CN108676079A - Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly - Google Patents
Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly Download PDFInfo
- Publication number
- CN108676079A CN108676079A CN201810555794.6A CN201810555794A CN108676079A CN 108676079 A CN108676079 A CN 108676079A CN 201810555794 A CN201810555794 A CN 201810555794A CN 108676079 A CN108676079 A CN 108676079A
- Authority
- CN
- China
- Prior art keywords
- pili
- amino acid
- conductive
- acid sequence
- types
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- H—ELECTRICITY
- H01—ELECTRIC ELEMENTS
- H01M—PROCESSES OR MEANS, e.g. BATTERIES, FOR THE DIRECT CONVERSION OF CHEMICAL ENERGY INTO ELECTRICAL ENERGY
- H01M8/00—Fuel cells; Manufacture thereof
- H01M8/16—Biochemical fuel cells, i.e. cells in which microorganisms function as catalysts
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E60/00—Enabling technologies; Technologies with a potential or indirect contribution to GHG emissions mitigation
- Y02E60/30—Hydrogen technology
- Y02E60/50—Fuel cells
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P70/00—Climate change mitigation technologies in the production process for final industrial or consumer products
- Y02P70/50—Manufacturing or production processes characterised by the final manufactured product
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biochemistry (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Gastroenterology & Hepatology (AREA)
- Sustainable Energy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Electrochemistry (AREA)
- Manufacturing & Machinery (AREA)
- Engineering & Computer Science (AREA)
- Sustainable Development (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to biotechnologies, and in particular to conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly.Technical scheme of the present invention can obtain following technical effect：(1) produce the present invention provides a kind of more convenient method for obtaining conductive four type pili and accordingly bacterial strain, make it possible conductive four type pili Material Field application；(2) the present invention provides the methods of the conductive four type pili electric conductivities of improvement；(3) the present invention provides a kind of methods increasing microbiological fuel cell electricity production.
Description
Technical field
The present invention relates to biotechnologies, and in particular to conductive four type pili and its encoding gene and contains the gene
Carrier and corresponding production bacterial strain and its application.
Background technology
Four type pili (Type IV pili, T4P) are present in nature majority bacterium, and function includes trembling ability
(twitching), in the transmission capacity etc. of the adsorption capacity of biology or inanimate surfaces, the intake ability of DNA and electronics.Four
Type fimbrial structure molecular weight of albumen is smaller, between 7-20kDa.The N-terminal structure of the structural proteins has conservative, that is,
One section of hydrophobic conservative alpha-helix (including one section of transmembrane domain and one section of interactions between protein structural domain), C-terminal configurations.Root
According to the homology of four type fimbriae genes, T4aP, two classes of T4bP can be divided into：The gene of T4aP class pili is relatively homologous, deposits
It is in many environmental microorganisms, such as pseudomonad, Shewanella (Shewanella), ground bacillus；The base of T4bP class pili
Because differentiation degree is larger, it is present in enterobacteriaceae lactobacteriaceae, such as Escherichia coli (Escherichia coli) and comma bacillus more
(Vibrio cholerae) etc..
Four type pili (GsPili) of sulphur reduction ground bacillus (Geobactersulfurreducens) belong to T4aP types, are
The putative four type pili of conduction with extracellular electron transmission ability unique so far, bioelectricity is developed into because it has
The potentiality of sub- material and known to scientists.The structural proteins PilA of the pili is by 61 Amino acid profiles.Sulphur also original place
Bacillus is strict anaerobes, slow-growing, limits exploitation of the four type pili of conduction of the bacterium in terms of bioelectronics material.
Invention content
Pseudomonad is widely present in natural environment, belongs to aerobic bacteria, and growth is fast, easily culture and genetic manipulation compared at
It is ripe.Wherein pseudomonas aeruginosa has electricity generation ability, is the bacterium that can be used for microbiological fuel cell.Microbiological fuel cell is
The electric energy generated using microorganism is as the device of the energy.Shewanella and sulphur reduction ground bacillus are microbiological fuel cell research
Type strain.The applicant of this invention has found in the recent period, using molecular biology method, can be obtained in pseudomonas aeruginosa
The four type pili of conduction for obtaining high-effective conductive, to there is the invention.
The first aspect of the invention provides a kind of conductive four types pili, the amino acid sequence of pilin PilA with
SEQ ID No：Amino acid sequence shown in 1 has at least 50% homology.
The second aspect of the present invention provides a genoid, the gene code conductive four type pili as described above.
The third aspect of the present invention provides a kind of carrier, which contains gene as described above.
The fourth aspect of the present invention provides a kind of corresponding bacterial strain producing above-mentioned conductive four types pili, which has such as
The upper gene or carrier as described above, and can be in the four type pili of conduction of phage surface high efficient expression conduction.
The fifth aspect of the present invention provides as described above conductive four type pili, gene as described above, as described above
The application in biological conductive material and/or microbiological fuel cell of carrier and bacterial strain as described above.
The sixth aspect of the present invention provides a kind of method of electricity production of the increase bacterium in microbiological fuel cell, should
Method includes：By the pilin (amino acid substitution, truncation etc.) of four type pili of genetically modified bacteria, to enhance four type pili
Conductive capability, to change electricity production of the bacterium in microbiological fuel cell.
Technical scheme of the present invention can obtain following technical effect：
(1) bacterial strain is produced the present invention provides a kind of more convenient method for obtaining conductive four type pili and accordingly, makes conduction
Four type pili are possibly realized in the application of Material Field；
(2) the present invention provides the methods of four type pili electric conductivities of improvement；
(3) the present invention provides a kind of methods increasing microbiological fuel cell electricity production.
Description of the drawings
Fig. 1 shows pseudomonas aeruginosa PAO1 (Figure 1A) and its Δ pilA (Figure 1B) mutant strains and Δ pilA/pPa61
The picture of (Fig. 1 C) under transmission electron microscope, wherein hollow arrow and F indicate that flagellum, filled arrows and P indicate four types
Pili.
Fig. 2 shows tetra- type pili of pseudomonas aeruginosa PAO1 (PaPilA pili) sample topography figure (Fig. 2A), expression
PaPilA truncated proteins (PaPilA1-61) corresponding bacterial strain four type pili (PaPilA1-61Pili) sample topography figure (Fig. 2 B) and
Expression increases by four type pili of the corresponding bacterial strain of the aromatic amino acid number destination protein in PaPilA truncated proteins
(PaPilA1-61M3Pili) sample topography figure (Fig. 2 C).
Fig. 3 shows tetra- type pili of pseudomonas aeruginosa PAO1 (PaPilA pili) sample current figure (Fig. 3 A), expression
PaPilA truncated proteins (PaPilA1-61) corresponding bacterial strain four type pili (PaPilA1-61Pili) sample current figure (Fig. 3 B) and
Expression increases by four type pili of the corresponding bacterial strain of the aromatic amino acid number destination protein in PaPilA truncated proteins
(PaPilA1-61M3Pili) sample current figure (Fig. 3 C).
Fig. 4 shows pseudomonas aeruginosa PAO1 tetra- type pili (PaPilA pili) sample I-V curve figures (Fig. 4 A), expression
PaPilA truncated proteins (PaPilA1-61) corresponding bacterial strain four type pili (PaPilA1-61Pili) sample I-V curve figure (figure
Four type pili of the corresponding bacterial strain of aromatic amino acid number destination protein 4B) and in expression increase PaPilA truncated proteins
(PaPilA1-61M3Pili) sample I-V curve figure (Fig. 4 C).PaPilA as shown in the figure1-61M3There is relatively best electric conductivity.
Fig. 5 shows tetra- type pili of pseudomonas aeruginosa PAO1 (PaPilA pili) sample, expression PaPilA truncated proteins
(PaPilA1-61) corresponding bacterial strain four type pili (PaPilA1-61Pili), the corresponding pili obtained by sulphur reduction ground bacillus PilA
(GsPilA pili) and expression increase the four of the corresponding bacterial strain of the aromatic amino acid number destination protein in PaPilA truncated proteins
Type pili (PaPilA1-61M3Pili) sample resistance view.PaPilA as shown in the figure1-61M3The resistance of pili is minimum, PaPilA
The resistance of pili is similar to GsPilA pili.
Fig. 6 shows biological production of the pseudomonas aeruginosa for expressing different conductive capability pili in microbiological fuel cell
Electricity.Detection bacterial strain is respectively wild type PAO1/pHerd20T, the mutant strain Δ pilA/pHerd20T for lacking PaPilA, expression
The bacterial strain Δ pilA/pPa of overall length PaPilA, the bacterial strain Δ pilA/pGs for expressing GsPilA, the bacterium for expressing PaPilA truncated proteins
Strain Δ pilA/pPa61 and expression increase the bacterial strain Δ pilA/pPa61M of PaPilA truncated protein aromatic amino acid numbers3(this
PHerd20T is vector plasmid in invention).
Specific implementation mode
The endpoint of disclosed range and any value are not limited to the accurate range or value herein, these ranges or
Value should be understood as comprising the value close to these ranges or value.For numberical range, between the endpoint value of each range, respectively
It can be combined with each other between the endpoint value of a range and individual point value, and individually between point value and obtain one or more
New numberical range, these numberical ranges should be considered as specific open herein.
A kind of conductive four types pili is provided according to the first aspect of the invention, the amino acid sequence of pilin PilA with
SEQ ID No：Amino acid sequence shown in 1 has at least 50% homology.
According to the present invention, pilin PilA amino acid sequences and the SEQ ID No of the conductive four types pili：Shown in 1
Amino acid sequence have at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%,
93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homology.
The present inventor has found that four type pilins truncate (sequence and SEQ ID No in the course of the study：1 institute
The amino acid sequence shown have at least 50% homology) after four type pili can not only be formed in Δ pilA deletion mycopremnas,
And compared to its full length sequence (for example, SEQ ID No：2) more excellent electronic transmission performance is also shown.Therefore, excellent
Choosing, the amino acid sequence such as SEQ ID No of the conductive four types pili：Shown in 1.
According to the present invention, the SEQ ID No：1 sequence is preferred from pseudomonas aeruginosa.Four types of pseudomonas aeruginosa
Fimbrial structure albumen (PaPilA) overall length is by 149 amino acid (SEQ ID No：2) it constitutes, with ground bacillus pilin
The N-terminal structure of GsPilA is identical, sequence similarity 51%, and the C-terminal architectural difference of two kinds of albumen is larger, the C-terminal of PaPilA
Structure is other than random coil, also α β-ring and beta sheet structure.The present inventor has found in the course of the study,
(SEQ ID No after the four type pili of pseudomonas aeruginosa truncate：1) more superior property can be shown in electron-transport
Energy.
According to a kind of specific embodiment of the present invention, the amino acid sequence of four type pili of conduction of the invention can also be
With SEQ ID No：Amino acid sequence change is carried out on the basis of amino acid sequence shown in 1, specifically, in SEQ ID
No：The substitution of one or several amino acid, but the amino acid obtained after replacing are carried out on the basis of amino acid sequence shown in 1
Sequence still has electronic transmission performance.
The present inventor is under study for action it has furthermore been found that by using aromatic amino acid to SEQ ID No：1 institute
The amino acid sequence obtained after the substitution of one or several non-aromatic amino acid in the amino acid sequence shown is formed by
Conductive four type pili can show more excellent performance in electron-transport.Therefore, according to a kind of preferred reality of the present invention
Mode is applied, the conductive four types pili has using aromatic amino acid substitution SEQ ID No：In amino acid sequence shown in 1
One or several non-aromatic amino acid amino acid sequence.
The present inventor also found under study for action, when the substituted site is located at SEQ ID No：Ammonia shown in 1
At least one in base acid sequence in the 38th, the 57th and the 63rd or the substituted site are located at SEQ ID No：2
Shown in amino acid sequence when at least one in the 38th, the 57th and the 63rd, be formed by conductive four type pili energy
It is enough that more excellent performance is shown in electron-transport.
According to a kind of preferred embodiment of the present invention, the substituted site is located at SEQ ID No：Amino shown in 1
The 38th, the 57th and the 63rd in acid sequence.
According to a kind of preferred embodiment of the present invention, the aromatic amino acid is phenylalanine, tyrosine and color ammonia
At least one of acid；According to further preferred embodiment of the present invention, the aromatic amino acid is phenylalanine and junket
Propylhomoserin.
It is further preferred that the amino acid sequence such as SEQ ID No of the conductive four types pili：Shown in 3.
According to the second aspect of the invention, a kind of gene is provided, the conduction described in gene code any one as above
Four type pili.
, it is understood that after having known corresponding amino acid sequence, those skilled in the art can be somebody's turn to do according to coding
The codon of amino acid knows the gene order of its coding.Also, well known, codon has degeneracy, therefore, the application institute
The corresponding gene for the coding conductive four type pili as described above stated, including the various gene sequences obtained by Codon degeneracy
Row.
According to a kind of preferred embodiment of the present invention, coding SEQ ID No：The gene of amino acid sequence shown in 1
Nucleotide sequence such as SEQ ID No：Shown in 4.
According to a kind of preferred embodiment of the present invention, coding SEQ ID No：The gene of amino acid sequence shown in 3
Nucleotide sequence such as SEQ ID No：Shown in 5.
According to the third aspect of the invention we, a kind of carrier is provided, which contains gene as described above.
According to the present invention, the various carriers that the carrier can be known in the art, those skilled in the art can basis
Actual demand selects suitable carrier, the carrier that can be but be not limited to plasmid pHerd20T.
According to the fourth aspect of the invention, a kind of thalline is provided, which has gene as described above, or as described above
Carrier.
Preferably, the one kind of the thalline in pseudomonas or genus Shewanella.More preferably pseudomonas aeruginosa.
Preferably bacteria is distributed widely in extremely strong survival ability in nature pseudomonas aeruginosa, obtains and cultivates extremely just
Profit, and genetic manipulation system is more perfect.Be conducive to a large amount of acquisitions of conductive four type pili.
In the present invention, the pseudomonas aeruginosa can be the existing pseudomonas aeruginosa with conductive four type pili,
But pseudomonas aeruginosa PAO1 specifically preferred according to the invention.Therefore, according to a kind of preferred embodiment of the present invention, the verdigris is false
Monad is pseudomonas aeruginosa PAO1.Wherein, obtaining for the pseudomonas aeruginosa PAO1 can be by conventional commercially available way
Diameter obtains, or is obtained by the available approach of others.The pseudomonas aeruginosa PAO1 is in document Genetic
recombination in Pseudomonas aeruginosa.J Gen Microbiol,1955.13(3):P.572-81 in
Detailed record is carried out.
According to the fifth aspect of the invention, as described above conductive four type pili, gene as described above, as above are provided
Application of the carrier or thalline as described above in biological conductive material and/or microbiological fuel cell.
According to the sixth aspect of the invention, a kind of side of electricity production of the increase bacterium in microbiological fuel cell is provided
Method, this method include：By the four type pilin of conduction (amino acid substitution, truncation etc.) of genetically modified bacteria, led with enhancing
The conductive capability of electric four type pili, to change electricity production of the bacterium in microbiological fuel cell.
The present invention will be described in detail by way of examples below, but does not limit the present invention.
Experimental method in following embodiments is unless otherwise specified conventional method.Examination as used in the following examples
Material is tested, is that conventional biochemical reagent company is commercially available unless otherwise specified.Quantitative test in following embodiment,
Three repeated experiments are set, and results are averaged.
Pseudomonas aeruginosa PAO1：Bibliography：Genetic recombination in Pseudomonas
aeruginosa.J Gen Microbiol,1955.13(3):p.572-81。
Pseudomonas aeruginosa PaPilA deletion mycopremnas (Δ pilA)：Bibliography：Functional expression of
heterologous type 4fimbriae in Pseudomonas aeruginosa.Gene,1996.175:p. 143–
150。
Pseudomonas aeruginosa PaPilA and FliC (flagellum major structural protein) double deletion mycopremnas (Δ pilA Δ fliC) structure
Construction method bibliography：A spider web strategy of type IV pili-mediated migration to
build a fibre-like Psl polysaccharide matrix in Pseudomonas aeruginosa
biofilms.Environ Microbiol,2013.15:p 2238-53。
LB solid mediums：Yeast extract 5g, tryptone 10g, NaCl 10g, agarose 20g, H2O 1000ml。
LB liquid medium：Yeast extract 5g, tryptone 10g, NaCl 10g, H2O 1000ml。
The use of antibiotic：
E. coli ampicillin (Amp) working concentration is 100 μ g/ml；Pseudomonas aeruginosa carbenicillin
(Carb) working concentration is 300 μ g/ml.
PaPilA protein expressing plasmids pPa's is configured to conventional cloning methods, plasmid pHerd20T bibliography used
PBAD-based shuttle vectors for functional analysis of toxic and highly
regulated genes in Pseudomonas and Burkholderia spp.and other bacteria.Appl
Environ Microbiol,2008.74(23):p.7422-6.Primer used is PaF：
GGAATTCGTGTTGGCGGACCAGCTT(SEQ ID No：6), PaR：
GGAATTCCATATGGAATCTCTCCGTTGATTATTATGTATAGG(SEQ ID No：7) (italic is restriction enzyme site).
PaPilA truncated proteins (PaPilA1-61) expression plasmid pPa61 structure, plasmid used is same as above, primer used
For PaF GGAATTCGTGTTGGCGGACCAGCTT (SEQ ID No：7), Pa61R：
CCCAAGCTTTTAAATTTTGCTACCAGCAATTCC(SEQ ID No：8).
PaPilA1-61Site directed mutant proteins (PaPilA1-61M3) expression plasmid pPa61M3Structure, plasmid used is same as above,
Directed mutagenesis method bibliography Site-directed mutagenesis.Methods Enzymol used, 2013.529:
p.241-8.Primer used is 32F： TATGTTGCGCGTTCGTATGGTGCTTCGGCG(SEQ ID No：9), 32R：
CGCCGAAGCACCATACGAACGCGCAACATA(SEQ ID No：10)；51F：
ACTGTTGAAGAGTCGTTCTCGCGTGGAATTGCT(SEQ ID No：11), 51R：
AGCAATTCCACGCGAGAACGACTCTTCAACAGT(SEQ ID No：12)；57F：
TCGCGTGGAATTGCTGGTAGCAAAATTAAAATT(SEQ ID No：13), 57R：
AATTTTAATTTTGCTACCAGCAATTCCACGCGA(SEQ ID No：14) (underscore part is mutant nucleotide sequence).
Microbiological fuel cell is conventional U-shaped dual chamber device, graphite electrode, external 1 kilo-ohm of resistance, bibliography
Photocatalytically improved azo dye reduction in a microbial fuel cell with
Rutile-cathode.Bioresour Technol, 2010.101 (10), the anode chambers 3500-5. are respectively provided with cathode chamber to be contained
There are M9 culture mediums (glucose 4g, disodium hydrogen phosphate 12.8g, potassium dihydrogen phosphate 3g, sodium chloride 0.5g, the chlorination of logarithmic phase bacterium solution
Ammonium 1g, 1mol/L magnesium sulfate 2ml, 1mol/L calcium chloride 100 μ l, H2O 1000ml) and 1mol/L Klorvess Liquids.Microorganism
Fuel cell produces electricity pressure and is measured by voltmeter, and electric current is converted by Ohm's law (voltage=electric current × resistance) and obtained.Work electricity
Biomass on extremely is measured by spectrophotometer.
Embodiment 1
The present embodiment is for illustrating PaPilA truncated proteins (PaPilA1-61) in pseudomonas aeruginosa Δ pilA bacterial strains
The formation of conductive four type pili.
(1) by pseudomonas aeruginosa PAO1/vector, PaPilA deletion mutations strain Δ pilA/vector and Δ pilA/
PPa61 is seeded in LB (Carb) solid medium tablets, and 37 DEG C stand overnight culture (vector is pHERD20T herein).
(2) from the list of picking PAO1/vector, Δ pilA/vector and Δ pilA/pPa61 on the tablet for completing step 1
Clone, is resuspended in 10 μ l distilled water, copper mesh is taken to be placed in 3s on bacteria suspension, and extra bacterium solution is siphoned away with filter paper, is repeated clear
After washing three times, dyeing processing is carried out to sample with 0.2% uranyl acetate, with four type of conduction of transmission electron microscope observation sample
Pili form.
The result is shown in Figure 1.It is observed that four types in PAO1/vector (Figure 1A), Δ pilA/pPa61 (Fig. 1 C) bacterium cell
Pili, and in Δ pilA/vector (Figure 1B) bacterium cell cannot, illustrate PaPilA truncated proteins (PaPilA1-61) can be in copper
Four type pili are formed in green pseudomonad.Wherein, hollow arrow and F indicate that flagellum, filled arrows and P indicate four type pili.
Embodiment 2
The present embodiment is used to illustrate the electron transmission ability of the four type pili of pseudomonas aeruginosa PAO1.
1, pseudomonas aeruginosa Δ pilA Δs fliC/pPa is seeded in LB (Carb) solid medium tablets, 37 DEG C
Stationary culture is stayed overnight.
2, from picking monoclonal on the tablet for completing step 1, it is seeded to LB (Carb) liquid added with 1 weight % arabinoses
In body culture medium, 37 DEG C of 200rpm shake cultures to OD600Value is 2 or so.
3, the bacterium solution in 1ml steps 2,13000g is taken to centrifuge 1min.Abandon supernatant.
4, the bacterial sediment for completing step 3 is resuspended in the 150mM ethanolamine solutions (pH 10.5) of 500 μ l, is placed in
On vortex oscillation instrument, gentle agitation 1min.
5, the bacterium solution 13000g for completing step 4 is centrifuged into 1min, retains supernatant.
6,10% ammonium sulfate of 500 μ l will be added in the supernatant for completing step 5, room temperature is positioned over after reverse mixing
3h。
7, step 3-6 is repeated, further to remove remaining bacterium cell.
8, the solution 13000g for completing step 7 is centrifuged into 1min, after abandoning supernatant, is resuspended in the 150mM ethanol amines of 100 μ l
Solution, and take 60 μ l drop in clean highly directional thermal cracking graphite (Highly Oriented Pyrolytic Graphite,
HOPG) in substrate, it is placed in ambient temperature overnight drying.
9, the HOPG completed in step 8 is placed in atomic force microscope (Bruker Icon), chooses PeakForce
Tuna modules, PeakForce Tuna probes are tested.Four type pili samples are first obtained under scan pattern (Scan mode)
Shape appearance figure (Height sensor image), then add the bias (sample bias voltage) of 2V in probe, obtain electric current
Scan pattern is then converted to incremental model (Ramp mode) by figure (Tuna current image), first obtains HOPG bases
The I-V curve figure at bottom, it is ensured that after probe has good conductive property, four type pili of 6-8 roots is chosen, wherein every four type pili
On take 6-8 point, acquire I-V curve figure.
After completing above-mentioned processing, data processing is carried out using 1.5 Software of Nanoscope Analysis.And according to
I-V curve figure extrapolates the resistance value of measured four type pili of conduction, wherein slope is bigger in I-V curve figure, illustrates sample
Product resistance value is smaller；Slope is smaller, illustrates that sample resistance value is bigger.
Wherein, tetra- type pili of pseudomonas aeruginosa PAO1 (PaPilA pili) sample topography figure is as shown in Figure 2 A, map of current
As shown in Figure 3A, I-V curve figure is as shown in Figure 4 A, and resistance is as shown in Figure 5.Pseudomonas aeruginosa PaPilA full-length proteins
(PaPilA) slope of the I-V curve of four type pili is less than normal, and sample resistance value is about 505M Ω, has the function of electron transmission.
Embodiment 3
The present embodiment expresses PaPilA truncated proteins (PaPilA for illustrating1-61) Δ pilA Δ fliC bacterial strains four types
Pili electric conductivity.
1, pseudomonas aeruginosa Δ pilA Δs fliC/pPa61 is seeded in LB (Carb) solid medium tablets, 37 DEG C
Stationary culture is stayed overnight.
2, the step 2-9 in embodiment 2 is repeated.
Wherein, expression PaPilA truncated proteins (PaPilA1-61) Δ pilA Δ fliC bacterial strains four type pili
(PaPilA1-61Pili) sample topography figure is as shown in Figure 2 B, and map of current is as shown in Figure 3B, and I-V curve figure is as shown in Figure 4 B, resistance
As shown in Figure 5.PaPilA1-61The I-V curve figure slope of four type pili is greater than PaPilA, and resistance value is about 25M Ω, is
The 1/20 of PaPilA full-length proteins.Illustrate PaPilA after C-terminal truncation, its electron transmission ability can be enhanced.
Embodiment 4
The present embodiment is used to illustrate to increase the aromatic amino acid number (PaPilA in PaPilA truncated proteins1-61M3)
Four type pili electric conductivities of corresponding bacterial strain.
1, by pseudomonas aeruginosa Δ pilA Δs fliC/pPa61M3It is seeded in LB (Carb) solid medium tablets, 37
DEG C stationary culture is stayed overnight.
2, with the step 2 in embodiment 3.
Wherein, increase by four type pili of the corresponding bacterial strain of the aromatic amino acid number in PaPilA truncated proteins
(PaPilA1-61M3Pili) sample topography figure is as shown in Figure 2 C, and map of current is as shown in Figure 3 C, and I-V curve figure is as shown in Figure 4 C, electricity
Resistance is as shown in Figure 5.PaPilA1-61M3The I-V curve figure slope of four type pili is greater than PaPilA1-61, resistance value is about 3.6M
Ω is PaPilA1-611/7, PaPilA 1/140.Illustrate to increase PaPilA1-61In aromatic amino acid number, can be with
Further enhance the electron transmission ability of its four types pili.
This patent has detected four type pili of pseudomonas aeruginosa PAO1 bacterial strain PaPilA full-length proteins and PaPilA truncates egg
The conductive capability of four type pili of white four types pili and corresponding point mutation.It was found that the truncation of the C-terminal structure with PaPilA, electronics
Transmission capacity is enhanced, meanwhile, with truncated protein PaPilA1-61The increase of middle aromatic amino acid number, electronics pass
The ability of passing further enhances.
Embodiment 5
The present embodiment is used to illustrate to express the electricity production of the Δ pilA bacterial strains of PaPilA truncated proteins.
1, by PAO1/pHerd20T, the mutant strain Δ pilA/pHerd20T of missing overall length PaPilA, expression overall length
The bacterial strain Δ pilA/pPa of PaPilA, the bacterial strain Δ pilA/pGs for expressing GsPilA, the bacterial strain Δ for expressing PaPilA truncated proteins
PilA/pPa61 and expression increase the bacterial strain Δ pilA/pPa61M of the aromatic amino acid number of PaPilA truncated proteins3
(pHerd20T is vector plasmid) is seeded in LB (Carb) solid medium tablets, and 37 DEG C of stationary cultures are stayed overnight.
2, from the tablet completed in step 1, picking monoclonal bacterial strain is in the 200ml LB of 1 weight % arabinoses
(Carb) in fluid nutrient medium, 37 DEG C of 200rpm shake cultures to OD600Value is 0.5 or so.
3, the bacterium solution in step 2 will be completed, 13000g centrifuges 4min, after abandoning supernatant, is resuspended in the M9 culture mediums of 200ml
In, by the bacterium solution after resuspension, inject sterilized anode of microbial fuel cell room.
4,150ml 1M Klorvess Liquids are injected to microbiological fuel cell.
5, primary voltage value is measured every 1h multimeters.
6, it waits after cultivating, working electrode is taken out, be put into the distilled water equipped with 200ml, it will with ultrasonic vibration instrument
After bacterium in working electrode is resuspended in distilled water, spectrophotometer measurement OD600。
The Δ pilA bacterial strains of PaPilA truncated proteins are expressed, biological electricity production improves for comparing PAO1/vector
About 3.3 times (Fig. 6).
The preferred embodiment of the present invention has been described above in detail, and still, the present invention is not limited thereto.In the skill of the present invention
In art conception range, technical scheme of the present invention can be carried out a variety of simple variants, including each technical characteristic with it is any its
Its suitable method is combined, and it should also be regarded as the disclosure of the present invention for these simple variants and combination, belongs to
Protection scope of the present invention.
Sequence table
<110>Institute of Microorganism, Academia Sinica
<120>Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly
<130> wsw
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 67
<212> PRT
<213> P.Aeruginosa
<400> 1
Met Lys Ala Gln Lys Gly Phe Thr Leu Ile Glu Leu Met Ile Val Val
1 5 10 15
Ala Ile Ile Gly Ile Leu Ala Ala Ile Ala Ile Pro Gln Tyr Gln Asn
20 25 30
Tyr Val Ala Arg Ser Glu Gly Ala Ser Ala Leu Ala Thr Ile Asn Pro
35 40 45
Leu Lys Thr Thr Val Glu Glu Ser Leu Ser Arg Gly Ile Ala Gly Ser
50 55 60
Lys Ile Lys
65
<210> 2
<211> 149
<212> PRT
<213> P.Aeruginosa
<400> 2
Met Lys Ala Gln Lys Gly Phe Thr Leu Ile Glu Leu Met Ile Val Val
1 5 10 15
Ala Ile Ile Gly Ile Leu Ala Ala Ile Ala Ile Pro Gln Tyr Gln Asn
20 25 30
Tyr Val Ala Arg Ser Glu Gly Ala Ser Ala Leu Ala Thr Ile Asn Pro
35 40 45
Leu Lys Thr Thr Val Glu Glu Ser Leu Ser Arg Gly Ile Ala Gly Ser
50 55 60
Lys Ile Lys Ile Gly Thr Thr Ala Ser Thr Ala Thr Glu Thr Tyr Val
65 70 75 80
Gly Val Glu Pro Asp Ala Asn Lys Leu Gly Val Ile Ala Val Ala Ile
85 90 95
Glu Asp Ser Gly Ala Gly Asp Ile Thr Phe Thr Phe Gln Thr Gly Thr
100 105 110
Ser Ser Pro Lys Asn Ala Thr Lys Val Ile Thr Leu Asn Arg Thr Ala
115 120 125
Asp Gly Val Trp Ala Cys Lys Ser Thr Gln Asp Pro Met Phe Thr Pro
130 135 140
Lys Gly Cys Asp Asn
145
<210> 3
<211> 67
<212> PRT
<213> P.Aeruginosa
<400> 3
Met Lys Ala Gln Lys Gly Phe Thr Leu Ile Glu Leu Met Ile Val Val
1 5 10 15
Ala Ile Ile Gly Ile Leu Ala Ala Ile Ala Ile Pro Gln Tyr Gln Asn
20 25 30
Tyr Val Ala Arg Ser Tyr Gly Ala Ser Ala Leu Ala Thr Ile Asn Pro
35 40 45
Leu Lys Thr Thr Val Glu Glu Ser Phe Ser Arg Gly Ile Ala Tyr Ser
50 55 60
Lys Ile Lys
65
<210> 4
<211> 201
<212> DNA
<213> P.Aeruginosa
<400> 4
atgaaagctc aaaaaggctt taccttgatc gaactgatga tcgtggttgc gatcatcggt 60
atcctggcgg caattgccat tccccagtat cagaactatg ttgcgcgttc ggaaggtgct 120
tcggcgctgg cgacgatcaa cccgctgaag accactgttg aagagtcgct gtcgcgtgga 180
attgctggta gcaaaattta a 201
<210> 5
<211> 201
<212> DNA
<213> P.Aeruginosa
<400> 5
atgaaagctc aaaaaggctt taccttgatc gaactgatga tcgtggttgc gatcatcggt 60
atcctggcgg caattgccat tccccagtat cagaactatg ttgcgcgttc gtatggtgct 120
tcggcgctgg cgacgatcaa cccgctgaag accactgttg aagagtcgtt ctcgcgtgga 180
attgcttata gcaaaattta a 201
<210> 6
<211> 25
<212> DNA
<213> P.Aeruginosa
<400> 6
ggaattcgtg ttggcggacc agctt 25
<210> 7
<211> 42
<212> DNA
<213> P.Aeruginosa
<400> 7
ggaattccat atggaatctc tccgttgatt attatgtata gg 42
<210> 8
<211> 33
<212> DNA
<213> P.Aeruginosa
<400> 8
cccaagcttt taaattttgc taccagcaat tcc 33
<210> 9
<211> 30
<212> DNA
<213> P.Aeruginosa
<400> 9
tatgttgcgc gttcgtatgg tgcttcggcg 30
<210> 10
<211> 30
<212> DNA
<213> P.Aeruginosa
<400> 10
cgccgaagca ccatacgaac gcgcaacata 30
<210> 11
<211> 33
<212> DNA
<213> P.Aeruginosa
<400> 11
actgttgaag agtcgttctc gcgtggaatt gct 33
<210> 12
<211> 33
<212> DNA
<213> P.Aeruginosa
<400> 12
agcaattcca cgcgagaacg actcttcaac agt 33
<210> 13
<211> 33
<212> DNA
<213> P.Aeruginosa
<400> 13
tcgcgtggaa ttgctggtag caaaattaaa att 33
<210> 14
<211> 33
<212> DNA
<213> P.Aeruginosa
<400> 14
aattttaatt ttgctaccag caattccacg cga 33
Claims (10)
1. a kind of conductive four types pili, which is characterized in that the amino acid sequence of the pilin PilA of the four type pili of conduction with
SEQ ID No：Amino acid sequence shown in 1 has at least 50% homology.
2. conductive four types pili according to claim 1, wherein the ammonia of the pilin PilA of the conductive four types pili
Base acid sequence such as SEQ ID No：Shown in 1.
3. conductive four types pili according to claim 1, wherein the pilin PilA of the conductive four types pili has
In SEQ ID No：After replacing one or several amino acid and still with electronic transmission performance in amino acid sequence shown in 1
Amino acid sequence；
Preferably, the pilin PilA of the conductive four types pili has using aromatic amino acid substitution SEQ ID No：1
Shown in one or several non-aromatic amino acid in amino acid sequence amino acid sequence；
Preferably, the site of the PilA substitutions is selected from SEQ ID No：38 amino acids-paddy in amino acid sequence shown in 1
Propylhomoserin, 57 amino acids-leucine and 63 amino acids-glycine.
4. conductive four types pili according to claim 3, wherein the aromatic amino acid is phenylalanine, tyrosine
At least one of with tryptophan；
Preferably, the aromatic amino acid is tyrosine and phenylalanine.
5. conductive four types pili according to claim 4, wherein the amino acid sequence of the pilin PilA of the pili
Such as SEQ ID No：Shown in 3.
6. a genoid, which is characterized in that the four type pili of conduction described in any one of gene code claim 1-5.
7. a kind of carrier, which is characterized in that the carrier contains the gene described in claim 6.
8. the corresponding bacterial strain of the above-mentioned conductive four types pili of production, which is characterized in that such bacterial strain has the base described in claim 6
Carrier described in cause or claim 7；
Preferably, which is selected from least one of pseudomonad (Pseudomonas) and Shewanella (Shewanella).
9. the gene described in four type pili of conduction, claim 6 described in any one of claim 1-5, claim 7 institute
Application of the carrier or thalline according to any one of claims 8 stated in biological conductive material and/or microbiological fuel cell.
10. a kind of method increasing electricity production of the bacterium in microbiological fuel cell, which is characterized in that this method includes：It is logical
The pilin (amino acid substitution, truncation etc.) for crossing four type pili of genetically modified bacteria, to enhance the conductive capability of four type pili,
To change electricity production of the bacterium in microbiological fuel cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810555794.6A CN108676079A (en) | 2018-05-31 | 2018-05-31 | Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810555794.6A CN108676079A (en) | 2018-05-31 | 2018-05-31 | Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108676079A true CN108676079A (en) | 2018-10-19 |
Family
ID=63809422
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810555794.6A Pending CN108676079A (en) | 2018-05-31 | 2018-05-31 | Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108676079A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922455A (en) * | 2019-12-28 | 2020-03-27 | 重庆艾力彼生物科技有限公司 | Pseudomonas aeruginosa vaccine recombinant protein repILA-FliC, and preparation method and application thereof |
| CN111430764A (en) * | 2020-04-01 | 2020-07-17 | 广东工业大学 | Pseudomonas-anode photosynthetic solar fuel cell system and preparation method and application thereof |
| CN114409746A (en) * | 2022-01-07 | 2022-04-29 | 深圳市灵蛛科技有限公司 | Polypeptide and polynucleotide and battery thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103184185A (en) * | 2013-01-29 | 2013-07-03 | 南京工业大学 | Structure, bacterial strain and application of electrogenesis genetically engineered bacterium |
| WO2017015306A2 (en) * | 2015-07-20 | 2017-01-26 | University Of Massachusetts | Microbial nanowires with increased conductivity and reduced diameters |
-
2018
- 2018-05-31 CN CN201810555794.6A patent/CN108676079A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103184185A (en) * | 2013-01-29 | 2013-07-03 | 南京工业大学 | Structure, bacterial strain and application of electrogenesis genetically engineered bacterium |
| WO2017015306A2 (en) * | 2015-07-20 | 2017-01-26 | University Of Massachusetts | Microbial nanowires with increased conductivity and reduced diameters |
Non-Patent Citations (2)
| Title |
|---|
| CARMEN L.GILTNER 等: "Evolutionary and functional diversity of the Pseudomonas type IVa pilin island", 《ENVIRONMENTAL MICROBIOLOGY》 * |
| 刘星: "菌毛及纳米材料对地杆菌胞外电子传递影响的研究", 《中国博士学位论文全文数据库医药卫生科技辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110922455A (en) * | 2019-12-28 | 2020-03-27 | 重庆艾力彼生物科技有限公司 | Pseudomonas aeruginosa vaccine recombinant protein repILA-FliC, and preparation method and application thereof |
| CN110922455B (en) * | 2019-12-28 | 2023-01-13 | 重庆艾力彼生物科技有限公司 | Pseudomonas aeruginosa vaccine recombinant protein repILA-FliC, and preparation method and application thereof |
| CN111430764A (en) * | 2020-04-01 | 2020-07-17 | 广东工业大学 | Pseudomonas-anode photosynthetic solar fuel cell system and preparation method and application thereof |
| CN114409746A (en) * | 2022-01-07 | 2022-04-29 | 深圳市灵蛛科技有限公司 | Polypeptide and polynucleotide and battery thereof |
| CN114409746B (en) * | 2022-01-07 | 2024-02-02 | 深圳市灵蛛科技有限公司 | Polypeptide and polynucleotide and battery thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20180111968A1 (en) | Cell-directed synthesis of multifunctional nanopatterns and nanomaterials | |
| CN108676079A (en) | Conductive four type pili and its encoding gene and the carrier containing the gene and production bacterial strain and its application accordingly | |
| Schleper et al. | Picrophilus gen. nov., fam. nov.: a novel aerobic, heterotrophic, thermoacidophilic genus and family comprising archaea capable of growth around pH 0 | |
| Ghanem et al. | An alkalophilic thermostable lipase produced by a new isolate of Bacillus alcalophilus | |
| Timmusk et al. | Plant root associated biofilms: perspectives for natural product mining | |
| Chen et al. | Enterococcus faecalis PcfC, a spatially localized substrate receptor for type IV secretion of the pCF10 transfer intermediate | |
| Feng et al. | Rational design of xylose dehydrogenase for improved thermostability and its application in development of efficient enzymatic biofuel cell | |
| Panosyan et al. | Geothermal springs in Armenia and Nagorno-Karabakh: potential sources of hydrolase-producing thermophilic bacilli | |
| CN108315288A (en) | A kind of recombination bacillus coli and its construction method and the application of expression formamidase and phosphorous acid dehydrogenase fusion proteins | |
| CN108118043B (en) | Lipase mutant with improved heat stability | |
| CN112680433A (en) | Method for producing and secreting protein by using halophilic bacteria | |
| KR101103022B1 (en) | Organophosphorus Hydrolase Variants and Method for Preparing the Same | |
| Jung et al. | Bacterial cell surface display of lipase and its randomly mutated library facilitates high-throughput screening of mutants showing higher specific activities | |
| Hung et al. | Mutation in the Xanthomonas campestris xanA gene required for synthesis of xanthan and lipopolysaccharide drastically reduces the efficiency of bacteriophage ΦL7 adsorption | |
| WO2019168163A1 (en) | Transformant, and method using said transformant to detect presence or absence of reduced phosphorous compound | |
| Herrera Seitz et al. | A chemoreceptor from Pseudomonas putida forms active signalling complexes in Escherichia coli | |
| Yahiaoui et al. | Identification and characterization of a highly chitinase producing Paenibacillus timonensis strain LK-DZ15 isolated from Djurdjura Mountains in Kabylia, Algeria | |
| DK2582810T3 (en) | Ulvanlyase, method of producing it and uses thereof | |
| Adhikari et al. | Polyphasic analysis of two thermotolerant, and exozymes producing Geobacillus species from hot spring of Nepal | |
| US20150322423A1 (en) | Protein alignment method | |
| EP2041285B1 (en) | Nucleic acid molecules encoding an enzyme that degrades long-chain n-alkenes | |
| Yue et al. | Study on thermostability of Bacillus subtilis lipase by site-directed mutagenesis | |
| Hnatush et al. | Bacteria of the genus Pseudomonas isolated from Antarctic substrates | |
| CN108841807A (en) | A kind of lipase mutant that thermal stability improves | |
| CN112195121B (en) | High-temperature-resistant micro bacillus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20181019 |
|
| WD01 | Invention patent application deemed withdrawn after publication |