CN110894507B - Method for inducing Chinese narcissus to generate anthocyanin and application thereof - Google Patents
Method for inducing Chinese narcissus to generate anthocyanin and application thereof Download PDFInfo
- Publication number
- CN110894507B CN110894507B CN201911278661.XA CN201911278661A CN110894507B CN 110894507 B CN110894507 B CN 110894507B CN 201911278661 A CN201911278661 A CN 201911278661A CN 110894507 B CN110894507 B CN 110894507B
- Authority
- CN
- China
- Prior art keywords
- ans
- gene
- steps
- bombardment
- following
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8206—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated
- C12N15/8207—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by physical or chemical, i.e. non-biological, means, e.g. electroporation, PEG mediated by mechanical means, e.g. microinjection, particle bombardment, silicon whiskers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Nutrition Science (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a method for inducing Chinese narcissus to generate anthocyanin and application thereof, belonging to the technical field of plant transgenosis. The method comprises the following steps: (1) cloning the full-length sequence of the coding region of the lily ANS gene; (2) constructing an ANS gene pC2300-35S, namely an ANS plant expression vector; (3) introducing an ANS plant expression vector into a Chinese narcissus receptor material by a gene gun method, wherein the expression vector is pC 2300-35S; (4) and identifying ANS gene expression results in the receptor material. The method of the invention leads the Chinese narcissus which originally does not contain anthocyanin to generate anthocyanin and show red phenomenon.
Description
Technical Field
The invention belongs to the technical field of plant transgenosis, and particularly relates to a method for inducing Chinese narcissus to generate anthocyanin and application thereof.
Background
The Chinese narcissus is a traditional famous flower in China, and is often used as a flower for the annual night in winter, so that the Chinese narcissus has great ornamental value and economic value. However, the color of the Chinese narcissus is single, and only yellow and white colors exist. One of the main reasons for the singleness of the flower color of Chinese narcissus is the lack of anthocyanins in the flower. Our studies found that the main reason why Narcissus tazetta fails to synthesize anthocyanin is the lack of expression of the gene for ANS (anthocyanin synthase), a key enzyme in the pathway for anthocyanin synthesis. Therefore, the introduction and effective expression of a proper exogenous ANS gene into the Chinese narcissus is an effective way for inducing the Chinese narcissus to generate red anthocyanin.
Chinese narcissus is a triploid plant, is highly sterile, can only be subjected to vegetative propagation by bulblet generally, and is difficult to breed a new variety by using the traditional crossbreeding mode. Therefore, the method is an effective way for the color innovation of the Chinese narcissus.
The present invention utilizes gene gun technology to transfer constructed 35S, wherein ANS carrier is transferred into Chinese narcissus to induce the Chinese narcissus to produce anthocyanin and change the color of the Chinese narcissus to make the Chinese narcissus produce red character.
Disclosure of Invention
The invention provides a method for inducing Chinese narcissus to generate red anthocyanin and application thereof, aiming at overcoming the defects that the Chinese narcissus only has yellow and white flowers and has single variety color. The lily ANS gene is cloned, 35S is constructed, wherein ANS chimeric gene is used for establishing gene gun transformation parameters, and the gene gun is introduced into a receptor material of the Chinese narcissus to express ANS, so that the Chinese narcissus generates anthocyanin and shows red character.
In order to achieve the purpose, the invention adopts the following technical scheme:
a method for inducing Chinese narcissus to produce red anthocyanin comprises the following steps:
(1) cloning the full-length sequence of the coding region of the lily ANS gene;
(2) constructing an ANS gene pC2300-35S, namely an ANS plant expression vector;
(3) introducing an ANS plant expression vector into a Chinese narcissus receptor material by a gene gun method, wherein the expression vector is pC 2300-35S;
(4) identification of ANS gene expression induced anthocyanin production in receptor material.
The cloning of the full-length sequence of the coding region of the lily ANS gene in the step (1) specifically comprises the following steps: designing a specific primer containing a restriction enzyme site according to a coding region sequence of the ANS gene of the lily in NCBI, and cloning the full length of the ANS gene by taking lily cDNA as a template.
Furthermore, the sequence of the coding region of the lily ANS gene is shown as SEQ ID NO. 1; the specific primers are as follows: SEQ ID NO: 2: ANSF: 5' -GGATCCATGCCGACCGAGATCATGCCGTT-3’；SEQ ID NO：3 ANSR：5’-CTG CAGCCTCACTTGGGAGAAGTGAAGTCCTCC-3’。
The ANS gene pC2300-35S is constructed in the step (2), wherein an ANS plant expression vector specifically comprises: ANS full-length gene and pC2300-35S plasmid, first using BamH IAnd Pst IDouble enzyme digestion, then connection, obtaining the recombinant plasmid pC2300-35S, ANS plant expression vector.
The acceptor material in the step (3) is: chinese narcissus petals, assistant crowns and bulbar plates.
The gene gun method in the step (3) introduces the pC2300-35S into an ANS plant expression vector into a Chinese narcissus receptor material, and comprises the following specific steps:
1) pretreating the receptor material;
2) preparing gene gun bullets;
3) bombarding acceptor material by a gene gun;
4) and (5) performing bombardment post-treatment.
Further, the pretreatment of the receptor material in the step 1) is as follows: the receptor material is inoculated in an osmotic culture medium for pretreatment 4-8h before bombardment; the permeation culture medium is as follows: MS +2mg/L2,4-D +0.2mol/L sorbitol +0.2mol/L mannitol +30g/L sucrose +6g/L agar, Ph5.8.
Further, the gene gun bullet in the step 2) is prepared by: 60mg/ml gold powder or tungsten powder suspension 50ul, 1ug/ul plant expression vector DNA 5ul, 2.5M CaCl250ul, 0.1M spermidine 20 ul.
Further, the gene gun in the step 3) bombards the receptor material, wherein the bombardment parameters of the bulb dish are bombardment distance of 6cm and air pressure of 1350psi, and the bombardment parameters of the petals and the secondary crowns are bombardment distance of 9cm and 1100 psi.
Further, the bombardment post-treatment in the step 4) comprises: after bombardment the receptor material is placed on an infiltration medium for infiltration treatment.
The method for inducing the Chinese narcissus to generate the red anthocyanin is applied to the generation of the anthocyanin by the Chinese narcissus which cannot generate the anthocyanin.
The invention has the advantages that:
the invention provides a method for inducing Chinese narcissus to generate red anthocyanin, which can be applied to the cultivation of red Chinese narcissus varieties (including red balls and red flowers) and overcomes the problems that the Chinese narcissus has single flower color and is difficult to innovate the flower color by a conventional breeding means.
Drawings
FIG. 1 is an electrophoresis diagram of the PCR clone of ANS gene. M is DL2000DNAmarker, 1,2 is PCR product.
FIG. 2 is a pMD19-T-ANS dicrotic map. M is DL15000DNAmarker, 1,2 is pMD19-T-ANS gene double enzyme digestion.
FIG. 3 shows pC2300-35S: ANS double enzyme cleavage map. M is DL15000DNAmarker, 1,2 is pC2300-35S, ANS gene double enzyme digestion.
Figure 4 is a graph of the effect of bombardment of the narcissus bulb-disk by different parameters. A: 6cm, 1100 psi; b: 9cm, 1100 psi; c: 9cm, 1350 psi; d: 6cm, 1350 psi.
FIG. 5 is a diagram showing the effect of bombardment of paraspinal canopy with different parameters. A: 6cm, 1100 psi; b: 9cm, 1100 psi; c: 9cm, 1350 psi; d: 6cm, 1350 psi.
Figure 6 is a graph of the effect of different parameters on the bombardment of narcissus petals. A: 6cm, 1100 psi; b: 9cm, 1100 psi; c: 9cm, 1350 psi; d: 6cm, 1350 psi.
FIG. 7 shows pC2300-35S showing the effect of ANS plasmid after being injected into petals by a gene gun, wherein the bombardment parameters are 9cm and 1100 psi.
FIG. 8 shows pC2300-35S showing the effect of ANS plasmid after gene gun injection into accessory crown, the bombardment parameter is 9cm, 1100 psi.
FIG. 9 shows pC2300-35S showing the effect of ANS plasmid gene gun driven into the bulb dish, with bombardment parameters of 6cm and 1350 psi.
FIG. 10 shows the effect of the blank vector pC2300-35S (control) after the petal injection.
FIG. 11 is a graph showing the effect of the empty vector pC2300-35S (control) after the injection into the accessory crown.
FIG. 12 is a graph showing the effect of the empty vector pC2300-35S (control) after being inserted into the bulb dish.
Fig. 13 is a Total ion flow diagram (TIC, i.e., a spectrum obtained by continuously plotting the sum of intensities of all ions in a mass spectrum at each time point) of the quality control QC sample of the narcissus mixture sample after introduction of the ANS gene.
FIG. 14 is a MRM metabolite detection map of Narcissus tazetta samples after introduction of ANS gene. A: a target detection object cyanidin peak pattern; b: ion flow spectrum of multi-substance extraction.
FIG. 15 is a graph of the results of the quantitative analysis integral correction of cyanidin in a sample.
Detailed Description
The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.
Example 1 pC2300-35S ANS plant expression vector construction
1 cloning of Lily ANS Gene
(1) Obtaining the sequence of the Gene of interest
Specific primers are designed according to the coding region sequence (SEQ ID NO: 1) of the lily ANS gene in NCBI, restriction enzyme sites are added at the upstream and downstream, and the full length is cloned.
The primers designed at both ends of the target gene sequence are as follows:
SEQ ID NO：2：ANSF：GGATCCATGCCGACCGAGATCATGCCGTT (underlined)BamH ICleavage site)
SEQ ID NO：3：ANSR：CTGCAGCCTCACTTGGGAGAAGTGAAGTCCTCC (underlined)Pst ICleavage site)
Extracting total lily RNA according to the requirements of the instructions of a TransZol Up Plus RNA Kit, carrying out reverse transcription into cDNA by referring to the instructions of a RevertAid First Strand cDNA Synthesis Kit reverse transcription Kit, and carrying out PCR amplification and cloning on a target gene of an ANS gene of lily by taking the cDNA as a template, wherein a PCR system is as follows:
the PCR reaction procedure was as follows: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 deg.C for 30s, annealing at 65 deg.C for 1min, extension at 72 deg.C for 1.5min, and circulating for 35 times; finally, extension was carried out at 72 ℃ for 7 min. The detection is carried out by 1% agarose gel electrophoresis, and the band of the target fragment is obtained by gel running (figure 1).
(2) Target gene connecting T vector
According to the operational requirements of the Omega Gel Extraction Kit, recovering the target fragment product, connecting the recovered product to a pMD19-T vector, transforming Escherichia coli DH5 alpha competent cells by a heat shock method, plating, and placing in a 37 ℃ incubator for overnight culture. And selecting a single colony for amplification culture, carrying out PCR detection, extracting plasmids of positive bacteria according to the instruction of a small-amount plasmid extraction kit of Omega company, and then carrying out sequencing comparison. The comparison results are consistent.
(2) ANS Gene 35S construction of ANS plant expression vector
pMD19-T-ANS plasmid, useBamHI andPsti, double digestion is carried out, and the target gene ANS fragment is recovered (figure 2). By usingBamH IAndPst Ithe plasmid pC2300-35S is cut by double enzymes, and the large fragment of the vector is recovered. Connecting the target gene and the large carrier segment with T4 ligase to construct recombinant plasmid pC2300-35S, ANS plant expression carrier,PCR detection and double enzyme digestion verification (figure 3), extracting recombinant plasmid sequencing, and confirming the success of recombinant plasmid construction.
Example 2 expression of ANS Gene in Narcissus tazetta
(1) Pretreatment of receptor material
The receptor materials of the petals of the Chinese narcissus, the paracrowns and the bulbar plates are inoculated in an infiltration medium (MS +2mg/L2,4-D +0.2mol/L sorbitol +0.2mol/L mannitol +30g/L sucrose +6g/L agar, Ph5.8) in advance for pretreatment 4-8h before bombardment of a gene gun, and the receptor materials are concentrated at the center (the diameter is 2.5 cm) of the culture dish before bombardment.
(2) Preparation before bombardment
Autoclaving the splittable support cap and carrier membrane components before use, soaking the carrier membrane and splittable membrane in 75% ethanol for 5-8min before use, air drying under aseptic condition, performing ultra-clean bench ultraviolet sterilization, surface sterilizing the rest components with 75% ethanol, and air drying.
(3) Preparation of gene gun bullet
The concentration of ANS plant expression vector or pC2300-35S original vector is adjusted to 1 ug/ul.
The concentrations and amounts of the materials used to prepare the bullets were: 50ul of gold powder/tungsten powder suspension 60mg/ml and recombinant plasmid pC2300-35S, 5ul of ANS plant expression vector or pC2300-35S original vector DNA, 50ul of 2.5M CaCl and 20ul of 0.1M spermidine (final concentration: CaCl 1M and spermidine 0.016M) are smeared on a carrier membrane. The bullet is used within 2h after preparation (can be played for 6 times).
(4) Gene gun bombarded Chinese narcissus acceptor material
Selecting bombardment parameters: the distance between the receptor material and the carrier membrane is 6cm and 9cm, the air pressure is 1100psi and 1350psi, and 4 parameter combinations (6 cm, 1100 psi; 6cm, 1350 psi; 9cm, 1100 psi; 9cm, 1350 psi) are adopted, and the optimal bombardment parameter combination is selected after the experiment (as shown in figures 4, 5 and 6).
FIG. 4 shows the results that the optimal bombardment parameters of the bulb dish are bombardment distance of 6cm and air pressure of 1350 psi; the results of fig. 5 and 6 show that the optimum bombardment parameters of the petals and the secondary crown are bombardment distance 9cm and 1100 psi.
The bombardment operation is as follows: turning on a transformer, a host and a vacuum pump power supply; opening the helium valve to adjust the pressure to a range 200psi higher than the desired pressure (adjusting the helium pressure to above 1300psi if 1100psi is desired and to above 1550psi if 1350psi is desired); mounting the splittable film, the carrier film coated with the bullets and the copper net into a fixed position, and adjusting the distance; placing a culture dish filled with receptor materials prepared in advance on a gene gun indoor tray, and closing a gene gun door; pressing a vacuumizing key Vac, and when the vacuum meter reaches 28inches Hg, putting the key at a Hold gear and keeping vacuum; pressing a Fire key until the bombardment is finished; taking out the culture dish; repeating the operation until all materials are processed.
(5) Post bombardment treatment
And (4) after bombardment, continuously placing the receptor material on an osmotic culture medium, performing osmotic treatment, covering a culture dish, sealing with a sealing film, and performing subsequent observation after treatment for 1 day.
Example 3 ANS Gene expression result identification
(1) The receptor material was placed under a stereomicroscope to observe the phenotypic change.
The acceptor materials bombarded by the ANS show red characters, as shown in figures 7, 8 and 9, while the acceptor materials bombarded by the control plasmid pC2300-35S show no red characters, as shown in figures 10, 11 and 12.
(2) Detection of anthocyanin content in sample
Material treatment:
at the end of the bombardment, the samples after observation of the phenotypic change were freeze-dried under vacuum and ground (30 Hz, 1.5 min) to a powder using a grinder (MM 400, Retsch). 100mg was weighed and dissolved in 1.0ml of the extract (70% aqueous methanol), and the mixture was cooled overnight at 4 ℃ in a refrigerator while vortexing 3 times to increase the extraction rate. After centrifugation (10000 g, 10 min), the supernatant was aspirated, and the sample was filtered through a microfiltration membrane (0.22 um pore size) and stored in a sample vial for analysis by LC-MS/MS.
Analyzing and detecting the anthocyanin content in the sample by liquid chromatography tandem mass spectrometry (LC-MS/MS):
liquid chromatography conditions: a chromatographic column: water ACQUITY UPLC HSS T3 C182.1mm × 100mm, 1.8 μm; mobile phase: the aqueous phase was ultrapure water (0.04% acetic acid added) and the organic phase was acetonitrile (0.04% acetic acid added); flow rate: 0.4 mL/min; column temperature: 40 ℃; sample introduction amount: 5 mu L of the solution; gradient elution procedure: 0min, water/acetonitrile (95: 5V/V), 11.0min 5: 95V/V, 12.0min 5: 95V/V, 95:5V/V at 12.1min and 95:5V/V at 15.0 min.
Mass spectrum conditions: an electrospray ion source; mass spectrum voltage 5500V; curtain air 25 psi.
The Total ion flow graph (TIC, i.e. the graph obtained by continuously plotting the sum of the intensities of all ions in the mass spectrum at each time point) of the quality control QC sample of the narcissus mixed sample after introduction of the ANS gene is shown in fig. 13.
FIG. 14 shows MRM metabolite detection of Narcissus tazetta samples after introduction of ANS gene.
The results of the quantitative analysis integral correction of cyanidin in the sample are shown in figure 15. The area of the integrated plot in fig. 15 is the relative content of cyanidin in the sample. The method indicates that after the pC2300-ANS exogenous plant expression vector is introduced into the Chinese narcissus by a gene gun method, the Chinese narcissus can generate cyanidin, namely the Chinese narcissus which cannot generate the anthocyanin originally can generate the anthocyanin, and red characters different from yellow and white are expressed.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fujian agriculture and forestry university
<120> method for inducing Chinese narcissus to generate anthocyanin and application thereof
<130> 3
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 1334
<212> DNA
<213> SEQ ID NO:1
<400> 1
taccactacc attctattgc catcaaccaa accaagctcc atgccgaccg agatcatgcc 60
gttgccggag agagttgaga gcctggccag cagtggtctc accacaatcc caaaagagta 120
tgttcgtccc gagtcggagc gcgacagcct cggtgacgct ttcgacgaag ccatgaagtt 180
gaactcgagt ggaccgcagg tgccggtagt cgacctagcg ggattcgatt cgcccgatga 240
ggcggtgagg gcgaagtgtg tggaggaatt gaagaaggca gcggaggatt ggggggtgat 300
gcatattgtg aaccatagaa ttccgttgga gttgattgat agggtgaggg aggtgggaaa 360
gggctttttc gaccttccgg tggagcagaa agagaagtat gcgaatgatc aggcgtctgg 420
agagatacag ggttacggca gtaaactggc gaataatgag agcgggcagc ttgagtggga 480
ggattactat tttcacctta tatttccaga ggaaaagacc aatttgtccc tctggcccaa 540
agaaccagaa gactatatag aagtaactaa ggagtttgcc aaggagctga gagtggtggt 600
gaccaagatg ctgtccatgc tctctcaagg tctcggcctc gaatccggca agctcgagaa 660
agagatcggg gggatggaag agctactcat gcagatgaag atcaactact acccgaaatg 720
tccacaaccg gagctcgccc tcggtgtcga agcccacacc gatgtcagct ccctaacctt 780
cctcctcacc aacatggtac cgggccttca gctctactat ggtggcaaat gggtcatcgc 840
ccagtgcgtc cccgattcgc ttctcgtcca cattggcgac actctagaga tcctcagcaa 900
tgggcgctat aggagcattt tgcataggag tttggtgaac aaggagaggg tcaggatctc 960
gtgggcagtg ttctgcgagc cgccgaagga gactatagtg ctgaaaccat tgccggagct 1020
ggtgacggag gcggcgccgg cgaagttccc gccgaggact ttcaagcagc acatccagca 1080
taagttgttc aagaagacgc aggaggactt cacttctccc aagtgaggat gcagattatt 1140
gtctaccgag actgcgtgta ggaatgaata taagtatttc tggattgtag aggggaatta 1200
cgaaataaat gatttgagag gtgagccccc caccccccac ccccattggt ttaaggtatt 1260
tataatttta agtaaatgaa tttatcagtg tgtaagtctc taagaaaaaa aaaaaaaaaa 1320
aaaaaaaaaa aaaa 1334
<210> 2
<211> 29
<212> DNA
<213> SEQ ID NO：2：ANSF
<400> 2
ggatccatgc cgaccgagat catgccgtt 29
<210> 3
<211> 33
<212> DNA
<213> SEQ ID NO：3 ANSR
<400> 3
ctgcagcctc acttgggaga agtgaagtcc tcc 33
Claims (8)
1. A method for inducing Chinese narcissus to generate red anthocyanin is characterized by comprising the following steps:
(1) cloning the full-length sequence of the coding region of the lily ANS gene;
(2) constructing an ANS gene pC2300-35S, namely an ANS plant expression vector;
(3) introducing an ANS plant expression vector into a Chinese narcissus receptor material by a gene gun method, wherein the expression vector is pC 2300-35S;
(4) identifying the anthocyanin generated by transient expression induction of ANS gene in the receptor material;
the cloning of the full-length sequence of the coding region of the lily ANS gene in the step (1) specifically comprises the following steps: designing a specific primer containing a restriction enzyme site according to a coding region sequence of an ANS gene of the lily in NCBI, and cloning the full length of the ANS gene by taking lily cDNA as a template;
the sequence of the coding region of the lily ANS gene is shown as SEQ ID NO. 1; the specific primer sequence is shown as SEQ ID NO: 2 and SEQ ID NO: 3, respectively.
2. The induction of Narcissus tazetta according to claim 1A method of producing red anthocyanins, comprising: the ANS gene pC2300-35S is constructed in the step (2), wherein an ANS plant expression vector specifically comprises: ANS full-length gene and pC2300-35S plasmid, using BamH IAnd Pst IDouble enzyme digestion, then connection, obtaining the recombinant plasmid pC2300-35S, ANS plant expression vector.
3. The method for inducing the Chinese narcissus to produce red anthocyanin according to claim 1, wherein the method comprises the following steps: the gene gun method in the step (3) introduces the pC2300-35s into an ANS plant expression vector into a Chinese narcissus receptor material, and comprises the following specific steps:
1) pretreating the receptor material;
2) preparing gene gun bullets;
3) bombarding acceptor material by a gene gun;
4) and (5) performing bombardment post-treatment.
4. The method for inducing the Chinese narcissus to produce red anthocyanin according to claim 3, wherein the method comprises the following steps: the pretreatment of the receptor material in the step 1) comprises the following steps: the receptor material is inoculated in an osmotic culture medium for pretreatment 4-8h before bombardment; the permeation culture medium is as follows: MS +2mg/L2,4-D +0.2mol/L sorbitol +0.2mol/L mannitol +30g/L sucrose +6g/L agar, Ph5.8; the receptor material is: one of Chinese narcissus petal, auxiliary crown and bulb dish.
5. The method for inducing the Chinese narcissus to produce red anthocyanin according to claim 3, wherein the method comprises the following steps: the gene gun bullet preparation in the step 2) comprises the following steps: 60mg/ml gold powder or tungsten powder suspension 50ul, 1ug/ul plant expression vector DNA 5ul, 2.5M CaCl250ul, 0.1M spermidine 20 ul.
6. The method for inducing the Chinese narcissus to produce red anthocyanin according to claim 3, wherein the method comprises the following steps: and 3) bombarding the receptor material by the gene gun in the step 3), wherein the bombardment parameters of the bulb plate are bombardment distance of 6cm and air pressure of 1350psi, and the bombardment parameters of the petals and the auxiliary crowns are bombardment distance of 9cm and 1100 psi.
7. The method for inducing the Chinese narcissus to produce red anthocyanin according to claim 3, wherein the method comprises the following steps: the bombardment post-treatment in the step 4) comprises the following steps: after bombardment the receptor material is placed on an infiltration medium for infiltration treatment.
8. Use of the method of claim 1 for inducing the production of red anthocyanins from colchicines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911278661.XA CN110894507B (en) | 2019-12-13 | 2019-12-13 | Method for inducing Chinese narcissus to generate anthocyanin and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911278661.XA CN110894507B (en) | 2019-12-13 | 2019-12-13 | Method for inducing Chinese narcissus to generate anthocyanin and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110894507A CN110894507A (en) | 2020-03-20 |
| CN110894507B true CN110894507B (en) | 2021-07-27 |
Family
ID=69787465
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911278661.XA Active CN110894507B (en) | 2019-12-13 | 2019-12-13 | Method for inducing Chinese narcissus to generate anthocyanin and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110894507B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100726874B1 (en) * | 2005-01-04 | 2007-06-14 | 한국생명공학연구원 | Novel Chrysanthemum Cultivar |
| JP5144347B2 (en) * | 2007-04-26 | 2013-02-13 | 石原産業株式会社 | Method for producing moth orchid with modified flower color |
| CN101538559A (en) * | 2008-11-06 | 2009-09-23 | 北京农学院 | Gene encoding anthocyanidin synthase--key enzyme for last-stage synthesis of plant anthocyanidin |
| CN102864159B (en) * | 2012-08-23 | 2014-02-12 | 北京农学院 | Lilium spp. ANS (Anthocyanidin Synthase) gene and cloning method thereof |
-
2019
- 2019-12-13 CN CN201911278661.XA patent/CN110894507B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110894507A (en) | 2020-03-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yao et al. | Map‐based cloning of the pear gene MYB 114 identifies an interaction with other transcription factors to coordinately regulate fruit anthocyanin biosynthesis | |
| Zottini et al. | Agroinfiltration of grapevine leaves for fast transient assays of gene expression and for long-term production of stable transformed cells | |
| CN112899288B (en) | Wild rose RmNHX2 gene and application thereof in improving salt tolerance of plants | |
| Li et al. | A stable and efficient Agrobacterium tumefaciens-mediated genetic transformation of the medicinal plant Digitalis purpurea L. | |
| CN105647880A (en) | CYP450 gene participating in DMNT and TMTT biosynthesis and coding product and application of CYP450 gene | |
| BR112020026792A2 (en) | LUCIFERINE BIOSYNTHESIS ENZYMES AND USE OF THE SAME | |
| Akhgari et al. | Establishment of transgenic Rhazya stricta hairy roots to modulate terpenoid indole alkaloid production | |
| CN110894507B (en) | Method for inducing Chinese narcissus to generate anthocyanin and application thereof | |
| Chen et al. | Integrated transcript and metabolite profiles reveal that Eb CHI plays an important role in scutellarin accumulation in erigeron breviscapus hairy roots | |
| CN104357479A (en) | Application of interference in expression of xanthein and excessive expression of lycopene in preparation of brassica plants with red petals | |
| Bae et al. | Agrobacterium tumefaciens-mediated transformation of a medicinal plant Taraxacum platycarpum | |
| JP6578681B2 (en) | Plant cultivation method and production of useful protein using the same | |
| CN114395571B (en) | Phaeodactylum tricornutum ZEP1 gene, protein and application | |
| CN114507674A (en) | Application of tea tree circadian rhythm gene LUX in improving cold resistance of plants | |
| CN104531755A (en) | Application of gene for interfering expression of LCYB and LCYE and simultaneously ectopically expressing TT8 in preparation of brassica plant having red petals | |
| CN112391397B (en) | Tobacco flavone monooxygenase gene NtCYP75B2 and application thereof | |
| CN103966234A (en) | Sugarcane anthocyanin adjustment gene ScRS and application thereof | |
| CN110923246B (en) | Tobacco NtMYB12 gene and application thereof in regulation and control of fatty acid synthesis | |
| CN109971744B (en) | Malan blue BcTSA gene and encoded protein and application thereof | |
| CN114214339A (en) | Hemp THCSAS2 gene, terpene phenolic acid oxidative cyclase as coded product thereof and application of terpene phenolic acid oxidative cyclase | |
| CN106636145A (en) | Nemesia strumosa KLM anthocyanin biosynthesis gene, and encoded protein and application thereof | |
| KR102080827B1 (en) | OsPHS3 gene derived from Oryza sativa for enhancing pre―harvest sprouting tolerance and uses thereof | |
| CN106967735B (en) | Safflower CtCHS1 gene, and coding protein and application thereof | |
| CN107459566B (en) | L hWDR protein derived from lily and coding gene and application thereof | |
| CN113528552B (en) | Gene combination for synergetic catalysis of tea tree ester type catechin biosynthesis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |