CN110872577A - Modified immune cells and uses thereof - Google Patents

Abstract

The invention belongs to the field of cell therapy, and particularly relates to a method for enhancing homing and aggregation of immune cells such as T cells, tumor infiltrating T cells, NK cells, NKT cells and macrophages at a solid tumor and infiltration of the solid tumor by genetically modifying the immune cells, so as to enhance the treatment effect of the immune cells on the solid tumor.

Description

Modified immune cells and uses thereof

Technical Field

The present invention is in the field of immune cell therapy. In particular, the invention relates to the enhancement of homing and aggregation within solid tumors by genetically modified immune cells, thereby enhancing the therapeutic effect of immune cells, such as CAR-T cells, on solid tumors.

Background

In recent years, tumor immunotherapy has been rapidly developed, especially Adoptive Cell Therapy (ACT), which refers to a method of isolating immune cells such as T cells and NK cells from a patient, amplifying the cells by in vitro modification, and then infusing the cells back into the patient for tumor treatment. In 2013, immunotherapy of tumors was evaluated as the first major breakthrough by Science impurities.

CAR-T and TCR-T are important components of adoptive cell therapy, in particular CAR-T therapy, with significant success in the treatment of hematological tumors, achieving a high remission rate, a typical CAR structure consisting of three parts, scFv, hinge and transmembrane domains, intracellular costimulatory signals and activation domains that recognize tumor antigens extracellularly. The first generation of CARs did not contain intracellular costimulatory signals, and CAR-T cells had lower killing activity and shorter survival time. Thus, second generation CARs began to add costimulatory signals such as CD28 and 4-1BB, and the CAR-T cells with different costimulatory signals also varied in their characteristics, with CD28 enhancing killing activity of CAR-T cells and 4-1BB enhancing killing activity of CAR-T cells while prolonging survival of CAR-T cells. Subsequently, a third generation CAR co-expressing two co-stimulatory signaling domains appeared, however its anti-tumor effect was not as good as the second generation CAR-T. Therefore, the clinical application is now mainly second generation CAR-T cells.

CAR-T therapy not only worked significantly on the treatment of hematological tumors, but also commercialized successfully, and the FDA officially approved two CAR-T drugs for marketing in 2017 in the united states. Although CAR-T cell therapy is very different in the treatment of hematological tumors, it has no good therapeutic effect on solid tumors, has low remission rate and is prone to off-target and other toxic and side effects. The inability of CAR-T cells to efficiently aggregate at solid tumors is one of the important factors affecting their efficacy, although local infusion of CAR-T cells has been investigated to increase their number and thus their anti-tumor activity at tumor cells, but such infusion is used to a lesser extent. Thus, there remains a need for new ways to induce homing aggregation of CAR-T cells within solid tumors. Researchers have made a lot of studies on the treatment of CAR-T cell solid tumors, CAR-T cells have been improved in various ways, for example, patent CN110157682A, artificially targeted modified CAR-T cells and their preparation methods and applications, metabolic modified CAR-T cells and their preparation methods and applications, bioactive molecules such as saccharides and amino acids coupled with azide are labeled on the surface of CAR-T cells, so that the bioactive molecules can effectively target and guide CAR-T cells to tumor sites in vivo; in vivo, the targeting and the approaching enable the specific CAR molecules on the CAR-T cells to be combined with tumor antigens at tumor sites, so that the CAR-T cells are stimulated to be specifically activated, and more efficient tumor killing capacity is achieved. Patent CN110144325A, a targeted T lymphocyte and a preparation method and application thereof, and provides a targeted T lymphocyte, which comprises a chimeric antigen receptor CARDR5 of targeted DR5 and/or a chimeric antigen receptor CAR c Met of targeted c Met, wherein the CAR DR5 can specifically target DR5, and the CAR c Met can specifically target c Met, thereby promoting the expansion of the T cell in a patient body, efficiently and specifically killing tumor cells, effectively inhibiting the escape of the tumor cells, and better maintaining the vitality and lethality of the cells.

The chemokine system plays a crucial role in the migration of immune cells. For example, the involvement of the chemokine system is required for the homing of T cells into lymph nodes, the retention of hematopoietic stem cells in the bone marrow, and the like. Chemokines are involved not only in the migration of immune cells, but also in the proliferation and metastasis of tumor cells. Tumor cells often secrete large amounts of chemokines that promote their proliferation and metastasis. Relatively few studies on the improvement of T cell targeting by chemokines have been published, and the references disclosed so far are "Enhanced tumor trafficking of GD2 clinical antigen receptor T cells bye expression of the chemokine CCR2b, J immunity, 2010", "T lymphocyte cellular expression CCR4 and a clinical antigen receptor targeting CD30 haveimoproved host and antigen or activity in a Hodgkin tumor model, Blood, CXCR 865, 1-or CXCR 2-induced CAR-T cells co-opt IL-8 for expression of restricted expression of genes in tumors of origin tumors, com 20120, 2009, 639", CAR 4 or CAR 4832 co-expression or CCL2 expression or CCL2 expression of CCL receptor CCR 23, and whether the above mentioned chemokine receptor CCR 23, CCR 3, CCL expression or CCL expression systems are deficient for clinical chemokine receptor, cx20, ct 2019, CCL 639 ", or CCL 4832 or CCL 25 expression of CCL receptor in clinical chemokine receptor binding, or whether the above mentioned chemokine receptor CCR 3, CCR 11, CCL 3, CCR 11, CCR 3, CCR 639, CCL 3, CCL expression or CCL 3, and CCL 3, or CCL. Furthermore, due to the diversity of cytokines and the complexity of cell signaling pathways, the roles of different chemokines in different tumors may not be the same, and theoretical analysis is often far from practical research results.

Disclosure of Invention

The invention provides a genetically modified immune cell, and aims to provide a method for enhancing the aggregation of the modified immune cell at a solid tumor, so as to overcome the defect that the modified immune cell such as CAR-T cell has low killing activity at the solid tumor.

The invention is realized by the following technical scheme:

in a first aspect, the invention provides a modified immune cell comprising a chimeric antigen receptor CAR and a chemokine receptor CCR 6;

further, the immune cell expresses a chimeric antigen receptor CAR and overexpresses chemokine receptor CCR 6;

wherein the immune cells are T cells, NK cells, NKT cells and macrophages; preferably T cells;

optionally, the chemokine receptor CCR6 is overexpressed;

optionally, transferring the target gene into an immune cell for expression to obtain a chimeric antigen receptor CAR and a chemokine receptor CCR 6;

alternatively, means for transferring the gene of interest into immune cells include lentiviruses, retroviruses, adenoviruses, common plasmid vectors, episomal vectors, nano-delivery systems, electrical transduction, transposons and other delivery systems capable of effecting the entry of the gene of interest into immune cells; preferably, the virus is a lentivirus, such as a lentivirus conventional in the art, e.g., FUW, CSII-EF-MCS, or pCDH.

Preferably, the chemokine system is CCL20-CCR 6.

In the present invention, cytokine secretion by CAR-T cells overexpressing the chemokine receptor CCR6 is not affected.

In the present invention, the specific killing ability of CAR-T cells overexpressing the chemokine receptor CCR6 on tumor cells is not affected.

In the present invention, CAR-T cells overexpressing the chemokine receptor CCR6 migrated significantly into tumors secreting CCL 20.

In the present invention, the CAR comprises a leader sequence, a scFv that recognizes an antigen, a hinge region and a transmembrane domain, an intracellular costimulatory signal, an intracellular activation signal.

Optionally, the leader sequence is derived from GM-CSF, CD3, CD4, CD 8.

Optionally, the hinge and transmembrane regions are derived from CD28, CD3, CD4, CD8, IgG.

Preferably, the intracellular costimulatory signals are derived from CD28, CD134, CD137(4-1BB), ICOS, NKG 2D.

In a second aspect, the invention provides the use of the immune cell in a medicament for treating a related disease;

further, the drug is a cell therapy related drug;

the related disease is a tumor, preferably a solid tumor;

optionally, the solid tumor overexpresses CCL 20;

preferably, squamous carcinoma of the cervix and adenocarcinoma, colon cancer, esophageal cancer, glioblastoma multiforme, squamous cell carcinoma of the head and neck, clear cell carcinoma of the kidney, hepatocellular carcinoma, adenocarcinoma of the lung, squamous carcinoma of the lung, ovarian cancer, pancreatic cancer, rectal cancer, gastric cancer and endometrial cancer;

more preferably, lung adenocarcinoma and lung squamous carcinoma;

in a third aspect, the invention provides an expression system consisting of a vector expressing a CAR and a vector expressing CCR 6; preferably, the vector is a lentiviral vector.

In a fourth aspect, the present invention also provides a method for obtaining the immune cell, comprising:

respectively inserting the CAR encoding gene and the CCR6 encoding gene into a lentivirus expression plasmid adopting an EF-1 α promoter to obtain a CAR recombinant plasmid and a CCR6 recombinant plasmid;

packaging the recombinant plasmids respectively to obtain a first lentiviral vector and a second lentiviral vector,

the two lentivirus vectors are separated by sequentially or co-transfecting immune cells.

The coding gene of CAR and the coding gene of CCR6 are connected in series through a 2A sequence or an IRES sequence, and the series sequence is inserted into a lentivirus expression plasmid to obtain CAR-2A-CCR6 and CCR6-2A-CAR or CAR-IRES-CCR6 and CCR 6-IRES-CAR.

Packaging the tandem plasmids respectively to obtain a lentivirus vector,

and (3) staining the lentivirus vector on immune cells, and separating.

In a fifth aspect, the invention also provides the construction and expression of chimeric antigen receptors.

In some embodiments, the genes encoding CAR, CCR6, CAR-2A-CCR6, CCR6-2A-CAR, CAR-IRES-CCR, and CCR6-IRES-CAR are artificially synthesized, and an XbaI cleavage site is added at the front end of the sequence and an FseI cleavage site at the end of the sequence.

In some embodiments, the lentiviral expression plasmid and synthetic gene of interest are digested with XbaI and FseI.

In some embodiments, the lentiviral expression plasmid and synthetic gene of interest are cleaved with T4 ligase.

In some embodiments, the T cell culture system is supplemented with 100 UI/mL IL-2 or 10 ng/mL IL7/IL15 combinations or other factors that facilitate T cell culture.

In some embodiments, the CAR comprises a leader sequence, an scFv that recognizes an antigen, a hinge and transmembrane domain, an intracellular costimulatory signal, an intracellular activation signal.

Optionally, the step of (a) is carried out,

the nucleotide sequence of the leader sequence of the CAR is from the sequence SEQ ID NO: 1.

the scFv nucleotide sequence of the CAR targeting the tumor associated antigen EGFR is derived from the sequence SEQ ID NO. 2.

The nucleotide sequence of the hinge and transmembrane domain of the CAR is from the sequence SEQ ID No. 3.

The nucleotide sequence of the intracellular costimulatory signal CD28 of the CAR is from the sequence SEQ ID No. 4.

The nucleotide sequence of the intracellular activation signal CD3 ζ of the CAR is from the sequence SEQ ID NO. 5.

The amino acid sequence of the leader sequence of the CAR is from the sequence SEQ ID NO: 6.

the EGFR-targeting scFv amino acid sequence of the CAR is from the sequence SEQ ID NO. 7.

The amino acid sequence of the hinge and transmembrane domains of the CAR is from the sequence SEQ ID No. 8.

The amino acid sequence of the intracellular co-stimulatory signal CD28 of the CAR is from the sequence SEQ ID No. 9.

The amino acid sequence of the intracellular activation signal CD3 ζ of the CAR is from the sequence SEQ ID NO 10.

Alternatively, the intracellular costimulatory signal is derived from CD28, CD134, CD137, ICOS.

Preferably, the nucleotide sequence of the chemokine receptor CCR6 is derived from the sequence SEQ ID NO. 11; the amino acid sequence is from the sequence SEQ ID NO 12.

In other embodiments, the tumor associated antigen may also be selected from the group consisting of AFP, BMCA, CEA, CA-125, CA-9, CA-4, CD116, CD117, CD171, CD123, CD, CLL, CD133, CD138, Her, GD, gp, GPC, GnTV, EGFRvIII, EpCAM, PSA, PSMA, PAP, NY-ESO-1, LAGA-1a, cMET, P, Prostein, PCTA-1, MAGE, ROR, FAP, NKG2, EMA, ETA, GFAP, MSA, MART-1, NSE, TAG-72, IL13, NKR-2, ROR, VEGFR, CLD, EphA, alpha-folatorR, CAIX, EBP, PD-MG, MUC, mesothelin, mucin, epithelial proteins, VEGF, EphA, and EphA, or EphE, or EphA, or EphE, or EGG 2, or EGG (human protein binding protein domains.

Compared with the prior art, the invention has the advantages that the following aspects are mainly included but not limited:

the system of the invention compares the relation between the chemokine CCL20 and solid tumors, and adopts clinical lung cancer cases and human lung cancer cell lines for verification.

The modified CAR-T cell remarkably promotes the aggregation of the CAR-T cell in a solid tumor, solves the disadvantage that the CAR-T cell cannot effectively contact the solid tumor, promotes the infiltration of the CAR-T cell to the solid tumor, further enhances the anti-tumor activity of the CAR-T cell, enables the CAR-T cell treatment technology to be applied to the treatment of the solid tumor, and overcomes the technical defect that the CAR-T in the prior art has poor treatment effect on the solid tumor.

The CCR6+ CAR-T cell modified by the invention can be suitable for various solid tumors, has wider applicability, and a double-plasmid system can combine CCR6 and CAR targeting different antigens more conveniently, thereby better expanding the application range of CCR6+ CAR-T.

The solid tumors suitable for the modified CCR6+ CAR-T cell comprise a plurality of tumors with higher malignant degree and harmfulness, including main organ tumors such as lung cancer, liver cancer, colon cancer, rectal cancer, stomach cancer, kidney cancer, pancreatic cancer, breast cancer, prostate cancer and the like.

The CCR6+ CAR-T cell modified by the invention can not only eliminate the primary focus of tumor, but also better trace and kill the tumor metastasis with high CCL20 expression by utilizing a chemokine system.

The cytokine secretion capacity of the CCR6+ CAR-T cell modified by the invention and the specific killing capacity on tumor cells are not influenced; but enhances the ability to home and aggregate to solid tumors secreting CCL20, prolonging patient survival.

Drawings

Figure 1 bioinformatics analysis of the mRNA expression level of CCL20 in tumor tissues and paracancerous normal tissues in the TCGA database, CCL20 was highly expressed in tumor tissues of various solid tumors.

FIG. 2 ELISA test the secretion level of CCL20 in tumor tissues and paracarcinoma normal tissues of lung cancer patients, and CCL20 shows high expression state in most of tumor tissues of lung cancer patients.

FIG. 3 ELISA detects the secretion level of human lung cancer cell line CCL20, normal human lung epithelial cell BEAS-2B hardly secretes CCL20, and cell lines A549/CCL20 over-expressing H23, A549 and CCL20 secretes high level of CCL 20.

FIG. 4 CCL20 shows that the chemokine receptor CCR6 has low expression levels in T cells (resting state and activated state) of lung cancer patients, especially in killer CD 8T cells.

FIG. 5 CCR6 and EGFRCRAR lentivirus particles infected T cells and analyzed for their infection efficiency by flow cytometry, with a CCR6+ EGFRCRAR co-infected T cell fraction of 23%.

FIG. 6 overexpression of CCR6 did not affect secretion of cytokines such as CAR-T cells IL-2 and IFN- γ.

Figure 7 overexpression of CCR6 did not affect the specific killing effect of CAR-T cells on target tumor cells co-cultured in vitro.

Figure 8 Jurkat T cells overexpressing CCR6 significantly migrated to tumor cell culture media containing CCL 20.

Figure 9 Jurkat T cells overexpressing CCR6+ CAR significantly aggregated at tumor cells (yellow circles).

Figure 10 at the same infusion dose, CCR6+ CAR T cells possessed better anti-tumor effects compared to traditional CAR-T cells, with significantly smaller tumor sizes in tumor-bearing mice.

Figure 11 CCR6+ CAR T infusion treated mouse tumors, more tumor infiltrating T cells were detected, indicating that CCR6 promoted CAR-T cells to more aggregate at tumor cells and enter the interior of the tumor.

FIG. 12 CCR6+ CAR T infusion therapy significantly prolonged the survival time of tumor-bearing mice compared to traditional CAR-T infusion therapy.

Detailed Description

Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the products and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations and modifications, or appropriate alterations and combinations, of the products and methods described herein may be made and utilized without departing from the spirit, scope, and spirit of the invention. For a further understanding of the present invention, reference will now be made in detail to the following examples.

Example 1

Bioinformatics screens solid tumors for high expression of chemokines.

The tumor Genome mapping project (The Cancer Genome Altas, TCGA) was initiated by NCI in The united states and is intended to enhance human understanding of The molecular mechanisms of Cancer by high throughput sequencing technologies. TCGA is a worldwide famous cancer database containing 33 cancer types, 11000 multiple clinical specimens. The expression level of the chemokine CCL20 in TCGA in various tumors is screened by a GEPIA website analysis tool, as shown in figure 1, CCL20 shows over-expression level in cervical squamous carcinoma and adenocarcinoma, colon cancer, esophageal cancer, glioblastoma multiforme, head and neck squamous cell carcinoma, renal clear cell carcinoma, hepatocellular carcinoma, lung adenocarcinoma, lung squamous carcinoma, ovarian cancer, pancreatic cancer, rectal cancer, gastric cancer, endometrial cancer and uterine sarcoma.

Collecting tumor tissue and tissue beside lung cancer of a patient, flushing the tumor tissue with precooled PBS, weighing, shearing the tumor tissue into pieces, and treating the pieces according to the weight ratio of the lung cancer tissue: PBS =0.1 g:10 mL, ground well on ice, centrifuged at 5000 g and 4 ℃ for 10min, and the supernatant was dispensed for use, and the secretion level of CCL20 was determined by follow-up procedures according to the ELISA kit instructions, as shown in FIG. 2, CCL20 was overexpressed in tumor tissues of most patients. Subsequently, the person is further detectedCCL20 secretion levels of lung cancer cell lines. At 4X 10⁵The tumor cells are inoculated in a culture dish, culture supernatant is collected after 24H, the secretion level of CCL20 is detected according to the instruction, and as shown in figure 3, the secretion level of CCL20 is higher in lung cancer cell lines A549, H23 and a CCL20 over-expression cell line A549/CCL 20.

Meanwhile, the expression of a corresponding receptor CCR6 of CCL20 in T cells is detected by flow cytometry, a lymphocyte separation solution is used for separating and enriching PBMCs (peripheral blood cells) of lung cancer patients, resting and CD3/CD28 beads activated T cells are collected, then CD4, CD8 and CCR6 flow antibodies are added, the cells are dyed for 20min in a dark place at 4 ℃, washed for 1 time by PBS and transferred to a flow cell tube, and the detection is carried out by an Asia flow cytometer of a company BD. As shown in fig. 4, CCR6 was less expressed in both CD 4T cells and CD 8T cells, particularly in CD 8T cells. Therefore, we tried to verify whether T cell homing and aggregation in solid tumors could be enhanced by over-expressing CCR6 in T cells, thereby enhancing killing effect.

Example 2

And (5) constructing an expression system.

The expression system consists of a vector expressing CAR and a vector expressing CCR 6; the CAR comprises in order a leader sequence, a scFv that recognizes an antigen, a hinge and transmembrane domain, an intracellular costimulatory signal, an intracellular activation signal CD3 ζ; the vector was lentiviral FUW (see Chimeric antigen receptor T (CAR-T) cells expanded with IL-7/IL-15 medium surfactant antigens or effects, Protein & Cell, June 2019).

Artificially synthesizing a CAR encoding gene and a CCR6 encoding gene, adding an XbaI restriction site at the front end of a sequence, adding an FseI restriction site at the tail end of the sequence, connecting the sequence into a cloning plasmid, carrying out restriction on a lentivirus expression plasmid and the cloning plasmid containing a target gene by using XbaI and FseI, carrying out agarose gel electrophoresis and gel cutting to recover a linearized lentivirus expression plasmid and a target gene fragment, connecting the recovered lentivirus expression plasmid and the target gene by using T4 ligase, transforming the obtained product into a DH5 α strain, coating the strain on an ampicillin-resistant LB solid plate for overnight culture, selecting a single cloning colony on the plate, inoculating the single cloning colony in an ampicillin-resistant LB liquid culture medium for overnight culture for 12-14 hours, then carrying out small-scale plasmid extraction and carrying out restriction enzyme digestion verification to respectively obtain a correctly connected CAR recombinant plasmid and a CCR6 recombinant plasmid.

CAR recombinant plasmid and CCR6 recombinant plasmid were subjected to endotoxin-free mass extraction and were mixed with psPAX2 and pmd2.g virus packaging plasmids, respectively, according to 10: 9: 6 into the virus packaging cells 293T by calcium phosphate, after 48 h the culture supernatant containing the virus particles was collected, the culture supernatant was filtered through a 0.45 μm filter and transferred to an ultracentrifuge tube, the virus particles were concentrated by low temperature ultracentrifugation (20000 rpm, 2 h, 4 ℃) to give the first and second lentiviral vectors, and then the two lentiviral vectors were co-transfected into immune cells.

The nucleotide sequence of the leader sequence of the CAR is from the sequence SEQ ID NO: 1.

the scFv nucleotide sequence of the CAR targeting the tumor associated antigen EGFR is derived from the sequence SEQ ID NO. 2.

The nucleotide sequence of the hinge and transmembrane domain of the CAR is from the sequence SEQ ID No. 3.

The nucleotide sequence of the intracellular costimulatory signal CD28 of the CAR is from the sequence SEQ ID No. 4.

The nucleotide sequence of the intracellular activation signal CD3 ζ of the CAR is from the sequence SEQ ID NO. 5.

The amino acid sequence of the leader sequence of the CAR is from the sequence SEQ ID NO: 6.

the EGFR-targeting scFv amino acid sequence of the CAR is from the sequence SEQ ID NO. 7.

The amino acid sequence of the hinge and transmembrane domains of the CAR is from the sequence SEQ ID No. 8.

The amino acid sequence of the intracellular co-stimulatory signal CD28 of the CAR is from the sequence SEQ ID No. 9.

The amino acid sequence of the intracellular activation signal CD3 ζ of the CAR is from the sequence SEQ ID NO 10.

The nucleotide sequence of CCR6 is derived from the sequence SEQ ID NO. 11, and the amino acid sequence is selected from the sequence SEQ ID NO. 12.

Example 3

And (3) carrying out isolated culture and infection on healthy human peripheral blood T cells.

Peripheral blood of healthy people is taken, mononuclear cells are separated by a density gradient centrifugation method, T cells are enriched by using a T cell enrichment kit of Meitian and whirly company, the T cells are inoculated in X-VIVO 15 culture medium of Lonza and added with 100 UI/mL IL-2, and then CD3/CD28 Dynabeads of Sammerfei company are added according to the instructions for activated amplification of the T cells.

After 36 h of T cell activation, using EGFR as a target of lung adenocarcinoma and the CCL20-CCR6 system as an example, lentiviral particles targeting EGFR-targeted CARs and chemokine receptor CCR6 were added at a rate of 10 multiplicity of infection for infection. After 1 week, the flow cytometry examined the infection efficiency of T cells, which as shown in figure 5, were successfully infected with CAR and CCR6, and the proportion of CAR and CCR6 double positive T cells reached 23%.

Example 4

Overexpression of CCR6 did not affect factor secretion and cell killing ability of CAR-T cells

2 x 10 of different groups⁵T cells and 2X 10⁵Tumor cells were co-incubated for 24h, and after centrifugation to collect the supernatant, the subsequent procedures were performed according to the instructions of the IL-2 and IFN-gama ELISA kits from Samerafei. As shown in figure 6, overexpression of CCR6 did not affect the cytokine secretion capacity of CAR-T cells. Subsequently, we used a luciferase-based cell killing assay. First, the targeted tumor cells were infected with GFP-luc virus particles, yielding H1975/luc, H23/luc, A549/luc and A549-CCL20/luc, respectively. Then, different groups of T cells and tumor cells were mixed at an effective target ratio of 10: 1 for 24h, followed by the addition of a fluorescein substrate to determine the fluorescein value to calculate the killing of the cells. The tumor cell hole without T cells is taken as a reference, compared with the reference hole, the ratio of the reduced fluorescence value is the killing efficiency, and the formula is as follows: percent kill = (reference well fluorescence value-target well fluorescence value) ÷ reference well × 100%. As shown in FIG. 7, overexpression of CCR6 did not affect the killing function of CAR-T cells.

Example 5

Overexpression of CCR6 promotes migration of Jurkat T cells to CCL20 secreting tumor cells

To validate the feasibility of the chemokine system to direct CAR-T cell aggregation to tumors, we first overexpressed CCR6 and EGFRCAR in the Jurkat T cell line, followed by seeding each group of cells in a transwell chamber, as shown in fig. 8, with significant migration of Jurkat cells overexpressing CCR6 to tumor culture supernatant containing CCL 20. Subsequently, 1X 10 inoculation⁶A549/CCL20 cells were subcutaneously injected into the back of mice 10 days later with caudal vein infusion of Jurkat/luc cells infected with CCR6 and CAR virus, followed by detection of fluorescence intensity at subcutaneous tumors with 24h, 48 h and 120 h. As shown in figure 9, EGFR CAR + CCR6 Jurkat cells clearly aggregated at the subcutaneous tumor compared to EGFR CAR Jurkat cells.

Example 6

CAR T cells overexpressing CCR6 kill tumor cells more efficiently and prolong the survival time of tumor-bearing mice.

To further verify the in vivo antitumor activity of the chemokine receptor CAR-T cells added, 2X 10 cells were inoculated⁵H23/luc cells subcutaneously in the back of mice, a gradient dose (1X 10) was administered by tail vein infusion 7 days later⁷，3×10⁶，1×10⁶) And CCR6+ CAR T cells, followed by detection of fluorescein intensity by a small animal imager to detect tumor cell size. The results show that the CCR6+ CAR T treated group had better therapeutic effect than the traditional CAR-T group at the same infusion dose (fig. 10), and that CCR6 promoted CAR-T cell infiltration into the tumor (fig. 11), exerted better anti-tumor effect, and significantly prolonged survival time of tumor-bearing mice (fig. 12).

The foregoing list is only illustrative of the preferred embodiments of the present invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> institute of animal research of Chinese academy of sciences

<120> modified immune cell and use thereof

<130>1

<160>12

<170>SIPOSequenceListing 1.0

<210>1

<211>66

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60

atccca 66

<210>2

<211>1362

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gatattctgc tgacccagag cccggtgatt ctgagcgtga gcccgggcga acgcgtgagc 60

tttagctgcc gcgcgagcca gagcattggc accaacattc attggtatca gcagcgcacc 120

aacggcagcc cgcgcctgct gattaaatat gcgagcgaaa gcattagcgg cattccgagc 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga gcattaacag cgtggaaagc 240

gaagatattg cggattatta ttgccagcag aacaacaact ggccgaccac ctttggcgcg 300

ggcaccaaac tggaactgaa acgcaccgtg gcggcgccga gcgtgtttat ttttccgccg 360

agcgatgaac agctgaaaag cggcaccgcg agcgtggtgt gcctgctgaa caacttttat 420

ccgcgcgaag cgaaagtgca gtggaaagtg gataacgcgc tgcagagcggcaacagccag 480

gaaagcgtga ccgaacagga tagcaaagat agcacctata gcctgagcag caccctgacc 540

ctgagcaaag cggattatga aaaacataaa gtgtatgcgt gcgaagtgac ccatcagggc 600

ctgagcagcc cggtgaccaa aagctttaac cgcggcgcgg gctccacctc tggatccggc 660

aagcccggat ctggcgaggg atccaccaag ggccaggtgc agctgaaaca gagcggcccg 720

ggcctggtgc agccgagcca gagcctgagc attacctgca ccgtgagcgg ctttagcctg 780

accaactatg gcgtgcattg ggtgcgccag agcccgggca aaggcctgga atggctgggc 840

gtgatttgga gcggcggcaa caccgattat aacaccccgt ttaccagccg cctgagcatt 900

aacaaagata acagcaaaag ccaggtgttt tttaaaatga acagcctgca gagcaacgat 960

accgcgattt attattgcgc gcgcgcgctg acctattatg attatgaatt tgcgtattgg 1020

ggccagggca ccctggtgac cgtgagcgcg gcgagcacca aaggcccgag cgtgtttccg 1080

ctggcgccga gcagcaaaag caccagcggc ggcaccgcgg cgctgggctg cctggtgaaa 1140

gattattttc cggaaccggt gaccgtgagc tggaacagcg gcgcgctgac cagcggcgtg 1200

catacctttc cggcggtgct gcagagcagc ggcctgtata gcctgagcag cgtggtgacc 1260

gtgccgagca gcagcctggg cacccagacc tatatttgca acgtgaacca taaaccgagc 1320

aacaccaaag tggataaacg cgtggaaccg aaaagcgcgg cc 1362

<210>3

<211>204

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gcaattgaag ttatgtatcc tcctccttac ctagacaatg agaagagcaa tggaaccatt 60

atccatgtga aagggaaaca cctttgtcca agtcccctat ttcccggacc ttctaagccc 120

ttttgggtgc tggtggtggt tgggggagtc ctggcttgct atagcttgct agtaacagtg 180

gcctttatta ttttctgggt gagg 204

<210>4

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

agtaagagga gcaggctcct gcacagtgac tacatgaaca tgactccccg ccgccccggg 60

cccacccgca agcattacca gccctatgcc ccaccacgcg acttcgcagc ctatcgctcc 120

<210>5

<211>339

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 60

tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120

cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat 180

gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc 240

cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc 300

tacgacgccc ttcacatgca ggccctgccc cctcgctaa339

<210>6

<211>22

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro

20

<210>7

<211>453

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

Ile Leu Leu Thr Gln Ser Pro Val Ile Leu Ser Val Ser Pro Gly Glu

1 5 10 15

Arg Val Ser Phe Ser Cys Arg Ala Ser Gln Ser Ile Gly Thr Asn Ile

20 25 30

His Trp Tyr Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile Lys

35 40 45

Tyr Ala Ser Glu Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly Ser

50 55 60

Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser Glu

65 70 75 80

Asp Ile Ala Asp Tyr Tyr Cys Gln Gln Asn Asn Asn Trp Pro Thr Thr

85 90 95

Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Arg Thr Val Ala Ala Pro

100 105 110

Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr

115 120 125

Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys

130 135 140

Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu

145 150 155 160

Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser

165 170 175

Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala

180 185 190

Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe

195 200 205

Asn Arg Gly Ala Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly

210 215 220

Glu Gly Ser Thr Lys Gly Gln Val Gln Leu Lys Gln Ser Gly Pro Gly

225 230 235 240

Leu Val Gln Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly

245 250 255

Phe Ser Leu Thr Asn Tyr Gly Val His Trp Val Arg Gln Ser Pro Gly

260 265 270

Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Ser Gly Gly Asn Thr Asp

275 280 285

Tyr Asn Thr Pro Phe Thr Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser

290 295 300

Lys Ser Gln Val Phe Phe Lys Met Asn Ser Leu Gln Ser Asn Asp Thr

305 310 315 320

Ala Ile Tyr Tyr Cys Ala Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe

325 330 335

Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala Ala Ser Thr

340 345 350

Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser

355 360 365

Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu

370 375 380

Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His

385 390 395 400

Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser

405 410 415

Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys

420 425 430

Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu

435 440 445

Pro Lys Ser Ala Ala

450

<210>8

<211>68

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>8

Ala Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser

1 5 10 15

Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro

20 25 30

Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly

35 40 45

Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile

50 55 60

Phe Trp Val Arg

65

<210>9

<211>40

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro

1 5 10 15

Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro

20 25 30

Arg Asp Phe Ala Ala Tyr Arg Ser

35 40

<210>10

<211>112

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>10

Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

1 5 10 15

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

20 25 30

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

35 40 45

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

50 55 60

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

65 70 7580

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

85 90 95

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

100 105 110

<210>11

<211>1125

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

atgagcgggg aatcaatgaa tttcagcgat gttttcgact ccagtgaaga ttattttgtg 60

tcagtcaata cttcatatta ctcagttgat tctgagatgt tactgtgctc cttgcaggag 120

gtcaggcagt tctccaggct atttgtaccg attgcctact ccttgatctg tgtctttggc 180

ctcctgggga atattctggt ggtgatcacc tttgcttttt ataagaaggc caggtctatg 240

acagacgtct atctcttgaa catggccatt gcagacatcc tctttgttct tactctccca 300

ttctgggcag tgagtcatgc caccggtgcg tgggttttca gcaatgccac gtgcaagttg 360

ctaaaaggca tctatgccat caactttaac tgcgggatgc tgctcctgac ttgcattagc 420

atggaccggt acatcgccat tgtacaggcg actaagtcat tccggctccg atccagaaca 480

ctaccgcgca gcaaaatcat ctgccttgtt gtgtgggggc tgtcagtcat catctccagc 540

tcaacttttg tcttcaacca aaaatacaac acccaaggca gcgatgtctg tgaacccaag 600

taccagactg tctcggagcc catcaggtgg aagctgctga tgttggggct tgagctactc 660

tttggtttct ttatcccttt gatgttcatg atattttgtt acacgttcat tgtcaaaacc 720

ttggtgcaag ctcagaattc taaaaggcac aaagccatcc gtgtaatcat agctgtggtg 780

cttgtgtttc tggcttgtca gattcctcat aacatggtcc tgcttgtgac ggctgcaaat 840

ttgggtaaaa tgaaccgatc ctgccagagc gaaaagctaa ttggctatac gaaaactgtc 900

acagaagtcc tggctttcct gcactgctgc ctgaaccctg tgctctacgc ttttattggg 960

cagaagttca gaaactactt tctgaagatc ttgaaggacc tgtggtgtgt gagaaggaag 1020

tacaagtcct caggcttctc ctgtgccggg aggtactcag aaaacatttc tcggcagacc 1080

agtgagaccg cagataacga caatgcgtcg tccttcacta tgtga 1125

<210>12

<211>374

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>12

Met Ser Gly Glu Ser Met Asn Phe Ser Asp Val Phe Asp Ser Ser Glu

1 5 10 15

Asp Tyr Phe Val Ser Val Asn Thr Ser Tyr Tyr Ser Val Asp Ser Glu

20 25 30

Met Leu Leu Cys Ser Leu Gln Glu Val Arg Gln Phe Ser Arg Leu Phe

35 40 45

Val Pro Ile Ala Tyr Ser Leu Ile Cys Val Phe Gly Leu Leu Gly Asn

50 55 60

Ile Leu Val Val Ile Thr Phe Ala Phe Tyr Lys Lys Ala Arg Ser Met

65 70 75 80

Thr Asp Val Tyr Leu Leu Asn Met Ala Ile Ala Asp Ile Leu Phe Val

85 90 95

Leu Thr Leu Pro Phe Trp Ala Val Ser His Ala Thr Gly Ala Trp Val

100 105 110

Phe Ser Asn Ala Thr Cys Lys Leu Leu Lys Gly Ile Tyr Ala Ile Asn

115 120 125

Phe Asn Cys Gly Met Leu Leu Leu Thr Cys Ile Ser Met Asp Arg Tyr

130 135 140

Ile Ala Ile Val Gln Ala Thr Lys Ser Phe Arg Leu Arg Ser Arg Thr

145 150 155 160

Leu Pro Arg Ser Lys Ile Ile Cys Leu Val Val Trp Gly Leu Ser Val

165 170 175

Ile Ile Ser Ser Ser Thr Phe Val Phe Asn Gln Lys Tyr Asn Thr Gln

180 185 190

Gly Ser Asp Val Cys Glu Pro Lys Tyr Gln Thr Val Ser Glu Pro Ile

195 200 205

Arg Trp Lys Leu Leu Met Leu Gly Leu Glu Leu Leu Phe Gly Phe Phe

210 215 220

Ile Pro Leu Met Phe Met Ile Phe Cys Tyr Thr Phe Ile Val Lys Thr

225 230 235 240

Leu Val Gln Ala Gln Asn Ser Lys Arg His Lys Ala Ile Arg Val Ile

245 250 255

Ile Ala Val Val Leu Val Phe Leu Ala Cys Gln Ile Pro His Asn Met

260 265 270

Val Leu Leu Val Thr Ala Ala Asn Leu Gly Lys Met Asn Arg Ser Cys

275 280 285

Gln Ser Glu Lys Leu Ile Gly Tyr Thr Lys Thr Val Thr Glu Val Leu

290 295 300

Ala Phe Leu His Cys Cys Leu Asn Pro Val Leu Tyr Ala Phe Ile Gly

305 310 315 320

Gln Lys Phe Arg Asn Tyr Phe Leu Lys Ile Leu Lys Asp Leu Trp Cys

325 330 335

Val Arg Arg Lys Tyr Lys Ser Ser Gly Phe Ser Cys Ala Gly Arg Tyr

340 345 350

Ser Glu Asn Ile Ser Arg Gln Thr Ser Glu Thr Ala Asp Asn Asp Asn

355 360 365

Ala Ser Ser Phe Thr Met

370

Claims (17)

1. A modified immune cell, wherein said immune cell expresses a chimeric antigen receptor and overexpresses the chemokine receptor CCR 6.

2. The modified immune cell of claim 1, wherein said immune cell has not been modified to express or under-express chemokine receptor CCR 6.

3. The modified immune cell of any one of claims 1-2, wherein said immune cell is a T cell, NK cell, NKT cell, macrophage and other tumor killer cell.

4. The immune cell of claim 3, wherein the T cell is a chimeric antigen receptor T cell (CAR-T), a T cell receptor T cell (TCR-T), or a tumor infiltrating T cell (TIL).

5. The immune cell of any one of claims 1-2, wherein a gene of interest is transferred into said immune cell for expression of chimeric antigen receptor and chemokine receptor CCR 6.

6. The immune cell of claim 5, wherein the transfer mode is: lentiviruses, retroviruses, common plasmid vectors, episomal vectors, nano-delivery systems, electrical transduction, transposons, and other delivery systems.

7. The immune cell of claim 1 or 2 or 4 or 6, wherein the immune cell has at least one of a) -e) as compared to an unmodified immune cell,

a) the secretion ability of cytokines is not affected;

b) the specific killing capacity to the tumor cells is not influenced;

c) enhancing the ability to home and aggregate to solid tumors secreting CCL 20;

d) enhanced infiltration in CCL20 solid tumors; and

e) the ability to prolong the survival time of a patient.

8. The immune cell of claim 1 or 2 or 4 or 6, wherein the chimeric antigen receptor comprises a leader sequence, a scFv that recognizes a tumor associated antigen, a hinge region and transmembrane domain, an intracellular costimulatory signal, and an intracellular activation signal CD3 ζ.

9. The immune cell of claim 8, wherein said tumor-associated antigen comprises AFP, BMCA, CEA, CA-125, CA-9, CA-4, CD116, CD117, CD171, CD123, CD, CLL, CD133, CD138, Her, GD, gp, GPC, GnTV, EGFR, EGFRvIII, EpCAM, PSA, PSMA, PAP, NY-ESO-1, LAGA-1a, cMET, P, Prostein, PCTA-1, MAGE, ROR, FAP, NKG2, EMA, ETA, GFAP, MSA, MART-1, NSE, TAG-72, IL13, NKR-2, VEGFR, CLD, EphA, alpha-later, CAIX, MG, LMP, MUL, MUSC, PIG, IG, EGFP-B, EGFA, EGFP-2, EGFA, EGSA-2, EGFA, EGSA, EGFA, EGFP, EGFA, EGSA, EGFA, EGSA, EGFA, EGSA, EGFA.

10. The immune cell of claim 9, wherein the scFv is selected from the group consisting of a monoclonal antibody, a chimeric monoclonal antibody, a humanized monoclonal antibody, a human antibody, a nanobody, and a synthetic antibody.

11. The immune cell of claim 8, wherein the chimeric antigen receptor comprises a leader sequence, a scFv that recognizes EGFR, a CD28 or CD8 hinge and transmembrane domain, a CD28 or CD137(4-1BB) costimulatory domain, and an intracellular activation signal, CD3 ζ.

12. Use of the immune cell of any one of claims 1-11 in the preparation of a medicament for the treatment of a tumor.

13. The use according to claim 12, wherein the tumor is selected from a solid tumor that overexpresses CCL 20.

14. The use of claim 13, wherein the solid tumor is selected from the group consisting of cervical squamous carcinoma, cervical adenocarcinoma, colon carcinoma, esophageal carcinoma, glioblastoma multiforme, squamous cell carcinoma of the head and neck, clear cell carcinoma of the kidney, hepatocellular carcinoma, lung adenocarcinoma, squamous cell carcinoma of the lung, ovarian carcinoma, pancreatic carcinoma, rectal carcinoma, gastric carcinoma, and endometrial carcinoma.

15. A gene expression system comprising a first vector expressing a chimeric antigen receptor and a second vector expressing CCR 6; or a vector comprising a co-expression of chimeric antigen receptor and CCR 6.

16. A method of modifying an immune cell, comprising:

transfecting an immune cell with the gene expression system of claim 15;

optionally, the cells are cultured in vitro for expansion.

17. The method of claim 16, wherein the immune cells are T cells, NK cells, NKT cells, macrophages, and other tumor killing cells.

Images