CN110872584A - Barley α -amylase and coding gene and application thereof - Google Patents

Abstract

The barley α -amylase has an amino acid sequence shown as SEQ ID No.6 or an amino acid sequence which is provided with one or more amino acids and has the same function by substitution, deletion or addition in the sequence, and a nucleotide sequence coded by the gene is shown as SEQ ID No.1 or a sequence with 80% homology with the sequence.

Description

Barley α -amylase and coding gene and application thereof

Technical Field

The invention belongs to the field of plant molecular biology, and particularly relates to a pollen specificity expression α -amylase, which can cause pollen abortion, is applied to a hybrid seed production technical system by utilizing a modern biotechnology, ensures the seed production quality, improves the seed production efficiency, and can also be applied to prevent transgene diffusion.

Background

Although almost all crops utilize the heterosis as much as possible, some limiting factors still exist, such as the great difficulty in breeding excellent combinations, high cost and high risk of hybrid seed production, so that the proportion of hybrid crops is still small, especially rice is the main crop, the commercial application of the heterosis is mainly realized through a breeding route from a three-line method to a two-line method developed in the last century, although the two-line method overcomes the defects of low utilization rate of germplasm resources, long breeding difficulty of sterile lines, high disease risk and the like of the three-line method, the matching freedom degree is improved, the utilization efficiency of the heterosis of the rice is improved, but the temperature-sensitive sterile line of the two-line method is easily influenced by the temperature, so that large-area seed production failure is easily caused, the loss is serious, and the three-series method cannot be completely replaced until now. The above-mentioned defects of "three-line method" and "two-line method" are still key links for restricting the utilization of heterosis of rice, so that researchers strive to develop new methods for improving the utilization efficiency of heterosis of crops, wherein the creation of a good sterile line is the core.

The male sterility of plant is mainly embodied in pollen abortion, and relates to generation and development of stamen in floral organs, tapetum structure, microspore formation, anther cracking, external ecological environment and other links or factors, wherein the pollen development relates to expression regulation of a plurality of genes, and the basis and key point of researching the male sterility of plant are clarified in the whole process and molecular mechanism. In the early 90 s of the last century, Mariani et al used the promoter specific to the anther tapetum (TA29) and the ribonuclease gene (Barnase) recombinant Expression cassette from tobacco to transform tobacco and oilseed rape and succeeded in obtaining male sterile lines, which initiated a new approach to the artificial preparation of male sterile lines (Denis M, Delourme R, Gourret J P, et al. Expression of nucleic acid male sterility in Brassica napus (genetics, morphology, cytotoxicity, and sensitivity to temperature) [ J ] Plant Physiology, 1993,101(4): 1304.). The feasibility of creating transgenic male sterile plants by using other functional genes through a genetic engineering method is shown.

The researchers have obtained cDNA sequences of various amylase genes (mentioned above, the diversity of genes of mazino east (2009) amylase. high school of pasture, high school of record, 29(2):21-23) by using genetic engineering techniques, studies on the diversity thereof show that the genes have diversity in gene structure and function in addition to the diversity of sources, α -amylase, β -amylase, gamma-amylase, isoamylase and the like, wherein the enzymes belong to the group of endonucleases, and the enzymes are capable of cleaving starch from pollen grains, and the enzymes have been capable of forming a proper amount of energy for pollen germination and pollen tube elongation, thus, if the starch in the pollen grains is degraded in advance, disrupting its energy source, thus preventing normal development of pollen and preventing pollen tube from completing the fertilization process, thus resulting in male sterility of plants, amylase is a generic term for starch and glycogen, starch production, pollen yield, pollen production, and energy consumption, etc. 2.

Therefore, the invention specifically regulates and controls the space-time expression of amylase by means of genetic engineering to obtain transgenic pollen abortion plants, realizes the breeding of non-transgenic sterile lines and the production of non-transgenic hybrids, and particularly provides a new choice in the aspects of controlling fertility, transgene drift and the like.

Disclosure of Invention

The invention aims to provide application of barley α amylase in pollen abortion and preparation of transgenic pollen abortion plants.

In order to achieve the above purpose, the barley α -amylase provided by the invention has the amino acid sequence as follows:

a) an amino acid sequence shown as SEQ ID No. 6; or

b) The amino acid sequence shown in SEQ ID No.6 is formed by replacing, deleting and/or adding one or more amino acid residues to form an amino acid sequence with the same function.

The invention provides a gene for coding barley α -amylase, which comprises the following steps:

1) the nucleotide sequence shown as SEQ ID No.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 80 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein.

Those skilled in the art can easily identify and utilize a DNA molecule complementary to the nucleotide sequence of the plant pollen abortion gene α -amylase for the same purpose, and therefore, an isolated sequence having promoter activity and hybridizing to the present abortion gene α -amylase sequence or a fragment thereof under stringent conditions is included in the present invention.

Wherein, the nucleotide sequence is complementary, which means that the nucleotide sequence can be hybridized with α -amylase under strict conditions.

Stringent conditions refer to conditions under which a probe will hybridize to a detectable degree to its target sequence over other sequences (e.g., at least 2 times background). Stringent conditions are sequence dependent and will vary from one environment to another. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified that are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some sequence mismatches so that a lower degree of similarity is detected (heterologous detection). Generally, probes are shorter than about 1000 nucleotides in length, preferably shorter than 500 nucleotides in length.

Typically, stringent conditions are those in which the salt concentration is less than about 1.5M Na ion, typically about 0.01-1.0M Na ion concentration (or other salts) at a pH of 7.0-8.3, and the temperature is at least about 30 ℃ for short probes (e.g., 10-50 nucleotides) and at least about 60 ℃ for long probes (e.g., more than 50 nucleotides). Stringent conditions may also be achieved by the addition of destabilizing agents such as formamide. Low stringency conditions, for example, include hybridization in 30-35% formamide, 1M NaCl, l% SDS (sodium dodecyl sulfate) buffer at 37 ℃ and washing in 1 × to 2 × SSC (20 × SSC ═ 3.0M NaCl/0.3M trisodium citrate) at 50-55 ℃. Moderately stringent conditions, for example, comprise hybridization at 37 ℃ in a buffer solution of 40-45% formamide, 1.0M NaCl, l% SDS, washing at 55-60 ℃ in 0.5X to 1 XSSC. Highly stringent conditions, for example, include hybridization in a buffer solution of 50% formamide, 1M NaCl, l% SDS at 37 ℃ and washing in 0.1 XSSC at 60-65 ℃. Optionally, the wash buffer may contain about 0.1% to 1% SDS. Hybridization times are generally less than about 24 hours, usually about 4-12 hours.

Particularly typically as a function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, Tm can be estimated from the equation of Meinkoth and Wahl (1984) anal. biochem.138:267-284, Tm 81.5 ℃ +16.6(logM) +0.41 (% GC) -0.61 (% form) -500/L; where M is the molar concentration of monovalent cations,% GC is the percentage of guanine and cytosine nucleotides in DNA,% form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in a base pair. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm needs to be lowered by about l ℃ per 1% mismatch; thus, Tm hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if the sought sequence has > 90% identity, the Tm can be lowered by 10 ℃. Generally, stringent conditions are selected to be about 5 ℃ below the thermal melting point (Tm) for the particular sequence, and which are complementary at a defined ionic strength and pH. However, highly stringent conditions may employ hybridization and/or washing at 1, 2, 3, or 4 ℃ below the thermal melting temperature (Tm); moderately stringent conditions can employ a hybridization and/or wash at 6, 7, 8, 9, or 10 ℃ below the thermal melting point (Tm); low stringency conditions can employ hybridization and/or washing at 11, 12, 13, 14, 15, or 20 ℃ below the thermal melting point (Tm). Using this equation, hybridization and wash compositions, and desired Tm, one of ordinary skill in the art will appreciate that the conditions of the hybridization and/or wash solutions will vary with stringency. If the desired degree of mismatch is such that the Tm is below 45 deg.C (aqueous solution) or 32 deg.C (formamide solution), it is preferred to increase the SSC concentration to enable the use of higher temperatures. Guidelines for nucleic acid hybridization are found in Tijssen (1993) biochemical and molecular biology laboratory techniques employing nucleic acid probe hybridization, part I, chapter 2 (Elsevier, New York); and Ausubel et al, edited (1995) Chapter 2, a modern method of molecular biology (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al (1989) molecular cloning, A Laboratory Manual (second edition, Cold Spring Harbor Laboratory Press, Plainview, New York).

The stringent conditions are preferably hybridization at 65 ℃ in a solution of 6 XSSC (sodium citrate), 0.5% SDS (sodium dodecyl sulfonate), followed by washing the membrane 1 time each with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.

The invention provides a biological material containing the barley α -amylase gene, which is a recombinant expression vector, an expression cassette, a recombinant bacterium or a host cell.

The biomaterial provided by the invention also comprises a transduction peptide and a male gamete priority promoter.

Further, the expression cassette provided by the invention contains DNA segments shown in SEQ ID No.1-3, or 1, 2, 4 or 1, 2, 5.

Wherein the sequence length shown in SEQ ID No.1 is 1281bp, which is a barley pollen abortion gene α -amylase forward DNA fragment, the sequence length shown in SEQ ID No.2 is 216bp transduction peptide, the sequence length shown in SEQ ID No.3 is 2737bp male gamete priority type promoter PG47, the sequence length shown in SEQ ID No.4 is 2038bp male gamete priority type promoter PC32, and the sequence length shown in SEQ ID No.5 is 1960bp male gamete priority type promoter PCHF 15.

The recombinant expression vector containing the barley α -amylase can transform plant cells or tissues by conventional biological methods such as an agrobacterium-mediated method, a gene gun method, a pollen tube channel method and the like to obtain independent transgenic cells or tissues, and obtain a transgenic strain containing transgenic components and used for pollen abortion.

The invention provides application of the barley α -amylase or the coding gene thereof or the biological material containing the coding gene thereof in degrading starch in plant pollen or disturbing development of the plant pollen.

The invention provides application of the barley α -amylase or the coding gene thereof or biological material containing the coding gene thereof in inducing plant male sterility.

The invention provides application of the barley α -amylase or the coding gene thereof or biological material containing the coding gene thereof in preparing pollen abortion transgenic plants.

The transgenic plant is a transgenic plant with exogenous genes specifically expressed in pollen, preferably a transgenic plant with enhanced/weakened pollination/fertilization capability, and more preferably a male sterile transgenic plant.

The invention provides application of the barley α -amylase or the coding gene thereof or biological material containing the coding gene thereof in crop breeding.

The invention provides a method for degrading starch in plant pollen so as to prevent diffusion of exogenous genes, which is characterized in that an expression cassette containing a barley α amylase gene is introduced into a plant to obtain a transgenic plant with aborted transgenic pollen, so that the pollen of the transgenic plant cannot be pollinated normally, and thus, the diffusion of the exogenous genes in the plant pollen is prevented.

The invention provides a method for producing non-transgenic seeds by using a transgenic plant containing barley α -amylase gene, which is characterized in that the transgenic plant containing barley α -amylase gene is used as a maintainer line in a hybrid crop to pollinate a male sterile line of a plant, the sterile line is harvested to obtain seeds, and the seeds are non-transgenic seeds to realize sterile line breeding or hybrid seed production.

The nucleotide sequence of the barley α amylase gene is as follows:

1) the nucleotide sequence shown as SEQ ID No.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein.

The plant is selected from plants of Gramineae, Leguminosae, Malvaceae, and Brassicaceae. Such plants include, but are not limited to, rice, corn, sorghum, barley, oats, wheat, millet, sugarcane, soybean, brassica species, cotton, safflower, tobacco, alfalfa, and sunflower.

The invention has the beneficial effects that:

(1) the pollen abortion gene α -amylase is separated from barley, is very beneficial to genetic engineering of rice, corn, wheat and the like, and is used as an endogenous gene of barley to greatly influence the genetic engineering of barley.

(2) Iodine staining experiments of barley α -amylase pollen grains show that α -amylase can precisely act on the pollen grains under the drive of a promoter PG47, so that the ratio of fertile pollen to abortive pollen is 1: 1.

(3) The plant α -amylase gene expression of the invention is accurate in regulation and control, can control transgene diffusion, can be used for maintaining and propagating male sterile lines, simultaneously saves the manual emasculation step in the hybrid seed production process, and has wide application prospect.

Drawings

FIG. 1 is a flow chart of construction of a recombinant expression vector DX2182-HVAA1 of a pollen abortion gene barley α -amylase HVAA1 in example 2.

FIG. 2 is a photograph of iodine-stained rice pollen of example 4, WT pollen stained flower 11 in wild type rice, and HVAA1 abortion gene pollen stained barley α -amylase rice line pollen.

FIG. 3 shows the screening results of hygromycin from the inbred seeds of DX2182-HVAA1 transgenic rice in example 5, ZH11 (non-transgenic control), 14-2(T1),40-2(T1) are all transgenic barley α -amylase rice strain T1 generations, 1/2MS rooting medium, 1/2MS + Hn is the rooting medium to which hygromycin as a screening agent is added.

FIG. 4 shows the results of hygromycin screening 28d for DX2182-HVAA1 transgenic rice hybrid seeds in example 6, ZH11 (non-transgenic control), 14-2(T2),40-2(T2) were all derived from transgenic barley α -amylase rice line T2 generations, 14-2 1907, 40-2 1907 (transgenic barley α -amylase rice line T2 generations 14-2, 40-2 pollinated to non-transgenic rice 1907 hybrid seeds, 1/2MS (rooting medium), 1/2MS + Hn (rooting medium) supplemented with hygromycin screening agent.

FIG. 5 is the electrophoresis diagram of PCR detection of the transgenic components of hybrid obtained by pollination of a DX2182-HVAA1 transgenic rice line in example 6. CK-: flower 11 in a non-transgenic control; CK +: DX2182-HVAA1 vector; 1-10: and randomly selecting hybrid seedlings. Hn: hygromycin primers (SEQ ID NOS: 11-12), P1: crossing the pG47 promoter with the HVAA1 primer (SEQ ID NO:13-14), P2: trans HVAA1 and terminator primers (SEQ ID NOS: 15-16).

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The reagents used in the examples are commercially available unless otherwise specified.

Example 1 barley α -Amylase acquisition

1. Extraction of barley RNA

Barley RNA was extracted using the Biozol Reagent method: weighing 0.1g of fresh young ear tissue of barley, adding 1ml of Biozol Reagent, mixing uniformly, and standing for 5min at room temperature; adding 0.2ml of chloroform into 1ml of Biozol Reagent, shaking for 15s with force, standing for 5min at room temperature after the solution is fully emulsified, and centrifuging for 15min at 4 ℃ at 12000 rpm; carefully taking out the centrifuge tube from the centrifuge, sucking the supernatant and transferring the supernatant into another new centrifuge tube; adding isopropanol with the same volume into the supernatant, turning the centrifuge tube upside down, fully mixing, standing at room temperature for 10min,12000rpm, and centrifuging at 4 ℃ for 10 min; discarding supernatant to obtain white precipitate, washing with 0.5ml 75% ethanol (prepared with RNase-free water), reversing, mixing, centrifuging at 4 deg.C for 5min at 10000 rpm; repeating the above steps once, drying at low temperature to volatilize ethanol; dissolving the precipitate with 50 μ l RNase-free water, adding DNase I to digest the genomic DNA, repeating the chloroform extraction and isopropanol precipitation until the water is added for dissolution (same procedure as above), and storing at-80 deg.C.

2. Barley cDNA Synthesis

The method comprises the following steps of (1) carrying out reverse transcription by using barley RNA as a template and using reverse transcriptase M-MLV, wherein the specific method comprises the following steps: (1) on ice configuration

RNA 5-10μl

Olig(dT) 2μl

RNase-free H₂O to 14.5. mu.l

Mixing uniformly

(2) 5min at 70 ℃ and immediately on ice, secondary structures were opened.

(3) Adding reverse transcriptase and the like:

mixing uniformly

(4) Extension for 90 minutes at 42 ℃. 70 ℃ for 15 minutes. Barley cDNA was obtained, stored in aliquots at-40 ℃.

Note: all the experimental products were RNase-free.

3. Barley α -Amylase amplification

The nucleotide sequence (shown as SEQ ID NO:1 in a sequence table) of the α -amylase HVAA1(LOC101768040) gene of barley was obtained by NCBI database, the amino acid sequence (shown as SEQ ID NO:6 in the sequence table). primers (shown as SEQ ID NO:7-8 in the sequence table) were designed according to the sequence, and the primer design used in the Gibson Assembly method, in which about 15 nucleotide sequences at the 5' ends of both upstream and downstream primers were repeated at the corresponding connection positions of the vector to allow the Gibson Assembly to be connected, and the amplification system and program were obtained by PCR using barley cDNA as a template as follows:

PCR program including pre-denaturation at 94 deg.C for 3min, denaturation at 94 deg.C for 30s, annealing at 55-65 deg.C for 40s, extension at 68 deg.C for 1min for 20s, 35 cycles, and extension at 68 deg.C for 10 min.

Example 2 construction of pollen abortion Gene plant binary expression vector DX2182-HVAA1

The construction process is shown in figure 1, and the amplification product of example 1, namely the primer SEQ ID NO:7-8 amplification PCR product, is subjected to 1% agarose gel electrophoresis to recover a product of about 1300bp, and is inserted into a linear enzyme digestion vector of DX2182 (disclosed in Chinese patent CN106434673A, the name of the invention is plant anther specific promoter PCHF15 and application thereof) through MluI and SacI. Wherein the DX2182 vector already contains pG47 optimized promoter and terminator and is respectively positioned at two sides of MluI and SacI enzyme cutting sites, so that the MluI and SacI enzyme cutting vector DX2182 recovers a linear enzyme cutting vector, is connected with a PCR product amplified in the embodiment 1 according to a certain proportion, and finally constructs a binary vector of the pollen-specific expression cassette containing HVAA 1.

The 2X ligation kit was used to ligate the abortion gene to DX2182 in a 10. mu.l system as follows:

α -Amylase PCR product (50ng) 2.5. mu.1

Restriction enzyme vector (100ng) 2.5. mu.1

Ligation Mix 5μ1

And (3) connecting procedures: 60 minutes at 50 ℃.

And (3) transformation: e.coli competent cells were transformed with 2. mu.1 of the ligation product by electric shock, spread on LB plates containing kanamycin resistance, selected positive clones for sequencing, and the recombinant vector with correct sequencing was named DX2182-HVAA1, whose sequence is shown in SEQ ID NO. 9.

Example 3 creation of HVAA1 transgenic Rice

Agrobacterium EHA105, stored at-70 ℃ was streaked onto YEP plates containing Rif (25. mu.g/ml) + streptomycin (50. mu.g/ml) and cultured at 28 ℃. Single colonies were picked and inoculated into 50ml YEP broth containing the above antibiotics and cultured with shaking at 220rpm for 12-16h at 28 ℃. Transferring 2ml of the bacterial solution into 100ml of YEP liquid culture medium (containing the above antibiotics), and performing shaking culture at 28 ℃ and 220rpm until OD₆₀₀0.5. Pre-cooled on ice for 10 minutes at 5000rpm for 10min (refrigerated centrifuge pre-cooled to 4 ℃). The gel was washed 2 times with sterile deionized water (10 ml each) and 1 time with 10% glycerol in 3ml of 10% glycerol. Mu.l of the DX2182-HVAA1 plasmid of example 2 was added to 100. mu.l of the competent cells, and the cells were transformed by 2.5KV electroporation. Culturing on YEP culture plate containing kanamycin, rifampicin and streptomycin, selecting positive clone, and loading with DX2182-HVAA1PCR verification of body-specific primers SEQ ID NO 11-12.

The correct clones were verified and rice Zhonghua 11(Hiei Y OhtaS, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium infection with medium by Agrobacterium and sequence analysis of the nucleic acids of the T-DNA. the Plant Journal 6:271-282) was infected by Agrobacterium-mediated genetic transformation. Obtaining T0 transgenic seedlings through links of co-culture, screening, differentiation, rooting and the like, extracting DNA, obtaining T1 transgenic plants through PCR verified transgenic positive plants, selfing and fructification, and taking T1 plants for subsequent analysis. Wherein the DX2182-HVAA1 vector contains hygromycin resistance gene, the sequence of the gene is shown in SEQ ID NO. 10, hygromycin can be used for screening transgenes to obtain a resistance plant; meanwhile, transgenic progeny seeds can be screened to obtain resistant plants.

Example 4 analysis of pollen fertility of HVAA1 transgenic Rice

Preparing potassium iodide staining solution (2 g KI is dissolved in 5-10mL distilled water, and then 1g I is added₂(dissolving with appropriate amount of anhydrous ethanol), and adding distilled water to a constant volume of 300mL after all the materials are dissolved. Storing in brown bottle, using potassium iodide: diluting deionized water into iodine dye working solution according to the proportion of 1: 1). Mature pollen of HVAA1 rice transgenic plant is subjected to staining microscopy to analyze pollen fertility, and the specific steps are as follows:

1. pollen collection: taking the anther which is fully mature and is going to be powdered, stripping the glumes, taking out the anther, and placing the anther on a glass slide.

2. Microscopic examination: approximately 70 μ l of the iodophor working solution was dropped on the anther, the anther was mashed with tweezers thoroughly, the pollen grains were released, and the cover slip was covered and observed under a low power microscope. Every pollen grain dyed in bluish-black color is fertile pollen grain, and the pale yellow is abortive pollen grain.

Potassium iodide staining analysis of pollen grains of transgenic plants shows that the ratio of fertile pollen to abortive pollen is 1:1, namely about 50% of pollen can be stained blue black to show normal fertility, about 50% of pollen can not be stained blue black to show abortive pollen (shown in figure 2.HVAA1 abortive gene), while wild type pollen can be stained blue black to show complete fertility (shown in figure 2. WT), showing that barley α -amylase can degrade starch in rice pollen grains to ensure that the energy supply in the development process is insufficient, so that pollen abortive is caused.

Example 5 isolation screening of inbred seed of HVAA1 transgenic Rice

According to the genetic rule, if the fertile pollen: the abortive pollen meets the separation ratio of 1:1, half of self-bred seed is non-transgenic seed, and half of self-bred seed is transgenic seed, so that hygromycin is used for screening and verifying T1 generation seeds of HVAA1 transgenic rice lines 14-2 and 40-2, and the scheme is as follows:

seeds of the wild type control flower 11(ZH11), the transgenic lines 14-2 and 40-2(T1) are taken, sterilized by sodium hypochlorite, and then respectively paved in a rooting medium (1/2 MS medium) and a rooting medium added with 40mg/L hygromycin (Sigma) for screening, and after 14 days, the survival rate is observed and counted (as shown in figure 3). And (3) displaying a statistical result: ZH11 can normally take root and sprout in the rooting culture medium, the survival rate is 96.00 percent, 14-2 and 40-2 can also normally take root and sprout, and the survival rate reaches more than 90.00 percent; ZH11 was completely inhibited under hygromycin screening, while the selfed seed fraction of line 14-2 was able to normally root and germinate with a survival rate of 49.00%, and the 40-2 line was similar to line 14-2 with a survival rate of 52.50%, with a segregation ratio of 1:1 (see Table 1).

TABLE 1 screening and segregation ratio of HVAA1 transgenic rice inbred seed

Example 6 detection of transgenic pollen escape Rate

In order to further detect the pollen abortion efficiency caused by HVAA1 and detect whether the transgenic pollen escapes, the embodiment pollinates non-transgenic rice materials through an HVAA1 transgenic rice strain, obtains hybrid seeds, detects whether the hybrid seeds have hygromycin resistance through hygromycin screening (the method is the same as the embodiment 5), and if so, the transgenic pollen escapes; if not, the HVAA1 has good working efficiency and can prevent transgene from escaping.

Pollinating the transgenic line to a sterile line 1907(14-2 × 1907 and 40-2 × 1907) to obtain 117 and 92 hybrid seeds respectively, screening the hybrid seeds by hygromycin, observing after 14d, that the hybrid seeds have strong germination vigor and a part of the hybrid seeds grow into seedlings, but when the screening culture is continued for about 28 days, the seedlings gradually die off in yellow, but the plants with resistance in the 14-2 and 40-2 selfing seeds can survive and grow into plants (as shown in figure 4). Thus, the 28d statistical survival rate showed: ZH11 can normally take root and sprout in the rooting culture medium, the survival rate is 96.00 percent, 14-2 and 40-2 can also normally take root and sprout, the survival rate reaches more than 90.00 percent, and the germination rate (survival rate) of the hybrid seeds of' 14-2X 1907 and 40-2X 1907 is higher due to the hybrid advantages; ZH11 was completely inhibited under hygromycin screening, while the survival rate of 14-2 selfed seeds was 47.5%, the survival rate of 40-2 was 51%, the segregation ratio was 1:1 (see Table 2), and the hybrid seeds of 14-2X 1907 and 40-2X 1907 were both inhibited and could not survive.

TABLE 2 detection of transgene pollen escape Rate

In order to further detect that the hybrid seed germinated seedlings are non-transgenic seedlings, part of the hybrid seed germinated seedlings are randomly selected, genome DNA is extracted, 3 pairs of specific primers are utilized for PCR amplification to identify whether transgenic elements exist, the result shows that the hybrid seed germinated seedlings cannot amplify transgenic segment strips and are consistent with a negative control (as shown in figure 5), and further shows that no transgenic elements escape.

Therefore, the barley α -amylase gene disclosed by the invention can degrade starch in pollen grains, so that rice transgenic pollen abortion is caused, and transgenic crops can be effectively prevented from transmitting transgenic elements to other crop varieties through pollen.

In conclusion, the α -amylase influencing the male fertility of the plant is from barley, is cloned for the first time, can degrade starch in pollen grains to cause rice transgenic pollen sterility, has high accuracy and good efficiency, effectively prevents transgenic crop pollen from escaping, can be used for keeping the homozygous recessive state of male sterile plants, simultaneously saves the step of manual emasculation in the hybrid seed production process, and has higher practical value.

Sequence listing

<110> Hainan Borax Rice Gene science and technology Co., Ltd

<120> barley α -amylase and coding gene and application thereof

<130>KHP181114257.0

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>1281

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gcgtccggcc accaagtcct ctttcagggg ttcaactggg agtcgtggaa gcagagcggc 60

gggtggtaca acatgatgat gggcaaggtc gacgacatcg ccgctgccgg agtcacccac 120

gtctggctgc caccgccgtc gcactccgtc tccaacgaag gttacatgcc tggtcggctg 180

tacgacatcg acgcgtccaa gtacggcaac gcggcggagc tcaagtcgct catcggcgcg 240

ctccacggca agggcgtgca ggccatcgcc gacatcgtca tcaaccaccg ctgcgccgac 300

tacaaggata gccgcggcat ctactgcatc ttcgagggcg gcacctccga cggccgcctc 360

gactggggcc cccacatgat ctgtcgcgac gacaccaaat actccgatgg caccgcaaac 420

ctcgacaccg gagccgactt cgccgccgcg cccgacatcg accacctcaa cgaccgggtc 480

cagcgcgagc tcaaggagtg gctcctctgg ctcaagagcg acctcggctt cgacgcgtgg 540

cgccttgact tcgctagggg ctactcgccg gagatggcca aggtgtacat cgacggcaca 600

tccccgagcc tcgccgtggc cgaggtgtgg gacaatatgg ccaccggcgg cgacggcaag 660

cccaactacg accaggacgc gcaccggcag aatctggtga actgggtgga caaggtgggc 720

ggcgcggcct cggcaggcat ggtgttcgac ttcacgacca aagggatact gaacgctgcc 780

gtggagggcg agctgtggag gctgatcgac ccgcagggga aggcccccgg cgtgatggga 840

tggtggccgg ccaaggccgc caccttcgtc gacaaccacg atacaggctc cacgcaggcc 900

atgtggccat tcccctccga caaggtcatg cagggctacg cgtacatcct cacccacccc 960

ggcatcccat gcatcttcta cgaccatttc ttcaactggg ggtttaagga ccagatcgcg 1020

gcgctggtgg cgatcaggaa gcgcaacggc atcacggcga cgagcgctct gaagatcctc 1080

atgcacgaag gagatgccta cgtcgccgag atagacggca aggtggtggt gaagatcggg 1140

tccaggtacg acgtcggggc ggtgatcccg gccgggttcg tgacctcggc acacggcaac 1200

gactacgccg tctgggagaa gaacggtgcc gcggcaacac tacaacggag ctgaagtctg 1260

cactgatccg tcattcgatc g 1281

<210>2

<211>216

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgctgtgtc tcacctcctc ttcctcctcc gcgcccgctc cgctccttcc ctctctcgct 60

gatcgaccga gcccgggaat cgcgggcggg ggtggcaatg ttcgcctgag cgtggtttct 120

tcgccgcgcc ggtcgtggcc tggaaaggtc aagaccaatt tctcagttcc tgcgactgcg 180

cgaaaaaaca aaaccatggt gactgttgtg gaggag 216

<210>3

<211>2737

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcaccggaca ctgtctggtg gcataccaga cagtccggtg tgccagatca gggcaccctt 60

cggttccttt gctcctttgc ttttgaaccc taactttgat cgtttattgg tttgtgttga 120

acctttatgc acctgtggaa tatataatct agaacaaact agttagtcca atcatttgtg 180

ttgggcattc aaccaccaaa attatttata ggaaaaggtt aaaccttatt tccctttcaa 240

tctccccctt tttggtgatt gatgccaaca caaaccaaag aaaatatata agtgcagaat 300

tgaactagtt tgcataaggt aagtgcatag gttacttaga attaaatcaa tttatacttt 360

tacttgatat gcatggttgc tttcttttat tttaacattt tggaccacat ttgcaccact 420

tgttttgttt tttgcaaatc tttttggaaa ttctttttca aagtcttttg caaatagtca 480

aaggtatatg aataagattg taagaagcat tttcaagatt tgaaatttct ccccctgttt 540

caaatgcttt tcctttgact aaacaaaact ccccctgaat aaaattctcc tcttagcttt 600

caagagggtt ttaaatagat atcaattgga aatatattta gatgctaatt ttgaaaatat 660

accaattgaa aatcaacata ccaatttgaa attaaacata ccaatttaaa aaatttcaaa 720

aagtggtggt gcggtccttt tgctttgggc ttaatatttctccccctttg gcattaatcg 780

ccaaaaacgg agactttgtg agccatttat actttctccc cattggtaaa tgaaatatga 840

gtgaaagatt ataccaaatt tggacagtga tgcggagtga cggcgaagga taaacgatac 900

cgttagagtg gagtggaagc cttgtcttcg ccgaagactc catttccctt tcaatctacg 960

acttagcata gaaatacact tgaaaacaca ttagtcgtag ccacgaaaga gatatgatca 1020

aaggtataca aatgagctat gtgtgtaatg tttcaatcaa agtttcgaga atcaagaata 1080

tttagctcat tcctaagttt gctaaaggtt ttatcatcta atggtttggt aaagatatcg 1140

actaattgtt ctttggtgct aacataagca atctcgatat cacccctttg ttggtgatcc 1200

ctcaaaaagt gataccgaat gtctatgtgc ttagtgcggc tgtgttcaac gggattatcc 1260

gccatgcaga tagcactctc attgtcacat aggagaggga ctttgctcaa tttgtagcca 1320

tagtccctaa ggttttgcct catccaaagt aattgcacac aacaatgtcc tgcggcaata 1380

tacttggctt cggcggtaga aagagctatt gagttttgtt tctttgaagt ccaagacacc 1440

agggatctcc ctagaaactg acaagtccct gatgtgctct tcctatcaat tttacaccct 1500

gcccaatcgg catctgaata tcctattaaa tcaaaggtgg atcccttggg gtaccaaaga 1560

ccaaatttag gagtgtaaac taaatatctc atgattcttt tcacggccct aaggtgaact 1620

tccttaggat cggcttggaa tcttgcacac atgcatatag aaagcatact atctggtcga 1680

gatgcacata aatagagtaa agatcctatc atcgaccggt ataccttttg gtctacggat 1740

ttacctcccg tgtcgaggtc gagatgccca ttagttccca tgggtgtcct gatgggcttg 1800

gcatccttca ttccaaactt gttgagtatg tcttgaatgt actttgtttg gctgatgaag 1860

gtgccatctt ggagttgctt gacttgaaat cctagaaaat atttcaactt ccccatcata 1920

gacatctcga atttcggaat catgatccta ctaaactctt cacaagtaga tttgttagta 1980

gacccaaata taatatcatc aacataaatt tggcatacaa acaaaacttt tgaaatggtt 2040

ttagtaaaga gagtaggatc ggctttactg actctgaagc cattagtgat aagaaaatct 2100

cttaggcatt cataccatgc tgttggggct tgcttgagcc cataaagcgc ctttgagagt 2160

ttataaacat ggttagggta ctcactatct tcaaagccga gaggttgctc aacatagacc 2220

tattcacccc atttgatcac ttttttggtc cttcaggatc taatagttat gtataattta 2280

gagtctcttg tttaatggcc agatatttct aattaatcta agaatttatg atatttttta 2340

attttttatc atgtctgatg agaattaaca taaaggctca attgggtcct gaattaataa 2400

tagagtgaaa attaatccag aggctctatt agaaccttca attagtaata ccaagatata 2460

tataagatag tagagtatag tttaaatgtt ggcattgttc attctttctt ttgttattta 2520

atttatgctt tccacggtgg ttagtggtta cttctgaagg gtccaaataa tgcatgaaga 2580

gtttgaggac aagaagtctg ccctaaaaat agcgatgcaa aggcatggtg tccaagccat 2640

acatatagcg cactaatttt atcagcagaa caatggtatt tataggtcct agtgcccagg 2700

caacaagaga cacgaataaa gcatcgatca cgacaag 2737

<210>4

<211>2038

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gataatgaca gcctaggcgg aggtgcggta aagcttgccg aaaacatgca gaagagcaac 60

gacggcaatg aacccaatgc tcatgatgag gactgagttc ggggacatct tgcgcccagc 120

agcctcatcg gtgtagaact ggagcattgt gctggcaccg cctccaccag tgccactgct 180

ggtggttcta cgcctgcgca agcttgcagc agctgctgca ctccctctag ccggggcatc 240

tccattggcc accatcttgc tttatccctc tgcatgataa tatgagtttc aaatgtaagg 300

tttgcagcac taatattaca gaaaaccaac agaacaacag agtttcatcc aaagtcgtat 360

tgcatataca taggaagtgt taaaatatgt ctatcatttt ggaagatacg gtttatgctg 420

tcacacagca ttttggaagt gactatttta taagcacaga agtttcttca atgtggaata 480

tgtcaaaagg caaaataaga agcacagaag tttcttcaat gtggaatatg tcagaaggca 540

gaataaggta cacatcttgg aagtgtatga tagtactaca ccaataccag tgaagtttta 600

gttgtcacat ttgagtgcta ataaaaatat aaaaaagaaa tggttgctgt tgctcatgcc 660

tatatacatt cataatctat caaactaact gctcctggat gctgcataac tataactaaa 720

caagcttaag ttaaatttac cacagaaaaa gaaaaaatga caactagtcc cagaattctg 780

ctgaaaaatt ttggggctgt cctgggcttg gccaaacacc cattgacatg atgctgccca 840

agtgtaagaa ctgtaaaaca agtatagtgt ctgtgtatgt acagggatgg cagcatattc 900

attgctgcaa cacaagctac gctacatgaa accaatttct tacgctggaa tatgaacaaa 960

caacatggag gagagatttc gtaatagaat tttgagcaaa tatgttggta cggacaaaat 1020

gatcccccac aaaaatccgc agagaagatc atgagtgaca cgcgatatat gaggtaacac 1080

acgaacatct tatcaagaat tcagatccat tcccagatcc tgacaaagca ctagaactac 1140

aacagaaata cttcgataaa acaattcgat ttcccttcat gacacatcct aacatcacat 1200

caaacccccc gcagccaatc tgaattctga acagcaagat ctggaacaga agcggtaccc 1260

atcccagaat tctaaatcgg ccaaaccaaa caagcccgat ctaagacatc gattcaacat 1320

gaacgcgtac ggaatcaaag caggctaatc ggagagatgg cgaaaagagg atgattttcg 1380

cgcgcacctg atgaatctgc cctgcgccaa tcgctcgtgc tcccgtccca acttggtcac 1440

tcgtcttctc gcccgaaaat ctgagtgcgg aattcagaat tctctccgcg tctgaacccg 1500

cgcgctgata tctacccaac tggctggatt aacgggttcc gttcaagatc cgatatcaag 1560

tgacgtggtc ggcgcgatct gattggccgg agcgcgtctc cgcgcgtcga tctgagccgt 1620

ccgattcgtt gccgggtccc gatcgcgcgg cctggtgtga aacgggtggc gtcaccgcgt 1680

gcggcgtggc actgtgacgt ggcaacggtt atgcggttat gcacagtcat gggctggacc 1740

ttttggccca acatctgtgg actcgtggac cgggtttcgg cccttttatc cgctctacgg 1800

acgcagtcca cgtcagccga cgtgggtccc accacgaagg gcgtgcctcc ctctaaaaat 1860

tgccaatgac gataagagca aagacggacg ggaggggagg ggtccaaatt aaaactccaa 1920

aatccattcg aacagcgaag gaaatttgtt ggaaaatttt gagatttgga tttttgttct 1980

aggagagggg aaggttagaa gaagttgaga tcggtggaga actggagatc gaggggag 2038

<210>5

<211>1960

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

acgtacgacg aggatgatat cctaacctct tcaaaataac aaagccttag aatttgatta 60

aacatacctt tgtatatgct tggtgtattt ccatgtttgt tttgtgcttc acaaaacagc 120

gaacatattt tattcacggg atataaaata tctacttgag tgtagtgata cattaatatc 180

ttaaaagaaa caaactttac aaacaactta ggacagttgt ctaagcaatt taagattttt 240

tttgacaaat cctattttta gaaacataaa gcaaataatc ataaaaaaca atccaataga 300

ttaattacaa aatcacataa gaccttattg gtttggagaa gattaaaaag gattggaggg 360

aattgatgga aaataattta acacaataat aagtgtaaat aaattgcttc caatccctcc 420

tttacgggga ttaactgaac atggtctaac tgaattgtca ctacagtcga ttggtattat 480

gagatgaaaa actgaacaat tgttgacacg tgcaatggca atatctctcc gagcatgatc 540

cgaatcccct gcagtttgaa ttgctaatgc tacagtcttt ctcggtagca cttgagcact 600

tagattaaaa acgaaacggt tcagatcagc aagtattgta gcatcaatat tttatttttt 660

agcttgtact atcacgttaa taccgtagag gttggttata gccctagaat tatgaataga 720

aggtgcagat ttctcctaat ttaatttact gtagcacctc tccatttcat actctaatgc 780

agaggatccc aatccgagca atacatgctt gatgaaacat gctggataca acacaaatag 840

gattgtgata tgattacgaa aagtggtatg gatttcgtga tgattgttgc aaagtaccac 900

tgccgaccat gtacgcaagg aagcgcgaga tgacgagggg caaaatgggg aaaccacact 960

ggaaactggc tgcgcggcgt agcccgagac caaagagcat ccatctccat ctccgagccc 1020

gacctcgcga acagcccaca cgtacgttac tgacgccata acgtccgagc cacccaccaa 1080

ctaaccaacc gacatgtggg ccacagccgt tgagccccac actccagtgt ccgtttacgt 1140

atcgcgtcca gggaggagag cacggatcgc aacggaaagt gcggcgtgca caaaaaactc 1200

cgtatccagc aactggcatg tgggccccac aggatggagg ccccacatgt cagttttttt 1260

ggggggtgtc tccgtctttt ctctatggtt tgaatgttct tgggcgtacg gctgtcacgt 1320

gtttccggcg gacgagtctt ttttcagcgg taggggtagt acggctgcca tgtgggaccc 1380

accaccgaaa accgtagtga ctctctctct ctctctctct ctccatgcaa aagaaaggaa 1440

agagaacagc tttcgcgatg ggacggttga ttctcctgct tgtctcgctc gaccgccgac 1500

gacgaagata cattgtactc ccgtctcact gccaggtggg cccggacgtc gtgtgcggtt 1560

ggcgcaacgc gcaacgattt gggcaacacg actaccacgc cggtttcgag gtttttgttg 1620

tagacgcagt ccatggaccg acgcgatcag tagccgtcca ttctgggcct ctaagattct 1680

cgaagcggtc gatcctgtgg actgggtcta cgctgaatct acggaaccaa ccgactaacg 1740

aggtaaccaa ctgtttactg gtctccatca agtttataac cgctcgcgtc gcgcccatct 1800

ccaccaatcc accaccgcca cgccacttca cccttgtttt ttttttcccc ttctcgcaaa 1860

gttcaaaccc cctcttcttc cctccctcct ctcctctcct cgcttccggg ttccgccgcg 1920

gcttcatccg atcgcccgcg ccaagaactc gatcctcatg 1960

<210>6

<211>427

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Ala Ser Gly His Gln Val Leu Phe Gln Gly Phe Asn Trp GluSer Trp

1 5 10 15

Lys Gln Ser Gly Gly Trp Tyr Asn Met Met Met Gly Lys Val Asp Asp

20 25 30

Ile Ala Ala Ala Gly Val Thr His Val Trp Leu Pro Pro Pro Ser His

35 40 45

Ser Val Ser Asn Glu Gly Tyr Met Pro Gly Arg Leu Tyr Asp Ile Asp

50 55 60

Ala Ser Lys Tyr Gly Asn Ala Ala Glu Leu Lys Ser Leu Ile Gly Ala

65 70 75 80

Leu His Gly Lys Gly Val Gln Ala Ile Ala Asp Ile Val Ile Asn His

85 90 95

Arg Cys Ala Asp Tyr Lys Asp Ser Arg Gly Ile Tyr Cys Ile Phe Glu

100 105 110

Gly Gly Thr Ser Asp Gly Arg Leu Asp Trp Gly Pro His Met Ile Cys

115 120 125

Arg Asp Asp Thr Lys Tyr Ser Asp Gly Thr Ala Asn Leu Asp Thr Gly

130 135 140

Ala Asp Phe Ala Ala Ala Pro Asp Ile Asp His Leu Asn Asp Arg Val

145 150 155 160

Gln Arg Glu Leu Lys Glu Trp Leu Leu Trp Leu Lys Ser Asp Leu Gly

165 170 175

Phe Asp Ala Trp Arg Leu Asp Phe Ala Arg Gly Tyr Ser Pro Glu Met

180 185 190

Ala Lys Val Tyr Ile Asp Gly Thr Ser Pro Ser Leu Ala Val Ala Glu

195 200 205

Val Trp Asp Asn Met Ala Thr Gly Gly Asp Gly Lys Pro Asn Tyr Asp

210 215 220

Gln Asp Ala His Arg Gln Asn Leu Val Asn Trp Val Asp Lys Val Gly

225 230 235 240

Gly Ala Ala Ser Ala Gly Met Val Phe Asp Phe Thr Thr Lys Gly Ile

245 250 255

Leu Asn Ala Ala Val Glu Gly Glu Leu Trp Arg Leu Ile Asp Pro Gln

260 265 270

Gly Lys Ala Pro Gly Val Met Gly Trp Trp Pro Ala Lys Ala Ala Thr

275 280 285

Phe Val Asp Asn His Asp Thr Gly Ser Thr Gln Ala Met Trp Pro Phe

290 295 300

Pro Ser Asp Lys Val Met Gln Gly Tyr Ala Tyr Ile Leu Thr His Pro

305 310 315 320

Gly Ile Pro Cys Ile Phe Tyr Asp His Phe Phe Asn Trp Gly Phe Lys

325 330 335

Asp Gln Ile Ala Ala Leu Val Ala Ile Arg Lys Arg Asn Gly Ile Thr

340 345 350

Ala Thr Ser Ala Leu Lys Ile Leu Met His Glu Gly Asp Ala Tyr Val

355 360 365

Ala Glu Ile Asp Gly Lys Val Val Val Lys Ile Gly Ser Arg Tyr Asp

370 375 380

Val Gly Ala Val Ile Pro Ala Gly Phe Val Thr Ser Ala His Gly Asn

385 390 395 400

Asp Tyr Ala Val Trp Glu Lys Asn Gly Ala Ala Ala Thr Leu Gln Arg

405 410 415

Ser Ser Ser Leu His Ser Ser Val Ile Arg Ser

420 425

<210>7

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ctgttgtgga ggagatcgcg tccggccacc aagtcctct 39

<210>8

<211>42

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aggagagttg ttgagctcga tcgaatgacg gatcagtgca ga 42

<210>9

<211>15405

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cgatcgaatg acggatcagt gcagacttca gctccgttgt agtgttgccg cggcaccgtt 60

cttctcccag acggcgtagt cgttgccgtg tgccgaggtc acgaacccgg ccgggatcac 120

cgccccgacg tcgtacctgg acccgatctt caccaccacc ttgccgtcta tctcggcgac 180

gtaggcatct ccttcgtgca tgaggatctt cagagcgctc gtcgccgtga tgccgttgcg 240

cttcctgatc gccaccagcg ccgcgatctg gtccttaaac ccccagttga agaaatggtc 300

gtagaagatg catgggatgc cggggtgggt gaggatgtac gcgtagccct gcatgacctt 360

gtcggagggg aatggccaca tggcctgcgt ggagcctgta tcgtggttgt cgacgaaggt 420

ggcggccttg gccggccacc atcccatcac gccgggggcc ttcccctgcg ggtcgatcag 480

cctccacagc tcgccctcca cggcagcgtt cagtatccct ttggtcgtga agtcgaacac 540

catgcctgcc gaggccgcgc cgcccacctt gtccacccag ttcaccagat tctgccggtg 600

cgcgtcctgg tcgtagttgg gcttgccgtc gccgccggtg gccatattgt cccacacctc 660

ggccacggcg aggctcgggg atgtgccgtc gatgtacacc ttggccatct ccggcgagta 720

gcccctagcg aagtcaaggc gccacgcgtc gaagccgagg tcgctcttga gccagaggag 780

ccactccttg agctcgcgct ggacccggtc gttgaggtgg tcgatgtcgg gcgcggcggc 840

gaagtcggct ccggtgtcga ggtttgcggt gccatcggag tatttggtgt cgtcgcgaca 900

gatcatgtgg gggccccagt cgaggcggcc gtcggaggtg ccgccctcga agatgcagta 960

gatgccgcgg ctatccttgt agtcggcgca gcggtggttg atgacgatgt cggcgatggc 1020

ctgcacgccc ttgccgtgga gcgcgccgat gagcgacttg agctccgccg cgttgccgta 1080

cttggacgcg tcgatgtcgt acagccgacc aggcatgtaa ccttcgttgg agacggagtg 1140

cgacggcggt ggcagccaga cgtgggtgac tccggcagcg gcgatgtcgt cgaccttgcc 1200

catcatcatg ttgtaccacc cgccgctctg cttccacgac tcccagttga acccctgaaa 1260

gaggacttgg tggccggacg cgatctcctc cacaacagtc accatggttt tgttttttcg 1320

cgcagtcgca ggaactgaga aattggtctt gacctttcca ggccacgacc ggcgcggcga 1380

agaaaccacg ctcaggcgaa cattgccacc cccgcccgcg attcccgggc tcggtcgatc 1440

agcgagagag ggaaggagcg gagcgggcgc ggaggaggaa gaggaggtga gacacagcat 1500

cttgtcgtga tcgatgcttt attcgtgtct cttgttgcct gggcactagg acctataaat 1560

accattgttc tgctgataaa attagtgcgc tatatgtatg gcttggacac catgcctttg 1620

catcgctatt tttagggcag acttcttgtc ctcaaactct tcatgcatta tttggaccct 1680

tcagaagtaa ccactaacca ccgtggaaag cataaattaa ataacaaaag aaagaatgaa 1740

caatgccaac atttaaacta tactctacta tcttatatat atcttggtat tactaattga 1800

aggttctaat agagcctctg gattaatttt cactctatta ttaattcagg acccaattga 1860

gcctttatgt taattctcat cagacatgat aaaaaattaa aaaatatcat aaattcttag 1920

attaattaga aatatctggc cattaaacaa gagactctaa attatacata actattagat 1980

cctgaaggac caaaaaagtg atcaaatggg gtgaataggt ctatgttgag caacctctcg 2040

gctttgaaga tagtgagtac cctaaccatg tttataaact ctcaaaggcg ctttatgggc 2100

tcaagcaagc cccaacagca tggtatgaat gcctaagaga ttttcttatc actaatggct 2160

tcagagtcag taaagccgat cctactctct ttactaaaac catttcaaaa gttttgtttg 2220

tatgccaaat ttatgttgat gatattatat ttgggtctac taacaaatct acttgtgaag 2280

agtttagtag gatcatgatt ccgaaattcg agatgtctat gatggggaag ttgaaatatt 2340

ttctaggatt tcaagtcaag caactccaag atggcacctt catcagccaa acaaagtaca 2400

ttcaagacat actcaacaag tttggaatga aggatgccaa gcccatcagg acacccatgg 2460

gaactaatgg gcatctcgac ctcgacacgg gaggtaaatc cgtagaccaa aaggtatacc 2520

ggtcgatgat aggatcttta ctctatttat gtgcatctcg accagatagt atgctttcta 2580

tatgcatgtg tgcaagattc caagccgatc ctaaggaagt tcaccttagg gccgtgaaaa 2640

gaatcatgag atatttagtt tacactccta aatttggtct ttggtacccc aagggatcca 2700

cctttgattt aataggatat tcagatgccg attgggcagg gtgtaaaatt gataggaaga 2760

gcacatcagg gacttgtcag tttctaggga gatccctggt gtcttggact tcaaagaaac 2820

aaaactcaat agctctttct accgccgaag ccaagtatat tgccgcagga cattgttgtg 2880

tgcaattact ttggatgagg caaaacctta gggactatgg ctacaaattg agcaaagtcc 2940

ctctcctatg tgacaatgag agtgctatct gcatggcgga taatcccgtt gaacacagcc 3000

gcactaagca catagacatt cggtatcact ttttgaggga tcaccaacaa aggggtgata 3060

tcgagattgc ttatgttagc accaaagaac aattagtcga tatctttacc aaaccattag 3120

atgataaaac ctttagcaaa cttaggaatg agctaaatat tcttgattct cgaaactttg 3180

attgaaacat tacacacata gctcatttgt atacctttga tcatatctct ttcgtggcta 3240

cgactaatgt gttttcaagt gtatttctat gctaagtcgt agattgaaag ggaaatggag 3300

tcttcggcga agacaaggct tccactccac tctaacggta tcgtttatcc ttcgccgtca 3360

ctccgcatca ctgtccaaat ttggtataat ctttcactca tatttcattt accaatgggg 3420

agaaagtata aatggctcac aaagtctccg tttttggcga ttaatgccaa agggggagaa 3480

atattaagcc caaagcaaaa ggaccgcacc accacttttt gaaatttttt aaattggtat 3540

gtttaatttc aaattggtat gttgattttc aattggtata ttttcaaaat tagcatctaa 3600

atatatttcc aattgatatc tatttaaaac cctcttgaaa gctaagagga gaattttatt 3660

cagggggagt tttgtttagt caaaggaaaa gcatttgaaa cagggggaga aatttcaaat 3720

cttgaaaatg cttcttacaa tcttattcat atacctttga ctatttgcaa aagactttga 3780

aaaagaattt ccaaaaagat ttgcaaaaaa caaaacaagt ggtgcaaatg tggtccaaaa 3840

tgttaaaata aaagaaagca accatgcata tcaagtaaaa gtataaattg atttaattct 3900

aagtaaccta tgcacttacc ttatgcaaac tagttcaatt ctgcacttat atattttctt 3960

tggtttgtgt tggcatcaat caccaaaaag ggggagattg aaagggaaat aaggtttaac 4020

cttttcctat aaataatttt ggtggttgaa tgcccaacac aaatgattgg actaactagt 4080

ttgttctaga ttatatattc cacaggtgca taaaggttca acacaaacca ataaacgatc 4140

aaagttaggg ttcaaaagca aaggagcaaa ggaaccgaag ggtgccctga tctggcacac 4200

cggactgtct ggtatgccac cagacagtgt ccggtgcacc tgcaggtcgc gagtcgacct 4260

gcagccaagc ttagcgctgt agctaccagc tactagttca caccttatgt aaagtatttg 4320

ttgcaagaaa agtctaagat gacagcaacc tgctgagaag aacaactgac gatgtcataa 4380

ggagagggag cttttcgata ggtgccgtgc agttcaaaga gttagttagc agtaggatga 4440

agatttttgc acatggcaat gagaagttaa ttatggtgta ggcaacccaa atgaaacacc 4500

aaaatatgca caagacagtt tgttgtattc tgtagtacag aataaactaa agtaatgaaa 4560

gaagatggtg ttagaaaatg aaacaatatt atgagtaatg tgtgagcatt atgggaccac 4620

gaaataaaaa aagaacattt ttatgagcag tgtgttctca atgagccttg aatgttatca 4680

cccaggataa gaaaccctta agcaatgaaa catgcaagcg tttaatgtgc aaagttggca 4740

ttctccacga cataatgcaa aagaagatat aatctatgac atagcaagtc atgcatcatt 4800

tcatgcctct gtcaacctat tcatttctag tcatctaggt aagtatctta agctaaagtg 4860

ttagaacttc ccatacataa gtcataactg atgacaattg ggtgtaacac atgacaaacc 4920

agagagtcaa gcaagataaa gcaaaaggat gtgtacataa aactacagag ctatatgtca 4980

tgttgcgaaa agaggagagc ttataagaca agccatgact caaaaaaaat tcacatgcct 5040

actgtggccc atatatcatg caacaatcca aaaactcaca ggtctcggtg ttgatcgtgt 5100

caacatgtga ccaccctaaa aactcttcac taaatattaa agtattgcta gaacagagct 5160

tcaagatata agtcatgatc accaacaacc atgttcaaaa agaaatagaa agctatggca 5220

cagcaacaaa aagcaaaagc atgcatggat ataatcttta acatcatcca tgtcatattg 5280

caaaagaaag aaagagagaa caatacaaat gatgtgtcaa ttacacatcc atcattatcc 5340

atccaccttc cgtgtaccac acttcatata tcatgagtca cttcatgtct ggacattaac 5400

aaactctatc ttaacattca aatgcatgag actttatctc actataaatg cacaatgatt 5460

tagcattgtt tctcacaaaa ccattcaagt tcattagtac tacaacaaca tggcatccat 5520

aaatcgcccc atagttttct tcacagtttg cttgttcctc ttgtgcaatg gctctctagc 5580

ctccatggtg agcaagggcg aggagctgtt caccggggtg gtgcccatcc tggtcgagct 5640

ggacggcgac gtaaacggcc acaagttcag cgtgtccggc gagggcgagg gcgatgccac 5700

ctacggcaag ctgaccctga agttcatctg caccaccggc aagctgcccg tgccctggcc 5760

caccctcgtg accaccctga cctacggcgt gcagtgcttc agccgctacc ccgaccacat 5820

gaagcagcac gacttcttca agtccgccat gcccgaaggc tacgtccagg agcgcaccat 5880

cttcttcaag gacgacggca actacaagac ccgcgccgag gtgaagttcg agggcgacac 5940

cctggtgaac cgcatcgagc tgaagggcat cgacttcaag gaggacggca acatcctggg 6000

gcacaagctg gagtacaact acaacagcca caacgtctat atcatggccg acaagcagaa 6060

gaacggcatc aaggtgaact tcaagatccg ccacaacatc gaggacggca gcgtgcagct 6120

cgccgaccac taccagcaga acacccccat cggcgacggc cccgtgctgc tgcccgacaa 6180

ccactacctg agcacccagt ccgccctgag caaagacccc aacgagaagc gcgatcacat 6240

ggtcctgctg gagttcgtga ccgccgccgg gatcactctc ggcatggacg agctgtacaa 6300

gtaaagcggc cgtgtgaatt acaggtgacc agctcgaatt tccccgatcg ttcaaacatt 6360

tggcaataaa gtttcttaag attgaatcct gttgccggtc ttgcgatgat tatcatataa 6420

tttctgttga attacgttaa gcatgtaata attaacatgt aatgcatgac gttatttatg 6480

agatgggttt ttatgattag agtcccgcaa ttatacattt aatacgcgat agaaaacaaa 6540

atatagcgcg caaactagga taaattatcg cgcgcggtgt catctatgtt actagatcgg 6600

gaattaaact atcagtgttt gacaggatat attggcgggt aaacctaaga gaaaagagcg 6660

tttattagaa taacggatat ttaaaagggc gtgaaaaggt ttatccgttc gtccatttgt 6720

atgtgcatgc caaccacagg gttcccctcg ggatcaaagt actttgatcc aacccctccg 6780

ctgctatagt gcagtcggct tctgacgttc agtgcagccg tcttctgaaa acgacatgtc 6840

gcacaagtcc taagttacgc gacaggctgc cgccctgccc ttttcctggc gttttcttgt 6900

cgcgtgtttt agtcgcataa agtagaatac ttgcgactag aaccggagac attacgccat 6960

gaacaagagc gccgccgctg gcctgctggg ctatgcccgc gtcagcaccg acgaccagga 7020

cttgaccaac caacgggccg aactgcacgc ggccggctgc accaagctgt tttccgagaa 7080

gatcaccggc accaggcgcg accgcccgga gctggccagg atgcttgacc acctacgccc 7140

tggcgacgtt gtgacagtga ccaggctaga ccgcctggcc cgcagcaccc gcgacctact 7200

ggacattgcc gagcgcatcc aggaggccgg cgcgggcctg cgtagcctgg cagagccgtg 7260

ggccgacacc accacgccgg ccggccgcat ggtgttgacc gtgttcgccg gcattgccga 7320

gttcgagcgt tccctaatca tcgaccgcac ccggagcggg cgcgaggccg ccaaggcccg 7380

aggcgtgaag tttggccccc gccctaccct caccccggca cagatcgcgc acgcccgcga 7440

gctgatcgac caggaaggcc gcaccgtgaa agaggcggct gcactgcttg gcgtgcatcg 7500

ctcgaccctg taccgcgcac ttgagcgcag cgaggaagtg acgcccaccg aggccaggcg 7560

gcgcggtgcc ttccgtgagg acgcattgac cgaggccgac gccctggcgg ccgccgagaa 7620

tgaacgccaa gaggaacaag catgaaaccg caccaggacg gccaggacga accgtttttc 7680

attaccgaag agatcgaggc ggagatgatc gcggccgggt acgtgttcga gccgcccgcg 7740

cacgtctcaa ccgtgcggct gcatgaaatc ctggccggtt tgtctgatgc caagctggcg 7800

gcctggccgg ccagcttggc cgctgaagaa accgagcgcc gccgtctaaa aaggtgatgt 7860

gtatttgagt aaaacagctt gcgtcatgcg gtcgctgcgt atatgatgcg atgagtaaat 7920

aaacaaatac gcaaggggaa cgcatgaagg ttatcgctgt acttaaccag aaaggcgggt 7980

caggcaagac gaccatcgca acccatctag cccgcgccct gcaactcgcc ggggccgatg 8040

ttctgttagt cgattccgat ccccagggca gtgcccgcga ttgggcggcc gtgcgggaag 8100

atcaaccgct aaccgttgtc ggcatcgacc gcccgacgat tgaccgcgac gtgaaggcca 8160

tcggccggcg cgacttcgta gtgatcgacg gagcgcccca ggcggcggac ttggctgtgt 8220

ccgcgatcaa ggcagccgac ttcgtgctga ttccggtgca gccaagccct tacgacatat 8280

gggccaccgc cgacctggtg gagctggtta agcagcgcat tgaggtcacg gatggaaggc 8340

tacaagcggc ctttgtcgtg tcgcgggcga tcaaaggcac gcgcatcggc ggtgaggttg 8400

ccgaggcgct ggccgggtac gagctgccca ttcttgagtc ccgtatcacg cagcgcgtga 8460

gctacccagg cactgccgcc gccggcacaa ccgttcttga atcagaaccc gagggcgacg 8520

ctgcccgcga ggtccaggcg ctggccgctg aaattaaatc aaaactcatt tgagttaatg 8580

aggtaaagag aaaatgagca aaagcacaaa cacgctaagt gccggccgtc cgagcgcacg 8640

cagcagcaag gctgcaacgt tggccagcct ggcagacacg ccagccatga agcgggtcaa 8700

ctttcagttg ccggcggagg atcacaccaa gctgaagatg tacgcggtac gccaaggcaa 8760

gaccattacc gagctgctat ctgaatacat cgcgcagcta ccagagtaaa tgagcaaatg 8820

aataaatgag tagatgaatt ttagcggcta aaggaggcgg catggaaaat caagaacaac 8880

caggcaccga cgccgtggaa tgccccatgt gtggaggaac gggcggttgg ccaggcgtaa 8940

gcggctgggt tgtctgccgg ccctgcaatg gcactggaac ccccaagccc gaggaatcgg 9000

cgtgacggtc gcaaaccatc cggcccggta caaatcggcg cggcgctggg tgatgacctg 9060

gtggagaagt tgaaggccgc gcaggccgcc cagcggcaac gcatcgaggc agaagcacgc 9120

cccggtgaat cgtggcaagc ggccgctgat cgaatccgca aagaatcccg gcaaccgccg 9180

gcagccggtg cgccgtcgat taggaagccg cccaagggcg acgagcaacc agattttttc 9240

gttccgatgc tctatgacgt gggcacccgc gatagtcgca gcatcatgga cgtggccgtt 9300

ttccgtctgt cgaagcgtga ccgacgagct ggcgaggtga tccgctacga gcttccagac 9360

gggcacgtag aggtttccgc agggccggcc ggcatggcca gtgtgtggga ttacgacctg 9420

gtactgatgg cggtttccca tctaaccgaa tccatgaacc gataccggga agggaaggga 9480

gacaagcccg gccgcgtgtt ccgtccacac gttgcggacg tactcaagtt ctgccggcga 9540

gccgatggcg gaaagcagaa agacgacctg gtagaaacct gcattcggtt aaacaccacg 9600

cacgttgcca tgcagcgtac gaagaaggcc aagaacggcc gcctggtgac ggtatccgag 9660

ggtgaagcct tgattagccg ctacaagatc gtaaagagcg aaaccgggcg gccggagtac 9720

atcgagatcg agctagctga ttggatgtac cgcgagatca cagaaggcaa gaacccggac 9780

gtgctgacgg ttcaccccga ttactttttg atcgatcccg gcatcggccg ttttctctac 9840

cgcctggcac gccgcgccgc aggcaaggca gaagccagat ggttgttcaa gacgatctac 9900

gaacgcagtg gcagcgccgg agagttcaag aagttctgtt tcaccgtgcg caagctgatc 9960

gggtcaaatg acctgccgga gtacgatttg aaggaggagg cggggcaggc tggcccgatc 10020

ctagtcatgc gctaccgcaa cctgatcgag ggcgaagcat ccgccggttc ctaatgtacg 10080

gagcagatgc tagggcaaat tgccctagca ggggaaaaag gtcgaaaagg tctctttcct 10140

gtggatagca cgtacattgg gaacccaaag ccgtacattg ggaaccggaa cccgtacatt 10200

gggaacccaa agccgtacat tgggaaccgg tcacacatgt aagtgactga tataaaagag 10260

aaaaaaggcg atttttccgc ctaaaactct ttaaaactta ttaaaactct taaaacccgc 10320

ctggcctgtg cataactgtc tggccagcgc acagccgaag agctgcaaaa agcgcctacc 10380

cttcggtcgc tgcgctccct acgccccgcc gcttcgcgtc ggcctatcgc ggccgctggc 10440

cgctcaaaaa tggctggcct acggccaggc aatctaccag ggcgcggaca agccgcgccg 10500

tcgccactcg accgccggcg cccacatcaa ggcaccctgc ctcgcgcgtt tcggtgatga 10560

cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga 10620

tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggcgc 10680

agccatgacc cagtcacgta gcgatagcgg agtgtatact ggcttaacta tgcggcatca 10740

gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg 10800

agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc 10860

gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 10920

tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 10980

aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa 11040

aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt 11100

ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 11160

tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc 11220

agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 11280

gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta 11340

tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct 11400

acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc 11460

tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa 11520

caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa 11580

aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 11640

aactcacgtt aagggatttt ggtcatgcat tctaggtact aaaacaattc atccagtaaa 11700

atataatatt ttattttctc ccaatcaggc ttgatcccca gtaagtcaaa aaatagctcg 11760

acatactgtt cttccccgat atcctccctg atcgaccgga cgcagaaggc aatgtcatac 11820

cacttgtccg ccctgccgct tctcccaaga tcaataaagc cacttacttt gccatctttc 11880

acaaagatgt tgctgtctcc caggtcgccg tgggaaaaga caagttcctc ttcgggcttt 11940

tccgtcttta aaaaatcata cagctcgcgc ggatctttaa atggagtgtc ttcttcccag 12000

ttttcgcaat ccacatcggc cagatcgtta ttcagtaagt aatccaattc ggctaagcgg 12060

ctgtctaagc tattcgtata gggacaatcc gatatgtcga tggagtgaaa gagcctgatg 12120

cactccgcat acagctcgat aatcttttca gggctttgtt catcttcata ctcttccgag 12180

caaaggacgc catcggcctc actcatgagc agattgctcc agccatcatg ccgttcaaag 12240

tgcaggacct ttggaacagg cagctttcct tccagccata gcatcatgtc cttttcccgt 12300

tccacatcat aggtggtccc tttataccgg ctgtccgtca tttttaaata taggttttca 12360

ttttctccca ccagcttata taccttagca ggagacattc cttccgtatc ttttacgcag 12420

cggtattttt cgatcagttt tttcaattcc ggtgatattc tcattttagc catttattat 12480

ttccttcctc ttttctacag tatttaaaga taccccaaga agctaattat aacaagacga 12540

actccaattc actgttcctt gcattctaaa accttaaata ccagaaaaca gctttttcaa 12600

agttgttttc aaagttggcg tataacatag tatcgacgga gccgattttg aaaccgcggt 12660

gatcacaggc agcaacgctc tgtcatcgtt acaatcaaca tgctaccctc cgcgagatca 12720

tccgtgtttc aaacccggca gcttagttgc cgttcttccg aatagcatcg gtaacatgag 12780

caaagtctgc cgccttacaa cggctctccc gctgacgccg tcccggactg atgggctgcc 12840

tgtatcgagt ggtgattttg tgccgagctg ccggtcgggg agctgttggc tggctggtgg 12900

caggatatat tgtggtgtaa acaaattgac gcttagacaa cttaataaca cattgcggac 12960

gtttttaatg tactgaatta acgccgaatt aattcggggg atctggattt tagtactgga 13020

ttttggtttt aggaattaga aattttattg atagaagtat tttacaaata caaatacata 13080

ctaagggttt cttatatgct caacacatga gcgaaaccct ataggaaccc taattccctt 13140

atctgggaac tactcacaca ttattatgga gaaactcgag cttgtcgatc gacagatccg 13200

gtcggcatct actctatttc tttgccctcg gacgagtgct ggggcgtcgg tttccactat 13260

cggcgagtac ttctacacag ccatcggtcc agacggccgc gcttctgcgg gcgatttgtg 13320

tacgcccgac agtcccggct ccggatcgga cgattgcgtc gcatcgaccc tgcgcccaag 13380

ctgcatcatc gaaattgccg tcaaccaagc tctgatagag ttggtcaaga ccaatgcgga 13440

gcatatacgc ccggagtcgt ggcgatcctg caagctccgg atgcctccgc tcgaagtagc 13500

gcgtctgctg ctccatacaa gccaaccacg gcctccagaa gaagatgttg gcgacctcgt 13560

attgggaatc cccgaacatc gcctcgctcc agtcaatgac cgctgttatg cggccattgt 13620

ccgtcaggac attgttggag ccgaaatccg cgtgcacgag gtgccggact tcggggcagt 13680

cctcggccca aagcatcagc tcatcgagag cctgcgcgac ggacgcactg acggtgtcgt 13740

ccatcacagt ttgccagtga tacacatggg gatcagcaat cgcgcatatg aaatcacgcc 13800

atgtagtgta ttgaccgatt ccttgcggtc cgaatgggcc gaacccgctc gtctggctaa 13860

gatcggccgc agcgatcgca tccatagcct ccgcgaccgg ttgtagaaca gcgggcagtt 13920

cggtttcagg caggtcttgc aacgtgacac cctgtgcacg gcgggagatg caataggtca 13980

ggctctcgct aaactcccca atgtcaagca cttccggaat cgggagcgcg gccgatgcaa 14040

agtgccgata aacataacga tctttgtaga aaccatcggc gcagctattt acccgcagga 14100

catatccacg ccctcctaca tcgaagctga aagcacgaga ttcttcgccc tccgagagct 14160

gcatcaggtc ggagacgctg tcgaactttt cgatcagaaa cttctcgaca gacgtcgcgg 14220

tgagttcagg ctttttcata tctcattgcc cccccggatc tgcgaaagct cgagagagat 14280

agatttgtag agagagactg gtgatttcag cgtgtcctct ccaaatgaaa tgaacttcct 14340

tatatagagg aaggtcttgc gaaggatagt gggattgtgc gtcatccctt acgtcagtgg 14400

agatatcaca tcaatccact tgctttgaag acgtggttgg aacgtcttct ttttccacga 14460

tgctcctcgt gggtgggggt ccatctttgg gaccactgtc ggcagaggca tcttgaacga 14520

tagcctttcc tttatcgcaa tgatggcatt tgtaggtgcc accttccttt tctactgtcc 14580

ttttgatgaa gtgacagata gctgggcaat ggaatccgag gaggtttccc gatattaccc 14640

tttgttgaaa agtctcaata gccctttggt cttctgagac tgtatctttg atattcttgg 14700

agtagacgag agtgtcgtgc tccaccatgt tatcacatca atccacttgc tttgaagacg 14760

tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca tctttgggac 14820

cactgtcggc agaggcatct tgaacgatag cctttccttt atcgcaatga tggcatttgt 14880

aggtgccacc ttccttttct actgtccttt tgatgaagtg acagatagct gggcaatgga 14940

atccgaggag gtttcccgat attacccttt gttgaaaagt ctcaatagcc ctttggtctt 15000

ctgagactgt atctttgata ttcttggagt agacgagagt gtcgtgctcc accatgttgg 15060

gcccggcgcg ccgaattccc gatctagtaa catagatgac accgcgcgcg ataatttatc 15120

ctagtttgcg cgctatattt tgttttctat cgcgtattaa atgtataatt gcgggactct 15180

aatcataaaa acccatctca taaataacgt catgcattac atgttaatta ttacatgctt 15240

aacgtaattc aacagaaatt atatgataat catcgcaaga ccggcaacag gattcaatct 15300

taagaaactt tattgccaaa tgtttgaacg atcggggaaa ttcgagctgg gtagcaattc 15360

ccgaggctgt agccgacgat ggtgcgccag gagagttgtt gagct 15405

<210>10

<211>810

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gaccttcctc tatataagga agttcatttc atttggagag gacacgctga aatcaccagt 60

ctctctctac aaatctatct ctctcgagct ttcgcagatc cgggggggca atgagatatg 120

aaaaagcctg aactcaccgc gacgtctgtc gagaagtttc tgatcgaaaa gttcgacagc 180

gtctccgacc tgatgcagct ctcggagggc gaagaatctc gtgctttcag cttcgatgta 240

ggagggcgtg gatatgtcct gcgggtaaat agctgcgccg atggtttcta caaagatcgt 300

tatgtttatc ggcactttgc atcggccgcg ctcccgattc cggaagtgct tgacattggg 360

gagtttagcg agagcctgac ctattgcatc tcccgccgtg cacagggtgt cacgttgcaa 420

gacctgcctg aaaccgaact gcccgctgtt ctacaaccgg tcgcggaggc tatggatgcg 480

atcgctgcggccgatcttag ccagacgagc gggttcggcc cattcggacc gcaaggaatc 540

ggtcaataca ctacatggcg tgatttcata tgcgcgattg ctgatcccca tgtgtatcac 600

tggcaaactg tgatggacga caccgtcagt gcgtccgtcg cgcaggctct cgatgagctg 660

atgctttggg ccgaggactg ccccgaagtc cggcacctcg tgcacgcgga tttcggctcc 720

aacaatgtcc tgacggacaa tggccgcata acagcggtca ttgactggag cgaggcgatg 780

ttcggggatt cccaatacga ggtcgccaac 810

<210>11

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

cttagccaga cgagcgggtt c 21

<210>12

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

gcttctgcgg gcgatttgt 19

<210>13

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ataattgcgg gactctaatc ata 23

<210>14

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

gcatcttcta cgaccatttc ttc 23

<210>15

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

ccttcgttgg agacggagtg 20

<210>16

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

tgctttccac ggtggttagt 20

Claims (10)

1. The application of a barley α -amylase in causing pollen abortion of plants, wherein the amino acid sequence of the barley α -amylase is as follows:

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 6; or

(b) The amino acid sequence of SEQ ID NO.6 is substituted and/or deleted by one or more amino acid residues and/or added with a protein which is derived from the SEQ ID NO.6 and keeps the function of the protein shown in the SEQ ID NO. 6.

2. The use according to claim 1, wherein the barley α -amylase gene has:

1) the nucleotide sequence shown as SEQ ID No.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein.

3. The application of the barley α -amylase or the coding gene thereof in preparing pollen abortion transgenic plants, wherein the amino acid sequence of the barley α -amylase is as follows:

(a) a protein consisting of an amino acid sequence shown in SEQ ID No. 6; or

(b) The amino acid sequence of SEQ ID NO.6 is substituted and/or deleted by one or more amino acid residues and/or added with a protein which is derived from the SEQ ID NO.6 and keeps the function of the protein shown in the SEQ ID NO. 6;

the coding gene of barley α -amylase has:

1) the nucleotide sequence shown as SEQ ID No.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein.

4. The application of the biological material containing the barley α -amylase gene in preparing pollen abortion transgenic plants,

the barley α -amylase gene has:

1) the nucleotide sequence shown as SEQ ID No.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein;

the biological material is a recombinant expression vector, an expression cassette, a recombinant bacterium or a host cell.

5. The use according to claim 4, wherein the biological material comprises a transduction peptide and a male gamete-preferred promoter.

6. The use according to claim 5, wherein the transduction peptide is an SBE signal peptide having the nucleotide sequence shown in SEQ ID No.2, and the male gamete preferred promoter is PG47, PC32, PCHF15 having the nucleotide sequences shown in SEQ ID No.3, 4, 5, respectively.

7. A method for regulating and controlling plant pollen development is characterized in that a barley α -amylase gene is expressed by a plant, and the nucleotide sequence of the gene is as follows:

1) the nucleotide sequence shown as SEQ ID NO.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) and has the same function by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID NO. 1; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein.

8. The method of claim 7, wherein said modulation is degradation of starch in plant pollen or induction of male sterility in the plant.

9. A method for degrading starch in plant pollen by using barley α -amylase to prevent the diffusion of exogenous transgenic components is characterized in that an expression cassette containing barley α -amylase gene is introduced into a plant to obtain a transgenic plant with aborted transgenic pollen, so that the transgenic pollen in the plant cannot be pollinated normally, thereby preventing the diffusion of exogenous genes in the plant pollen,

the nucleotide sequence of the barley α -amylase gene is as follows:

1) the nucleotide sequence shown as SEQ ID No.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein.

10. A method for producing non-transgenic seeds by using a transgenic plant containing a barley α -amylase gene is characterized in that the transgenic plant containing the barley α -amylase gene is used as a maintainer line in a hybrid crop to pollinate a plant male sterile line, the sterile line is harvested to obtain seeds, and the seeds are non-transgenic seeds to realize sterile line breeding or hybrid seed production;

the barley α -amylase gene has:

1) the nucleotide sequence shown as SEQ ID No.1, or

2) A nucleotide sequence which is derived from the nucleotide sequence 1) by substituting, deleting or adding one or more nucleotides in the nucleotide sequence shown in SEQ ID No.1 and has the same function; or

3) A nucleotide sequence which hybridizes with the sequence shown in SEQ ID NO.1 under stringent conditions in a 0.1 XSSPE containing 0.1% SDS or a 0.1 XSSC containing 0.1% SDS solution at 65 ℃ and which expresses the same functional protein, and washing the membrane with the solution; or

4) A nucleotide sequence which has more than 90 percent of homology with the nucleotide sequence of 1), 2) or 3) and expresses the same functional protein.

Images