CN110903381B - Peptide KAI11 for promoting cartilage regeneration and application thereof - Google Patents

Abstract

The invention discloses a peptide KAI11 for promoting cartilage regeneration, which has more than 9/11 sequence consistency compared with an amino acid sequence shown in SEQ ID NO. 1. The peptide KAI11 of the invention is derived from BMP-7, can obviously promote cartilage regeneration, and has the advantages of easy synthesis, low immunogenicity and the like, so the polypeptide of the invention has wide application prospect in cartilage injury repair and osteoarthritis treatment.

Description

Peptide KAI11 for promoting cartilage regeneration and application thereof

Technical Field

The invention relates to the technical field of polypeptides, in particular to a peptide KAI11 for promoting cartilage regeneration and application thereof.

Background

Osteoarthritis (OA) is a common joint disease manifested by joint pain, stiffness, and cartilage damage is the major cause of osteoarthritis. The disease is common after middle age, more female than male, with prevalence of 10% -17% in 40 years old, 50% above 60 years old, and up to 80% above 75 years old. The disability rate of the disease can reach 53 percent. With the increasing aging of the population, osteoarthritis becomes an important problem affecting the quality of life of people, and the market demand of osteoarthritis drugs is continuously expanded.

At present, the treatment medicaments for osteoarthritis clinically comprise specific treatment medicaments and non-specific treatment medicaments. Non-specific therapeutic drugs, such as non-steroidal anti-inflammatory drugs, are mainly used for analgesia and symptom control, but have no protective effect on cartilage. Specific therapeutic drugs can protect articular cartilage and delay the progress of osteoarthritis, such as glucosamine, chondroitin sulfate and the like, but generally have slow effect, take effect after being treated for several months, and have no effect on the regeneration of damaged cartilage. Therefore, the development of a novel osteoarthritis treatment drug with good safety and outstanding curative effect becomes a large target in the medical field.

As described above, cartilage damage is the major cause of osteoarthritis, and articular cartilage is composed of abundant extracellular matrix (ECM) and a few chondrocytes embedded therein. The metabolism of chondrocytes is regulated by many cytokines, such as bone morphogenetic protein 7(BMP-7) and the like. BMP-7 is a member of TGF- β superfamily, which is a transforming growth factor, and is an important active substance involved in the formation of cartilage and bone tissues, and can promote the development of cartilage and bone and repair of defects (see non-patent documents 1, 2, and 3). BMP-7 has not been reported in the literature that a certain polypeptide has the activity of promoting cartilage regeneration.

Reference documents:

non-patent document 1: zhou JJ, Yu GR, Cao CF, et a1.bone morphogenetic protein-7 proteins chorogenesis in human amniotic epithelial cells. int ortho op, 2011, 35 (6): 941-948. DOI: 10.1007/s00264-010-1116.3.

Non-patent document 2: hayashi M, Sekiya I, Muneta T, et a1. weikly intra-annular injections of bone morpholinogenic protein-7 inhibitors osteo characterization [ J ]. jarthrotis Res Ther, 2018, 10 (5): r118. doi: 10.1186/ar2521.

Non-patent document 3: kang Q, Song WX, Luo Q, et a1. comprehensive analytical of the dual roles of BMPs in regulating additive and ecological differentiation of sensory promoter Cells [ J ]. Stem Cells Dev, 2009, 18 (4): 545-559. DOI: 10.1089/scd.2008.0130.

Disclosure of Invention

Based on the above problems, the present invention aims to overcome the disadvantages of the prior art and provide a peptide KAI11 which can significantly promote cartilage regeneration.

In order to achieve the purpose, the invention adopts the technical scheme that: a peptide KAI11 for promoting cartilage regeneration, which has a sequence identity of 9/11 or more compared with the amino acid sequence shown in SEQ ID NO. 1.

Preferably, the amino acid sequence of peptide KAI11 is shown in SEQ ID No. 1. The peptide for promoting the cartilage regeneration comprises but is not limited to amino acid shown in SEQ ID NO.1, and can also be polypeptide which has 9/11, 10/11 or 11/11 sequence identity compared with the amino acid sequence shown in SEQ ID NO.1 and can promote the cartilage regeneration.

Preferably, the carboxy terminus of peptide KAI11 has an amidation or carbonylation modification, more preferably an amidation modification.

As another aspect of the invention, the invention also provides the use of the peptide KAI11 as defined above in the manufacture of a medicament for the treatment of cartilage repair or/and osteoarthritis.

As a further aspect of the invention, the invention provides a medicament for the treatment of cartilage repair or/and osteoarthritis comprising the peptide KAI11 described above. It is noted that the peptide KAI11 in the medicament may also be an acetate, a hydrochloride or a phosphate salt of the peptide, preferably an acetate salt.

Preferably, the medicament also contains hyaluronic acid or a non-steroidal anti-inflammatory drug.

Preferably, the effective dose of the medicine is 1-5 mg each time.

Preferably, the medicament further comprises a pharmaceutically acceptable carrier, preferably a saline solution or a colloidal solution. Wherein, the medicine can be administrated by injection, preferably knee joint cavity injection or subcutaneous injection.

Preferably, the colloidal solution is a hyaluronic acid gel.

In conclusion, the beneficial effects of the invention are as follows:

the peptide KAI11 of the invention is derived from BMP-7, can obviously promote cartilage regeneration, and has the advantages of easy synthesis, low immunogenicity and the like, so the polypeptide of the invention has wide application prospect in cartilage injury repair and osteoarthritis treatment.

Drawings

FIG. 1 is a chart of HPLC assay results of solid phase synthesis of peptide KAI 11;

FIG. 2 is a graph showing the effect of peptide KAI11 on the expression of collagen type II (COL2A1) mRNA, wherein the relative expression level of COL2A1 mRNA was determined by quantitative PCR using PBS as a negative control and human insulin growth factor (IGF-1) as a positive control;

FIG. 3 is a graph showing the results of the effect of peptide KAI11 on the expression of proteoglycan (ACAN) mRNA, wherein the relative expression amount of ACAN mRNA was detected by quantitative PCR using PBS as a negative control and IGF-1 as a positive control;

FIG. 4 is a graph showing the results of the effect of peptide KAI11 on rat chondrocyte proliferation measured by the MTS method using PBS as a negative control and IGF-1 as a positive control;

FIG. 5 is a graph of the results of immunohistochemistry for COL2A1 of peptide KAI 11-treated chondrocytes;

FIG. 6 is a graph showing the results of the repair of damaged cartilage in zebrafish by peptide KAI 11;

FIG. 7 is a photograph of the repair effect of peptide KAI11 on damaged cartilage of zebrafish, wherein A) is a normal control group; B) is a model control group; C) is a positive control group; D) in the KAI11 low dose group; E) dose group in KAI 11; F) in the KAI11 high dose group;

figure 8 is a graph of pathological score results for the peptide KAI 11-treated rat OA model.

Detailed Description

The present invention provides a peptide KAI11 which is a fragment derived from bone morphogenetic protein 7 (BMP-7). The peptide KAI11 has activities of promoting differentiation of bone marrow mesenchymal stem cells into chondrocytes and promoting proliferation of chondrocytes, and can be used for cartilage repair and/or treatment of osteoarthritis. The amino acid sequence of the peptide KAI11 for promoting cartilage repair is shown in SEQ ID NO. 1.

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments. It should be noted that many changes and modifications can be made by those skilled in the art without departing from the inventive concept, which falls within the scope of the invention.

Example 1 solid phase Synthesis of peptide KAI11

Peptide KAI11 (SEQ ID NO.1) was synthesized using conventional solid phase techniques with a peptide purity of > 95% (see FIG. 1) and 500mg synthesized.

Example 2 Effect of peptide KAI11 on mesenchymal Stem cell differentiation in vitro

1) Culturing and subculturing the human mesenchymal stem cells:resuscitating human bone marrow mesenchymal stem cells (BMSCs, available from Guangzhou Sai Biotechnology Co., Ltd.), adding complete culture medium, standing at 37 deg.C and 5% CO ₂ And culturing in an incubator with saturated humidity. And on the next day after recovery, replacing the recovered cells with fresh complete culture medium, replacing the cells with fresh complete culture medium every two days until the cells reach 80% -90% confluence, and then carrying out subculture.

2) Chondrogenesis induction: peptide KAI11 was dissolved in Phosphate Buffered Saline (PBS). Cells were resuspended in complete chondrogenic media containing varying concentrations of peptide KAI11(0.1, 1 and 10. mu.M) such that the concentration of BMSCs was 5.0X 10 per ml ⁵ And (4) one cell. PBS was used as a negative control, and 1. mu.M human insulin growth factor 1(IGF-1) was used as a positive control.

The treated BMSCs were placed at 37 ℃ in 5% CO ₂ Incubation under saturated humidity conditions. The medium was changed every 2-3 days, and 0.5mL of fresh complete chondrogenic medium was added to each tube.

3) And (3) qPCR detection: collecting cells, extracting total RNA by a Trizol method, carrying out reverse transcription to obtain cDNA, wherein the reaction conditions are as follows: preserving the heat for 10 minutes at 30 ℃; keeping the temperature at 42 ℃ for 60 minutes; the temperature is kept at 85 ℃ for 10 minutes.

Quantitative PCR was performed on type II collagen (Col2A1) and proteoglycan (Aggrecan, Acan) using the cDNA as a template and the primers shown in Table 1 below under the following reaction conditions: 2 minutes at 50 ℃; 2 minutes at 95 ℃; plates were read at 95 ℃ for 15 seconds, 60 ℃ for 32 seconds, 40 cycles.

TABLE 1 primer pairs

COL2A1-F1	CAAGAACAGCATTGCCTATC	SEQ ID NO.2
			COL2A1-R1	ATAACAGTCTTGCCCCACTT	SEQ ID NO.3
ACAN-F1	TGGGTCTGGAGTAGAAGTATCA	SEQ ID NO.4
			ACAN-R1	GTTAGCTTCGTGGAATGCA	SEQ ID NO.5
β-actin-F1	TGGATCAGCAAGCAGGAGTA	SEQ ID NO.6
			β-actin-R1	TCGGCCACATTGTGAACTTT	SEQ ID NO.7

4) Results and analysis

The 0.1, 1 and 10 mu M peptide KAI11 can obviously promote the mRNA expression of COL2A1 and ACAN to be increased, and shows obvious dose-effect relationship and time-effect relationship (see the figure 2 and the figure 3), which indicates that the peptide KAI11 promotes the differentiation of mesenchymal stem cells to cartilage cells, and the peptide KAI11 has induction promoting effect on the expression of COL2A1 and ACAN genes.

Example 3 Effect of peptide KAI11 on chondrocyte proliferation

1) Culturing the chondrocytes: articular cartilage of 2-month-old New Zealand white rabbits was excised under aseptic conditions, cut into 1mm pieces, digested with 2mg/ml hyaluronidase for 45 minutes, 2mg/ml trypsin for 45 minutes, and 4mg/ml collagenase II for 3 hours at 37 ℃, washed and centrifuged (1500 r/min) for 5 minutes, and the precipitates were cultured in a DMEM medium containing 15% fetal bovine serum.

2) Identification of chondrocytes: taking a small amount of primary chondrocyte smears, performing immunodetection by using a collagen I antibody SABC, staining the smears to be brown yellow, indicating that the smears secrete the collagen I, and confirming the smears to be chondrocytes.

3) MTS assay for chondrocyte proliferation: chondrocytes according to 2X 10 ⁴ Inoculating each well into 96-well plate, adding different concentrations of peptide KAI11(0.1, 1 and 10 μ M), and using PBS as negative control group and IGF-1(1 μ M) as positive control group, at 37 deg.C and 5% CO ₂ The culture is carried out for 5 days in a saturated water vapor carbon dioxide incubator. Mu.l of MTS mixture was added to each well, and the culture was continued for 3 to 4 hours for color development. The plates were shaken for 10 seconds before detection and the color was mixed. The light absorption (OD) of each well was measured on an enzyme-linked detector at a wavelength of 570 nm.

4) Immunohistochemical assay COL2a 1: the ratio of chondrocytes to cartilage cells is 3.5X 10 ⁵ The cells were inoculated in 6-well plates with coverslips, and different concentrations of peptide KAI11(0.1, 1 and 10. mu.M) were added, with PBS as a negative control and IGF-1 (1. mu.M) as a positive control. 37 ℃ and 5% CO ₂ The culture is carried out for 5 days in a saturated water vapor carbon dioxide incubator. Fixing the treated chondrocytes with 4% paraformaldehyde for 24-36 hours, cutting into materials with proper sizes, and carrying out paraffin embedding. The wax block was cut into 5 μm thick sections, deparaffinized with xylene, and washed 3 times with PBS for 5 minutes each. Heating to boil with high fire in a microwave oven, maintaining the boiling with low fire, and continuing heating for 8 minutes (citric acid antigen repairing solution) until the water temperature naturally decreases to room temperature. PBS wash 3 times, each for 5 minutes; sealing 10% goat serum at room temperature for 30 min; incubating the primary antibody at 4 ℃ overnight, washing with PBS 3 times for 5 minutes each time; incubating the secondary antibody at room temperature for 30 minutes, washing with PBS for 3 times, and washing for 5 minutes each time; DAB color development, PBS washes 3 times, each time for 5 minutes; and (4) performing hematoxylin counterstaining, washing with water to remove redundant staining solution, and differentiating for several seconds. Washing with water and returning blue. 50%, 75%, 85%, 95% and 100% ethanol gradient dehydrated 1 time each, xylene transparent 2 times, each time for 5 minutes. And (5) sealing the neutral gum.

5) Results and analysis

5.1 promoting Effect of peptide KAI11 on chondrocyte proliferation

After 5 days of treatment with different concentrations of peptide KAI11, 0.1, 1 and 10 μ M of peptide KAI11 significantly promoted the proliferation of chondrocytes compared to the PBS group, with a clear dose-effect relationship (see figure 4).

5.2 promoting Effect of peptide KAI11 on COL2A1 expression

The immunohistochemical staining of COL2a1 was significantly increased in the 0.1, 1 and 10 μ M peptide KAI 11-treated groups compared to the PBS-treated group, indicating that the level of COL2a1 protein expression was significantly increased, reaching a maximum at 1 μ M (see figure 5).

The results show that peptide KAI11 can promote the proliferation of chondrocytes and the expression of type II collagen in vitro.

Example 4 repair of Zebra fish cartilage injury model by peptide KAI11

And (3) randomly selecting transgenic cartilage fluorescent zebra fish 2 days after fertilization into a six-hole plate, dissolving 30 zebra fish in water and giving dexamethasone to establish a zebra fish cartilage damage model. The model zebra fish is respectively administered with peptide KAI11 dissolved by normal saline by intravenous injection, the dosage is 20, 100 and 500 ng/tail, the positive control drug chondroitin sulfate is dissolved by water, the concentration is 1000 mug/mL, meanwhile, a normal control group (administered with normal saline) and a model control group (administered with normal saline) are set, the volume of each hole is 3mL, and the model zebra fish is incubated for 72 hours in an incubator at 28 ℃. After the experiment is finished, 10 zebra fish in each group are randomly selected and observed under a microscope, photographed and stored, and the fluorescence intensity of the zebra fish cartilage, the length and the angle of the zebra fish canthus and the Meckel's cartilage are measured by Nikon NIS-Elements D3.10 advanced image processing software. The calculation formula for cartilage regeneration is as follows:

statistical analysis by T-test, for statistical treatment of results

Is represented by the formula p<0.05 indicated significant differences.

Results and analysis: compared with the model control group, the treatment of the peptide KAI11 with medium and high doses (100 ng/tail and 500 ng/tail respectively) shows obvious cartilage repair effect, and the fluorescence of the zebra fish in the peptide KAI11 medium and high dose groups is obviously stronger than that of the model control group (P is represented by P < 0.01) and the dose-effect relationship is obvious (see figure 6, figure 7 and table 2), which indicates that the peptide KAI11 has the effect of promoting the regeneration of damaged cartilage.

TABLE 2 therapeutic Effect of KAI11 on cartilage damage in Zebra fish

Group of	Fluorescence value
		Normal control group	899032±37936
Model control group	573260±51879
		KAI11 Low dose group	682738±42568
Dosage groups in KAI11	746549±56729**
		KAI11 high dose group	844633±63792**
Positive group	878931±69391**

Note: the differences are statistically significant (P < 0.01) compared to model controls

Example 5 Effect of peptide KAI11 on rat Osteoarthritis (OA) model

1) Modeling: a rat OA model is established by adopting a method of surgical excision of Anterior Cruciate Ligament (ACLT) and combined meniscectomy (MMT), and the specific operation is as follows: SD rats were intramuscularly administered a dose of antibiotic (gentamicin, 20mg/kg), subcutaneously administered atropine (0.05mg/kg), 1.5-3.0% isoflurane for maintenance of intraoperative anesthesia. After the animals were anesthetized, one side (right side) of the knee joint was prepared for hair preparation, and cleaned and sterilized with iodophor, and prepared for surgery. The medial femur-tibia joint will be incised, the medial meniscus will be exposed by blunt dissection, full thickness dissection will be performed at the narrowest point of the meniscus, the anterior cruciate ligament will be cut off at the same time, the posterior joint reduction will be completed, the knee joint muscles, ligaments and skin will be sutured, and the operative part will be disinfected. All animals were given an amount of the analgesic, tolfenamic acid (4% tolfenamic acid, 0.1mg/kg, i.m.) for 3 consecutive days post-surgery, once daily. All animals were given a quantity of antibiotic (gentamicin, 20mg/kg, i.m.) after surgery was completed. Animals were allowed free mobility and full weight bearing during the anesthesia recovery period, and animal experimenters had to closely monitor all animals during the anesthesia recovery period.

2) Treatment: two weeks after the operation, the molded animals were randomly divided into a normal control group, a model control group, a peptide KAI11 low, medium and high dose group and a positive control group, and were administered with physiological saline, 0.2mg, 1mg, 5mg of peptide KAI11 and 0.5mg of sodium hyaluronate injection, respectively, in such a manner that the right hind leg knee joint cavity was injected, and the administration volume was 50. mu.l.

3) And (3) detection: after 28 days of drug administration treatment, animals were euthanized, all groups of right knee joints and model groups of left knee joints were taken, 10% NBF was fixed for more than 48 hours, formic acid was decalcified, paraffin embedded, coronal section was taken, H & E and Safranin-O were stained; the slices were scored for degenerative changes by a professional pathologist (cartilage degeneration, osteophytes, number and extent of cartilage calcification and subchondral bone damage, number of synovial inflammation) and the scoring criteria were referenced to the osteo arthritis Research Society International (oassi) scoring system.

4) Statistical analysis: data analysis was performed using GraphPad Prism (GraphPad Software, Inc.) or PASW statisticcs 18.0(SPSS Inc.). Significant differences were considered when P < 0.05.

5) Results and analysis: compared with the model control group, the OA scores of the peptide KAI11 treatment groups are reduced, the dose-effect relationship is obvious, and the medium and high dose groups have statistical significance (see figure 8 and table 3), which indicates that the peptide KAI11 has treatment effect on the rat OA model.

TABLE 3 therapeutic Effect of KAI11 on OA in rats (OARSI score)

Normal control group	Model control group	KAI11 Low dose group	KAI11 Medium dosage group	KAI11 high dose group	Sodium hyaluronate group
						4.5±1.5	29.6±6.9	24.7±5.5	18.3±5.1**	14.6±4.6**	16.7±5.3**

Note: indicates that the difference was statistically significant (P < 0.01) compared to model controls.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> Guangzhou Zhicheng medical science and technology Limited

<120> peptide KAI11 for promoting cartilage regeneration and application thereof

<130> 2019

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 11

<212> PRT

<213> Artificial sequence

<400> 1

Lys Ala Ile Ser Val Leu Tyr Phe Asp Asp Ser

1 5 10

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

caagaacagc attgcctatc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

ataacagtct tgccccactt 20

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

tgggtctgga gtagaagtat ca 22

<210> 5

<211> 19

<212> DNA

<213> Artificial sequence

<400> 5

gttagcttcg tggaatgca 19

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

tggatcagca agcaggagta 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

tcggccacat tgtgaacttt 20

Claims (6)

1. The application of the peptide KAI11 in preparing the medicine for repairing cartilage or/and treating osteoarthritis is disclosed, wherein the amino acid sequence of the peptide KAI11 is shown as SEQ ID number 1.

2. A medicine for repairing cartilage or/and treating osteoarthritis comprises a peptide KAI11, wherein the amino acid sequence of the peptide KAI11 is shown as SEQ ID number 1.

3. The medicament of claim 2, further comprising hyaluronic acid or a nonsteroidal anti-inflammatory drug.

4. The medicament of claim 2, wherein the effective dose is 1-5 mg per time.

5. The medicament of claim 2, further comprising a pharmaceutically acceptable carrier, the carrier being a saline solution or a colloidal solution.

6. The medicament of claim 5, wherein the colloidal solution is a hyaluronic acid gel.

Images