CN110922455A - Pseudomonas aeruginosa vaccine recombinant protein repILA-FliC, and preparation method and application thereof - Google Patents

Abstract

The invention belongs to the technical field of bacterial antigens, and discloses a recombinant protein repILA-FliC of a pseudomonas aeruginosa vaccine, a preparation method and application thereof, wherein the nucleotide sequence of the recombinant protein repILA-FliC of the pseudomonas aeruginosa vaccine is SEQ ID NO. 1; the amino acid sequence is SEQ ID NO 2; the recombinant expression vector comprises a nucleotide sequence SEQ ID NO 1. The invention adopts pGEX-6p-2 vector to construct recombinant expression plasmid, and express recombinant protein repILA-FliC, pGEX is the vector for expressing fusion protein, and the expressed fusion protein contains a GST label for protein purification. Compared with other fusion vectors, the pGEX series vectors have the advantages of mild purification conditions, simple steps and no need of adding a denaturant, so that the spatial conformation and the immunogenicity of the purified protein can be kept to the maximum extent.

Description

Pseudomonas aeruginosa vaccine recombinant protein repILA-FliC, and preparation method and application thereof

Technical Field

The invention belongs to the technical field of bacterial antigens, and particularly relates to a pseudomonas aeruginosa vaccine recombinant protein repILA-FliC, a preparation method and an application thereof.

Background

Pseudomonas Aeruginosa (PA) is the most common pathogenic bacterium of nosocomial infections in patients with burns, war wounds, mechanical ventilation, etc., and can cause severe pneumonia, lung failure, sepsis and even death. The WHO listed PA as the second in the "new antibiotic research, discovery and global antibiotic-resistant bacteria priority list" published in 2017, thus indicating that health problems caused by the prevalence of PA infection are very serious. Because PA has multiple or pan-drug resistance to antibiotics, clinical therapeutic efficacy is very limited. The data show that the total PA separation rate was 8.69% in 2016, and especially the PA separation rate in mechanical ventilation pneumonia was as high as 22.9%. Annual resistance rates of PA to imipenem and meropenem have reached 23.6% and 20.9%. Due to the high clinical infection rate and the rising drug resistance rate of PA, the search for new "non-antibiotic therapies" is imminent.

Due to abuse of antibiotics and the like, the drug resistance problem of PA is gradually highlighted, and pan-drug-resistant pseudomonas aeruginosa (PDR-PA) and multi-drug-resistant pseudomonas aeruginosa (MDR-PA) appear, and the separation rate of drug-resistant PA is increased year by year. Starting from the immunology perspective, the development of safe and effective vaccines becomes the most ideal choice, but no pseudomonas aeruginosa vaccine on the market is available at present. In summary, the problems of the prior art are as follows: the key point of vaccine research is to find out an antigen with good immunogenicity and immune protection effect. The key to the development of genetically engineered vaccines is how to screen for good protective antigenic molecules from the thousands of pathogen proteomes.

The pilus (pilus) of the pseudomonas aeruginosa is polymerized by pilin (pilA), is positioned on the surface of bacteria, and participates in the physiological and pathogenic processes of the bacteria such as bacterial adhesion, peristalsis, biofilm formation, drug-resistant gene transfer and the like. In addition, the pseudomonas aeruginosa pilus can also stimulate the vaccine response of the host, and is a potential candidate vaccine antigen. Pilin protein PilA has been reported to have certain immunogenicity and to exert immunoprotective effects in mouse wound infection PA model, mouse burn infection PA model and mouse PA pneumonia infection model (Bakht Azad et al 2018, Banadkoki AZ et al 2016, Korpi F, et al 2016). However, the PilA protein alone used as a vaccine antigen has the problems of small molecular weight, weak immunogenicity, poor uniformity and the like.

Flagella are an elongated, curved, wavy, extra-large molecular protein machine that is widely present on bacterial surfaces. Is the major motor organ of bacteria (Haiko J et al 2013). The PA has 1-3 flagella at one end, is responsible for movement of bacteria, is also used as a main virulence factor, and plays a key role in pathogenic processes such as adhesion and colonization of bacteria, formation of a biological membrane, activation of TLR5 and induction of inflammatory response and the like (Klockgeter J and the like 2017). Flagella are ultra-large molecular protein machines composed of more than thirty proteins, and mainly comprise three parts, namely a Basal body part (Basal body), a flagella Hook (Hook) and a flagella Filament (fiber), wherein the flagella Filament assembled by flagella silk proteins (FliC) is positioned at the tail end of the flagella and is a main functional structural domain. FliC is one of the key targets for immunomodulation of PA infection, and vaccines and antibodies targeting FliC have been shown to have significant immunoprotective effects (SahaSukumar et al 2017, tanomandsghar et al 2013). However, natural FliC is difficult to prepare, easy to aggregate and degrade, and needs a denaturation and renaturation step, and the operation is complicated (CSobhanFaezi et al 2016), so that the application of vaccine antigen is difficult to meet.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a pseudomonas aeruginosa vaccine recombinant protein repILA-FliC, a preparation method and application thereof. The vaccine provided by the invention has the advantages of simple process, low cost, strong operability and the like.

The technical scheme of the invention is as follows:

the invention provides a pseudomonas aeruginosa vaccine recombinant protein repilA-FliC, and the amino acid sequence of the vaccine recombinant protein is shown as SEQ ID NO:2, respectively.

The recombinant protein is formed by flexibly connecting an active fragment of PilA protein and an active fragment of FliC protein through connecting peptide, the preferable connecting peptide is Linker, and the amino acid sequence structure of the connecting peptide is GSGGSG.

In a second aspect, the invention provides a gene encoding the vaccine recombinant protein as described above, wherein the nucleotide sequence of the gene is as shown in SEQ ID NO:1 is shown.

In a third aspect, the present invention provides an expression vector into which a gene as described above is inserted.

The expression vector is pGex series vector, pET series vector and pQE series vector, preferably pGex-6P-2.

In a fourth aspect, the present invention provides a host bacterium containing the expression vector as described above.

The host bacteria are Escherichia coli XL1-blue, BL21 series or HMS174 series, and preferably Escherichia coli XL 1-blue.

In a fifth aspect, the invention provides a recombinant protein of the pseudomonas aeruginosa vaccine as described above, and an application of the recombinant protein in preparation of medicines for preventing and/or treating pseudomonas aeruginosa infection.

The vaccine further comprises an adjuvant, preferably selected from the group consisting of aluminum hydroxide adjuvant, aluminum phosphate adjuvant, aluminum monostearate adjuvant, MF59 adjuvant, complete freund adjuvant, incomplete freund adjuvant, and mycobacterial bcg adjuvant.

In a sixth aspect, the invention provides a pseudomonas aeruginosa vaccine, which contains the vaccine recombinant protein as described above.

The seventh aspect of the invention provides a preparation method of a pseudomonas aeruginosa vaccine recombinant protein repilA-FliC, which comprises the following steps:

(1) culturing the host bacterium, and inducing the coding gene of the vaccine recombinant protein to express;

(2) separating and purifying the expressed vaccine recombinant protein.

The invention optimizes the sequencing mode of protein monomers and the connected Linker through the selection of rational design fusion fragments, and screens the soluble fusion modes of PilA and FliC from hundreds to thousands of designs on the basis of fully analyzing the molecular structure, surface charge distribution, structure accessibility and the like of the protein: i.e. rePilA-FliC. The protein is formed by fusing and connecting part of PilA protein (Ala35-Arg150) and part of FliC protein (Asn23-Ala401) through a flexible Linker-GSGGSG molecule, and the sequence is shown as SEQ ID NO. 2.

Connecting the fragments of PilA and FliC into a brand new protein repiA-FliC through a flexible Linker, wherein the connection mode from the N end to the C end sequentially comprises the following steps: PilA_{(Ala35-Arg150)}-FliC_{(Asn23-Ala401)}. Research results show that repiA-FliC has unique physicochemical properties and conformations, is expressed in soluble form in escherichia coli, stably exists in aqueous solution, avoids the problems of small PilA molecular weight, weak immunogenicity, difficult FliC preparation and poor stability, has better immunogenicity and immune protection effects, and has important significance for the next step of developing immune regulation means such as pseudomonas aeruginosa vaccines and the like. The vaccine has the advantages of simple process, low cost, strong operability and the like, and becomes an important direction for developing the vaccine.

The recombinant protein is cloned and expressed by adopting a genetic engineering technology, is convenient to separate and purify, can be directly matched with adjuvants (such as an aluminum hydroxide adjuvant, an aluminum phosphate adjuvant, an aluminum monostearate adjuvant, MF59, a complete Freund adjuvant, an incomplete Freund adjuvant, a mycobacteria BCG adjuvant and the like) for use, and is suitable for injection immunization.

The invention adopts pGEX-6p-2 vector to construct recombinant expression plasmid, and express recombinant protein repILA-FliC, pGEX is a vector for expressing fusion protein constructed by Smith and Johnson in 1987, and is mainly characterized in that the vector is connected with glutathione-S-transferase (GST) with molecular weight of 26kDa, and the expressed fusion protein contains a GST label which is a mark for protein purification. Compared with other fusion vectors, the pGEX series vectors have the advantages of mild purification conditions, simple steps and no need of adding a denaturant, so that the spatial conformation and the immunogenicity of the purified protein can be kept to the maximum extent.

The gene engineering recombinant repILA-FliC protein has the following advantages:

1) the recombinant repILA-FliC protein can induce animals to generate specific antibodies and has immune protection effect; the subunit vaccine prepared by the recombinant repILA-FliC protein can be used for immunization through a subcutaneous (intramuscular) injection way, and an organism is stimulated to generate high-titer IgG antibodies. Animal experiments prove that the repILA-FliC induced immune response has good protection effect on resisting PA infection.

2) The recombinant repILA-FliC protein can be expressed in a prokaryotic expression system, namely escherichia coli, and compared with the method for extracting the repILA and FliC from the thallus of natural pseudomonas aeruginosa and other recombinant expression systems, the recombinant repILA-FliC protein has low cost and high yield;

3) the recombinant repILA-FliC protein is a fusion protein, and one molecule only contains two protective antigens: PilA and FliC, two proteins of antigen PilA and FliC need to be prepared respectively in the original production method, but the invention can achieve the same effect only by preparing one protein. Therefore, the invention has simple production process and low production cost.

3) When pGEX vector series is selected, the repILA-FliC recombinant protein is expressed in a fusion protein form; the expression vector is connected with glutathione-S-transferase (GST) with the molecular weight of 26kDa, and the expressed fusion protein contains a GST label which not only serves as a marker for protein purification, but also can help repILA-FliC protein to keep the spatial conformation and immunogenicity of the repILA-FliC protein to the maximum extent.

Drawings

FIG. 1: the double restriction enzyme identification result of the recombinant plasmid pGex-6P-2-repILA-FliC, wherein lane 1: nucleic Acid (DNA) molecular weight standards (Marker), from top to bottom, are: 4500. 3000, 2000, 1200, 800, 500, 200 bp; lane 2: the recombinant expression plasmid pGEX-6p-2-repILA-FliC is subjected to enzyme digestion to obtain an identification result, and the fragment separated after enzyme digestion is about 5000bp and about 1500 bp;

FIG. 2: the protein rePilA-FliC induced identification result, wherein, lane 1: protein molecular weight standard (Marker), from top to bottom size: 170Kd, 130Kd, 100Kd, 70Kd, 55Kd, 40Kd, 35Kd, 25Kd, 15Kd, 10 Kd; (ii) a Lane 2: inducing the expressed ultrasonic supernatant; lane 3: (ii) Glutathione Sepharose4B filler bound to the induced expression supernatant; lane 4: supernatant obtained after enzyme digestion by PP enzyme; lane 5: glutathione Sepharose4B filler after PP enzyme digestion;

FIG. 3: the purified protein repilA-FliC SDS-PAGE result, wherein, lane 1: protein molecular weight standard (Marker), from top to bottom size: 170Kd, 130Kd, 100Kd, 70Kd, 55Kd, 40Kd, 35Kd, 25Kd, 15Kd, 10 Kd; lane 2: purified repilA-FliC protein.

Detailed Description

EXAMPLE 1 Synthesis and subcloning of the Gene

The repILA-FliC protein is formed by connecting a PilA protein (Ala35-Arg150) and a FliC protein (Asn23-Ala401) through fusion of a flexible Linker-GSGGSG molecule. The 5 'end of the coding sequence is introduced with BamHI enzyme cutting sequence, the 3' end is introduced with TGA stop codon and Xhol enzyme cutting sequence, the DNA sequence (SEQ ID NO: 2) of the recombinant plasmid pGEX-6p-reSBP-FliC and the repILA-FliC is synthesized by Shanghai biological engineering Limited company through the synthesis of the DNA sequence and the connection of the sequence and pGEX-6 p-2.

The amino acid sequence of the repILA-FliC is shown in SEQ ID NO:2, respectively.

AlaArgSerGluGlyAlaSerAlaLeuAlaSerValAsnProLeuLysThrThrValGluGluAlaLeuSerArgGlyTrpSerValLysSerGlyThrGlyThrGluAspAlaThrLysLysGluValProLeuGlyValAlaAlaAspAlaAsnLysLeuGlyThrIleAlaLeuLysProAspProAlaAspGlyThrAlaAspIleThrLeuThrPheThrMetGlyGlyAlaGlyProLysAsnLysGlyLysIleIleThrLeuThrArgThrAlaAlaAspGlyLeuTrpLysCysThrSerAspGlnAspGluGlnPheIleProLysGlyCysSerArgGlySerGlyGlySerGlyAsnAspLeuAsnThrSerLeuGlnArgLeuThrThrGlyTyrArgIleAsnSerAlaLysAspAspAlaAlaGlyLeuGlnIleSerAsnArgLeuSerAsnGlnIleSerGlyLeuAsnValAlaThrArgAsnAlaAsnAspGlyIleSerLeuAlaGlnThrAlaGluGlyAlaLeuGlnGlnSerThrAsnIleLeuGlnArgIleArgAspLeuAlaLeuGlnSerAlaAsnGlySerAsnSerAspAlaAspArgAlaAlaLeuGlnLysGluValAlaAlaGlnGlnAlaGluLeuThrArgIleSerAspThrThrThrPheGlyGlyArgLysLeuLeuAspGlySerPheGlyThrThrSerPheGlnValGlySerAsnAlaTyrGluThrIleAspIleSerLeuGlnAsnAlaSerAlaSerAlaIleGlySerTyrGlnValGlySerAsnGlyAlaGlyThrValAlaSerValAlaGlyThrAlaThrAlaSerGlyIleAlaSerGlyThrValAsnLeuValGlyGlyGlyGlnValLysAsnIleAlaIleAlaAlaGlyAspSerAlaLysAlaIleAlaGluLysMetAspGlyAlaIleProAsnLeuSerAlaArgAlaArgThrValPheThrAlaAspValSerGlyValThrGlyGlySerLeuAsnPheAspValThrValGlySerAsnThrValSerLeuAlaGlyValThrSerThrGlnAspLeuAlaAspGlnLeuAsnSerAsnSerSerLysLeuGlyIleThrAlaSerIleAsnAspLysGlyValLeuThrIleThrSerAlaThrGlyGluAsnValLysPheGlyAlaGlnThrGlyThrAlaThrAlaGlyGlnValAlaValLysValGlnGlySerAspGlyLysPheGluAlaAlaAlaLysAsnValValAlaAlaGlyThrAlaAlaThrThrThrIleValThrGlyTyrValGlnLeuAsnSerProThrAlaTyrSerValSerGlyThrGlyThrGlnAlaSerGlnValPheGlyAsnAlaSerAlaAlaGlnLysSerSerValAlaSerValAspIleSerThrAlaAspGlyAlaGlnAsnAla

The invention adopts pGEX-6p-2 vector to construct recombinant expression plasmid, and express recombinant protein repILA-FliC, pGEX is a vector which is constructed by Smith and Johnson in 1987 and expresses fusion protein, the vector is connected with glutathione-S-transferase (GST) with molecular weight of 26kDa, the expressed fusion protein only contains a GST label, and the label is a mark for protein purification.

The DNA sequence of repILA-FliC is shown in SEQ ID NO: 1:

GCACGTAGCGAAGGTGCAAGCGCACTGGCAAGCGTTAATCCGCTGAAAACCACCGTTGAAGAAGCACTGAGTCGCGGTTGGAGCGTTAAAAGCGGCACCGGCACCGAAGATGCAACCAAAAAAGAAGTTCCGCTGGGCGTTGCAGCAGATGCAAATAAACTGGGCACCATTGCACTGAAACCTGATCCGGCAGATGGCACCGCAGATATTACCCTGACCTTTACAATGGGTGGTGCAGGTCCGAAAAACAAAGGTAAAATCATTACACTGACCCGTACCGCAGCCGATGGTCTGTGGAAATGTACCAGCGATCAGGATGAACAGTTTATTCCGAAAGGTTGTAGCCGTGGTAGCGGTGGTAGTGGTAATGATCTGAATACCAGCCTGCAGCGTCTGACCACCGGTTATCGTATTAATAGCGCAAAAGATGATGCAGCAGGTCTGCAGATTAGCAATCGTCTGAGCAATCAGATTAGCGGTCTGAATGTTGCAACCCGTAATGCAAATGATGGTATTAGCCTGGCACAGACCGCAGAAGGTGCACTGCAGCAGAGCACCAATATTCTGCAGCGTATTCGTGATCTGGCACTGCAGAGCGCAAATGGTAGCAATAGTGATGCAGATCGTGCAGCCCTGCAGAAAGAAGTTGCAGCACAGCAGGCAGAACTGACCCGCATTAGCGATACCACCACCTTTGGTGGTCGTAAACTGCTGGATGGTAGCTTTGGTACAACCAGCTTTCAGGTGGGTAGCAATGCCTATGAAACCATTGATATTAGTCTGCAGAATGCAAGCGCCAGCGCCATTGGTAGCTATCAGGTTGGTTCAAATGGTGCAGGCACCGTTGCAAGCGTTGCAGGTACAGCAACCGCAAGCGGTATTGCCAGCGGTACAGTTAATCTGGTTGGTGGTGGTCAGGTTAAAAACATTGCCATTGCAGCCGGTGATAGCGCCAAAGCAATTGCAGAAAAAATGGATGGTGCAATTCCGAATCTGAGCGCACGTGCCCGTACCGTTTTTACCGCAGATGTTAGCGGTGTTACCGGTGGTAGCCTGAATTTTGATGTTACCGTTGGCAGCAATACCGTGAGCCTGGCAGGCGTTACCAGCACACAGGATCTGGCAGATCAGCTGAATAGCAATAGCAGCAAACTGGGTATTACCGCCAGCATTAATGATAAAGGTGTTCTGACCATTACCAGCGCAACCGGTGAAAATGTTAAATTTGGTGCGCAGACCGGTACGGCCACCGCAGGTCAGGTTGCAGTTAAAGTTCAGGGTTCAGATGGTAAATTTGAAGCCGCAGCAAAAAATGTTGTTGCAGCGGGTACAGCAGCAACCACCACAATTGTTACCGGCTATGTGCAGCTGAACAGCCCGACCGCATATAGCGTTAGTGGTACAGGCACCCAGGCAAGCCAGGTTTTTGGTAATGCCAGCGCAGCACAGAAAAGCAGCGTTGCAAGTGTGGATATTAGCACAGCTGATGGTGCACAGAATGCA

the preparation method of the pseudomonas aeruginosa vaccine recombinant protein repILA-FliC comprises the following steps:

step one, adding 400 mu L of pGEX-6p-2-repilA-FliC/XL-1blue bacterium liquid stored in a refrigerator at 4 ℃ for later use into 20mL of LB culture medium containing Amp resistance for primary activation, culturing at 200rpm at 37 ℃ for 5-6 h, adding 10mL of the primary activated bacterium liquid into 1000mL of LB culture medium containing Amp resistance for secondary activation, and culturing at 37 ℃ for 3-4 h until OD600 is 1.0;

step two, adding 200 microliter IPTG, placing the mixture in a shaking table at 16 ℃ for overnight induction, centrifuging at 12000rpm for 15min to collect thalli, adding 50mL of lysine buffer for re-suspending the thalli, carrying out ultrasonic lysis on bacterial liquid for 3min, and combining the collected supernatant with 10mL of Glutathione Sepharose4B gel beads for combining GST fusion protein;

and step three, adding 10mL PBS and 2mL PreScission protease into the remained 10mL protein-bound Glutathione Sepharose4B, vertically rotating at room temperature for digestion for 5h, centrifuging to absorb supernatant, taking 20 mu L of sample for denaturation treatment, loading 10 mu L of sample for protein electrophoresis, observing the result under a phase system, wherein the molecular weight of the digested repILA-FliC protein is 55kDa and is consistent with the expected molecular weight of the protein.

The method specifically comprises the following steps:

EXAMPLE 2 transformation and double restriction enzyme identification of recombinant plasmids

1. Transformation of recombinant plasmid 3 tubes of E.coli XL 1blue competent cells were taken from-80 ℃ freezer and 1ulpGEX-6p-repILA-FliC synthetic plasmid was added. Ice-bath for 10min, heat shock in 42 deg.C metal bath for 90s, and rapidly ice-bath for 2 min. Add 600. mu.l LB blank medium, mix well and shake for 1h at 220rpm in a 37 ℃ shaker. Centrifuge at 5000rpm for 3min at room temperature, discard 300. mu.l of supernatant, resuspend the cells, take 200. mu.l of coated, Amp-resistant LB plate. The plate was placed upside down in an incubator at 37 ℃ and incubated for 24 hours.

Well-separated colonies on the transformation plate were picked, inoculated in Amp-resistant LB medium, and shake-cultured overnight at 37 ℃.

2. Double enzyme digestion identification

The positive plasmids were subjected to shake culture at 37 ℃ overnight, and the plasmids of the positive clones were extracted by a rapid plasmid miniextraction kit (Tiangen Biochemical technology Co., Ltd.) according to the procedures of the specification. The digestion was carried out with BamHI (Takara Co.) and Xhol (Takara Co.) in a water bath at 37 ℃ for half an hour. The system is as follows:

pouring 1.0% agarose gel containing EB 0.5 μ g/ml, adding 1 μ l 6 × Loading buffer into the above digestion reaction system, performing gel 80V electrophoresis for 20min, and observing digestion result with UV scanner. As a result, the plasmid of the positive clone was found to be cut into 2 fragments, the large fragment of about 5000bp was part of the expression vector pGEX-6P-2, and the small fragment of about 1500bp was an inserted fragment encoding repILA-FliC (FIG. 1).

Example 3 identification of inducible expression, purification and expression form of recombinant fusion protein repILA-FliC in prokaryotic expression system-Escherichia coli

repILA-FliC inducible expression

1) Adding 100 mu L of overnight cultured pGEX-6P-2-repILA-FliC/XL-1blue bacterial liquid into 10mL of Amp + resistant LB culture medium, culturing overnight at the temperature of 180rpm and 37 ℃, adding 400 mu L of overnight cultured bacterial liquid into 20mL of Amp + resistant LB culture medium (the rest bacterial liquid is stored in a refrigerator at the temperature of 4 ℃ for later use), culturing at the temperature of 37 ℃ for 2-3 h at the rotation speed of 200rpm, performing secondary activation until OD600 is 0.8-1.0, adding 4 mu L of IPTG to enable the final concentration to be 200 mu M, and performing shake table induced expression at the temperature of 30 ℃ for induced expression for 3 h.

2) Taking out the bacteria liquid after induction expression, centrifuging at 12000rpm for 5min, discarding the supernatant, adding 1mL lysbuffer (20mM PB, pH 7.2,250mM Nacl), mixing well, performing ultrasonic lysis for 3min (ultrasonic lysis for 6 times and 30 s/time), centrifuging at 14000rpm for 15min at 4 ℃, and separating the supernatant and the precipitate.

2. Treating the supernatant

After washing 40. mu.l of Glutathione Sepharose4B with PBS 3 times, the prepared supernatant was added to Glutathione Sepharose4B and bound at room temperature for 1 hour. After centrifugation at 14000rpm for 3min at 4 ℃, washed 2 times with PBS-0.25% Tween 20 and once with PBS. 20ul of Glutathione Sepharose4B filler bound to the target protein was added to 20. mu.L of 2 XProtein loading buffer, boiled for 5min, and centrifuged at 14000rpm for 3min.

3. Preparation of enzyme-digested sample

Adding 80. mu.L PBS and 20. mu.L LPreScission protease (PP enzyme, GE company) to the remaining 20. mu.L of protein-bound Glutathione Sepharose4B filler, performing vertical rotary digestion at room temperature for 5 hours, centrifuging to extract the supernatant, and adding 20. mu.L of 6 XProtein loading buffer for sample preparation; the digested filler was washed 3 times with 200. mu.L PBS, then resuspended Glutathione Sepharose4B digested filler with 20. mu.L LPBS, and 20. mu.L of 2 XProtein loading buffer protein was added to prepare a sample.

SDS-PAGE electrophoresis

Pouring 5% concentrated glue into offset plate, adding distilled water to flatten the glue, standing at room temperature for 30min for solidification, pouring out the upper layer of distilled water, pouring 10% separation glue, immediately inserting comb, and standing at room temperature for 30min for solidification. 10. mu.L of each of the treated supernatant and the treated precipitate was subjected to SDS-PAGE. The voltage is firstly electrophoresed for 30min at 80v, then is adjusted to 180v, after electrophoresis is carried out for 1-2 h, the glue is taken out, is placed in Coomassie brilliant blue staining solution for oscillation staining, is placed in destaining solution for oscillation destaining, and then the result is observed under an imaging system: the repILA-FliC is fused with the GST tag and then expressed in a soluble form in escherichia coli, and the protein still exists stably after the GST tag is removed by enzyme digestion. (FIG. 2).

Example 4 preparation of repILA-FliC antigen

1. Amplifying culture to obtain protein

Adding 400 mu L of pGEX-6P-2-repILA-FliC/XL-1blue bacterium solution reserved in a refrigerator at 4 ℃ into 20mL of LB culture medium containing Amp resistance for primary activation, culturing at 200rpm and 37 ℃ for 5-6 h, adding 8mL of the primary activated bacterium solution into 400mL of LB culture medium containing Amp resistance for secondary activation, culturing at 37 ℃ for 3-4 h until OD600 is 1.0, adding 80 mu L of IPTG (with the final concentration of 200 mu M) into a shaking table at 16 ℃ for overnight induction, centrifuging at 12000rpm for 15min to collect bacteria, adding 20mL of lysine buffer (same as example 2) for re-suspension, carrying out ultrasonic lysis on the bacterium solution for 3min (200V), collecting supernatant, and combining with 800 mu L of Glutathione 4B (GE) gel beads (beads) for combining with GST fusion protein; then, SDS-PAGE gel electrophoresis was performed.

2. Separating the target protein from the GST tag by using an enzyme digestion method to obtain the repILA-FliC target protein

To the remaining approximately 800. mu.L of protein-bound Glutathione Sepharose4B, 800. mu.L of PBS and 120. mu.L of LPreScission protease (PP enzyme, GE Co., Ltd.) were added, and after vertically rotating and digesting at room temperature for 5 hours, the supernatant was centrifuged, washed 3 times with 800. mu.L of PBS, 10. mu.L of each sample was denatured, and 5. mu.L of each sample was subjected to protein electrophoresis (the same procedure as above), and the results were observed in the phase system, whereby the cleaved repILA-FliC protein had a molecular weight of 60 to 50kDa corresponding to the molecular weight of the desired protein, as shown in FIG. 3.

EXAMPLE 5 immunization of animals

1) 15 SPF-grade BALB/C6-8 week-old female mice are divided into an experimental group, an adjuvant control group and a negative control group, and 5 mice in each group are purchased from Beijing Huafukang company.

2) The first immunization, the repILA-FliC antigen was diluted with PBS, and Al (OH) was added at a concentration of 1mg/mL₃(ii) a The injection was made bilaterally intramuscularly in the thigh using a 5 gauge half-needle. Experimental groups Each BALB/C mouse was injected in an amount of 100. mu.L, containing repILA-FliC 50. mu.g and Al (OH)₃100 mu g; adjuvant control group injection amount of 100. mu.L/BALB/C mouse containing Al (OH)₃100 mu g; negative control group Each BALB/C mouse was injected with 100. mu.L PBS, containing no protein and Al (OH)₃An adjuvant.

2) The second immunization, the second immunization is carried out on the 14 th day, the immunization components are the same, the amount of the protein antigen injected is the same as that of the first immunization, and the immunization approaches are the same;

3) the third immunization, the third immunization is carried out on day 21, the immunization components are the same, the amount of the protein antigen injected is the same as that of the first immunization, and the immunization way is the same as that of the first immunization;

on day 7 after the third immunization, blood from BALB/C mice was collected, and the antigen-specific IgG response level after the mice were immunized was measured by ELISA.

EXAMPLE 6 detection of antibodies

1. Preparation of liquids

1) Preparation of coating liquid: weighing Na₂CO₃1.6 g，NaHCO₃2.9g in 1L ddH₂O, adjusting the pH to 9.6 by using a pH meter;

2) preparing a sealing liquid: 1g bovine serum V, dissolved in 100mL of antibody diluent (1: 100);

3) preparing an antibody diluent: dissolving phosphate in 1L ddH₂O, adding 500 mu L of Tween 20, and adjusting the pH to 7.4 by using a pH meter;

4) preparation of a washing solution: antibody dilution

5) A color developing solution (TMB) which is a product of Tiangen corporation;

6) stop solution (2M H)₂SO₄) The preparation of (1): 22.2mL of concentrated sulfuric acid was poured into 177.8mL of ddH₂And (4) in O.

ELISA detection of antibody titer generated by repILA-FliC recombinant protein immunized mice

1) The purified repILA-FliC recombinant protein was diluted to 6. mu.g/mL with the coating solution.

2) Coating: adding the recombinant protein diluent into an enzyme label plate, washing for 3 times by using a washing solution after overnight standing at 4 ℃, wrapping by using a preservative film after air drying, and placing in a refrigerator at 4 ℃ for later use;

3) and (3) sealing: adding 200 mu L of confining liquid into an ELISA plate per hole, placing the ELISA plate in an incubator at 37 ℃ for 2 hours, and washing for 3 times;

4) diluting the serum by 2 times such as 1:1000, 1:2000, 1:4000, 1:8000, etc.;

5) taking the sealed enzyme label plate, sequentially adding diluted serum with the concentration of 100 mu L/hole, placing the plate in an incubator at 37 ℃ for 1h, washing for 3 times, and drying in the air;

6) adding an HRP-labeled goat anti-mouse IgG antibody preservative solution, diluting 1: 5000, preparing an antibody working solution;

7) adding diluted antibody working solution at a concentration of 100 μ L/well, placing in an incubator at 37 deg.C for 40min, washing for three times, and air drying;

8) adding 100 mu L/hole of substrate color development liquid (TMB), and reacting for 5min at room temperature in a dark place;

9) adding stop solution (2M H)₂SO₄) Immediately placing the sample on an enzyme-labeling instrument and measuring the OD value at the wavelength of 450 nm;

10) and (5) judging a result: a. the_{Sample (I)}/A_{Negative of}The value ≧ 2.1 is positive (the negative control is the serum 1: 1000-fold dilution before mouse immunization).

As a result: detecting that the titer of an antibody generated by a repILA-FliC protein antigen immunized mouse reaches 1: 1024000; the antibody positive rate of 7 days after the third immunization reaches 100%, which indicates that the repILA-FliC recombinant protein constructed by the invention can enable an immunized mouse to generate an antibody in vivo. However, the antibody titers of the adjuvant control group and the negative control group did not change significantly.

Example 7 evaluation of the protection against challenge of animal immunization with repILA-FliC recombinant proteins

1) 90 SPF-grade BALB/C4-6 week-old female mice from Beijing Huafukang company are randomly divided into an experimental group, an adjuvant control group and a negative control group, and each group contains 30 mice. The protein composition, immunization time point and location of mice were the same as in example 5.

2) The challenge protection evaluation of rePilA-FliC recombinant protein animal immunity is according to the reference: gao Chen et al Clin Immunol2017,183, 354-363. Briefly, 10-14 days after the last immunization of repILA-FliC, PA XN-1 bacterial liquid is prepared and the concentration is adjusted to 1.5 × 10 by using physiological saline¹⁰CFU/mL, the mice were anesthetized with isoflurane and then infected by nasal drip, and the amount of infection per mouse was 20. mu.L. Observing mouse death every 1 day after infection, wherein the observation period is 7 days, and the rest animals are treated with CO after the observation period is over₂Inhalation euthanized. The survival rate of each group of mice was counted. The results are shown in Table 1.

TABLE 1 protective Effect of challenge after immunization of mice with repILA-FliC recombinant proteins

Table 1 shows: the survival rates of the adjuvant control group and the negative control group were 16.7% and 13.3%, respectively, and the recombinant fusion protein repILA-FliC was added with Al (OH)₃The survival rate of the adjuvant group was 83.3%, by the formula: the protection rate (control mortality-experimental mortality)/control mortality × 100% was calculated to be 80.7% for rePilA-FliC. Therefore, the repILA-FliC recombinant protein has good immunogenicity, can induce an organism to generate immune response, can play a role in protecting PA XN-1 infection, and can be supplemented with an aluminum adjuvant to prepare a subunit vaccine for preventing the infection of pseudomonas aeruginosa.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Sequence listing

<110> Chongqing Ailidi Biotech Co., Ltd

<120> pseudomonas aeruginosa vaccine recombinant protein repilA-FliC, preparation method and application

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>1503

<212>DNA

<213> DNA sequence of repILA-FliC (The DNA sequence of repILA-FliC)

<400>1

gcacgtagcg aaggtgcaag cgcactggca agcgttaatc cgctgaaaac caccgttgaa 60

gaagcactga gtcgcggttg gagcgttaaa agcggcaccg gcaccgaaga tgcaaccaaa 120

aaagaagttc cgctgggcgt tgcagcagat gcaaataaac tgggcaccat tgcactgaaa 180

cctgatccgg cagatggcac cgcagatatt accctgacct ttacaatggg tggtgcaggt 240

ccgaaaaaca aaggtaaaat cattacactg acccgtaccg cagccgatgg tctgtggaaa 300

tgtaccagcg atcaggatga acagtttatt ccgaaaggtt gtagccgtgg tagcggtggt 360

agtggtaatg atctgaatac cagcctgcag cgtctgacca ccggttatcg tattaatagc 420

gcaaaagatg atgcagcagg tctgcagatt agcaatcgtc tgagcaatca gattagcggt 480

ctgaatgttg caacccgtaa tgcaaatgat ggtattagcc tggcacagac cgcagaaggt 540

gcactgcagc agagcaccaa tattctgcag cgtattcgtg atctggcact gcagagcgca 600

aatggtagca atagtgatgc agatcgtgca gccctgcaga aagaagttgc agcacagcag 660

gcagaactga cccgcattag cgataccacc acctttggtg gtcgtaaact gctggatggt 720

agctttggta caaccagctt tcaggtgggt agcaatgcct atgaaaccat tgatattagt 780

ctgcagaatg caagcgccag cgccattggt agctatcagg ttggttcaaa tggtgcaggc 840

accgttgcaa gcgttgcagg tacagcaacc gcaagcggta ttgccagcgg tacagttaat 900

ctggttggtg gtggtcaggt taaaaacatt gccattgcag ccggtgatag cgccaaagca 960

attgcagaaa aaatggatgg tgcaattccg aatctgagcg cacgtgcccg taccgttttt 1020

accgcagatg ttagcggtgt taccggtggt agcctgaatt ttgatgttac cgttggcagc 1080

aataccgtga gcctggcagg cgttaccagc acacaggatc tggcagatca gctgaatagc 1140

aatagcagca aactgggtat taccgccagc attaatgata aaggtgttct gaccattacc 1200

agcgcaaccg gtgaaaatgt taaatttggt gcgcagaccg gtacggccac cgcaggtcag 1260

gttgcagtta aagttcaggg ttcagatggt aaatttgaag ccgcagcaaa aaatgttgtt 1320

gcagcgggta cagcagcaac caccacaatt gttaccggct atgtgcagct gaacagcccg 1380

accgcatata gcgttagtgg tacaggcacc caggcaagcc aggtttttgg taatgccagc 1440

gcagcacaga aaagcagcgt tgcaagtgtg gatattagca cagctgatgg tgcacagaat 1500

gca 1503

<210>2

<211>501

<212>PRT

<213> Amino acid sequence of repILA-FliC (Amino acid sequence of repILA-FliC)

<400>2

Ala Arg Ser Glu Gly Ala Ser Ala Leu Ala Ser Val Asn Pro Leu Lys

1 5 10 15

Thr Thr Val Glu Glu Ala Leu Ser Arg Gly Trp Ser Val Lys Ser Gly

20 25 30

Thr Gly Thr Glu Asp Ala Thr Lys Lys Glu Val Pro Leu Gly Val Ala

35 40 45

Ala Asp Ala Asn Lys Leu Gly Thr Ile Ala Leu Lys Pro Asp Pro Ala

50 55 60

Asp Gly Thr Ala Asp Ile Thr Leu Thr Phe Thr Met Gly Gly Ala Gly

65 70 75 80

Pro Lys Asn Lys Gly Lys Ile Ile Thr Leu Thr Arg Thr Ala Ala Asp

85 90 95

Gly Leu Trp Lys Cys Thr Ser Asp Gln Asp Glu Gln Phe Ile Pro Lys

100 105 110

Gly Cys Ser Arg Gly Ser Gly Gly Ser Gly Asn Asp Leu Asn Thr Ser

115 120 125

Leu Gln Arg Leu Thr Thr Gly Tyr Arg Ile Asn Ser Ala Lys Asp Asp

130 135 140

Ala Ala Gly Leu Gln Ile Ser Asn Arg Leu Ser Asn Gln Ile Ser Gly

145 150 155 160

Leu Asn Val Ala Thr Arg Asn Ala Asn Asp Gly Ile Ser Leu Ala Gln

165 170 175

Thr Ala Glu Gly Ala Leu Gln Gln Ser Thr Asn Ile Leu Gln Arg Ile

180 185 190

Arg Asp Leu Ala Leu Gln Ser Ala Asn Gly Ser Asn Ser Asp Ala Asp

195 200 205

Arg Ala Ala Leu Gln Lys Glu Val Ala Ala Gln Gln Ala Glu Leu Thr

210 215 220

Arg Ile Ser Asp Thr Thr Thr Phe Gly Gly Arg Lys Leu Leu Asp Gly

225 230 235 240

Ser Phe Gly Thr Thr Ser Phe Gln Val Gly Ser Asn Ala Tyr Glu Thr

245 250 255

Ile Asp Ile Ser Leu Gln Asn Ala Ser Ala Ser Ala Ile Gly Ser Tyr

260 265 270

Gln Val Gly Ser Asn Gly Ala Gly Thr Val Ala Ser Val Ala Gly Thr

275 280 285

Ala Thr Ala Ser Gly Ile Ala Ser Gly Thr Val Asn Leu Val Gly Gly

290 295 300

Gly Gln Val Lys Asn Ile Ala Ile Ala Ala Gly Asp Ser Ala Lys Ala

305 310 315 320

Ile Ala Glu Lys Met Asp Gly Ala Ile Pro Asn Leu Ser Ala Arg Ala

325 330 335

Arg Thr Val Phe Thr Ala Asp Val Ser Gly Val Thr Gly Gly Ser Leu

340 345 350

Asn Phe Asp Val Thr Val Gly Ser Asn Thr Val Ser Leu Ala Gly Val

355 360 365

Thr Ser Thr Gln Asp Leu Ala Asp Gln Leu Asn Ser Asn Ser Ser Lys

370 375 380

Leu Gly Ile Thr Ala Ser Ile Asn Asp Lys Gly Val Leu Thr Ile Thr

385 390 395 400

Ser Ala Thr Gly Glu Asn Val Lys Phe Gly Ala Gln Thr Gly Thr Ala

405 410 415

Thr Ala Gly Gln Val Ala Val Lys Val Gln Gly Ser Asp Gly Lys Phe

420 425 430

Glu Ala Ala Ala Lys Asn Val Val Ala Ala Gly Thr Ala Ala Thr Thr

435 440 445

Thr Ile Val Thr Gly Tyr Val Gln Leu Asn Ser Pro Thr Ala Tyr Ser

450 455 460

Val Ser Gly Thr Gly Thr Gln Ala Ser Gln Val Phe Gly Asn Ala Ser

465 470 475 480

Ala Ala Gln Lys Ser Ser Val Ala Ser Val Asp Ile Ser Thr Ala Asp

485 490 495

Gly Ala Gln Asn Ala

500

Claims (10)

1. The pseudomonas aeruginosa vaccine recombinant protein repilA-FliC is characterized in that the amino acid sequence of the vaccine recombinant protein is shown as SEQ ID NO:2, respectively.

2. The protein of claim 1, wherein: the recombinant protein is formed by flexibly connecting an active fragment of PilA protein and an active fragment of FliC protein through connecting peptide, the preferable connecting peptide is Linker, and the amino acid sequence structure of the connecting peptide is GSGGSG.

3. The gene of the recombinant protein of the vaccine of claim 1, wherein the nucleotide sequence of the gene is shown in SEQ ID NO:1 is shown.

4. An expression vector into which the gene according to claim 2 or 3 is inserted.

5. The expression vector of claim 4, wherein the expression vector is pGex series vector, pET series vector and pQE series vector, preferably pGex-6P-2.

6. A host bacterium which expresses the expression vector of claim 4 or 5.

7. The host bacterium of claim 6, wherein the host bacterium is escherichia coli XL1-blue, BL21 series, or HMS174 series, preferably escherichia coli XL 1-blue.

8. Use of the pseudomonas aeruginosa vaccine recombinant protein rePilA-FliC according to claim 1 in the preparation of a medicament for the prevention and/or treatment of pseudomonas aeruginosa infection.

9. Use according to claim 8, wherein the vaccine further comprises an adjuvant, preferably selected from the group consisting of aluminium hydroxide adjuvant, aluminium phosphate adjuvant, aluminium monostearate adjuvant, MF59 adjuvant, complete freund adjuvant, incomplete freund adjuvant and mycobacterial bcg adjuvant.

10. The method for preparing recombinant proteins for vaccines according to claim 1, comprising the steps of:

(1) culturing the host bacterium of claim 6, and inducing the expression of the gene encoding the vaccine recombinant protein;

(2) separating and purifying the expressed vaccine recombinant protein.

Images