CN110846427A

CN110846427A - Salmonella typhimurium specific gene probe for diagnosing human intestinal pathogenic bacteria infection

Info

Publication number: CN110846427A
Application number: CN201911343166.2A
Authority: CN
Inventors: 黄新祥
Original assignee: Jiangsu Yi Nuo Fei Biotechnology Co Ltd
Current assignee: Jiangsu Yi Nuo Fei Biotechnology Co Ltd
Priority date: 2019-12-24
Filing date: 2019-12-24
Publication date: 2020-02-28

Abstract

The invention discloses a gene chip salmonella typhimurium specific gene probe for diagnosing infection of intestinal pathogenic bacteria, which has a nucleotide sequence shown as SEQ ID NO: 1 is shown. After determining the candidate sequence, designing specific primers, and selecting standard and clinically separated wild strains for PCR investigation and corresponding sequence analysis verification. According to the verified pathogenic bacteria specific probe sequence, a synthetic primer is designed, corresponding specific nucleotide fragments are amplified through PCR, each specific nucleotide fragment is about 200 nucleotides in length, and 3 to 5 specific fragments of a certain pathogenic bacteria are amplified and linked through overlap extension PCR to serve as the specific probes of various pathogenic bacteria. The probe prepared by connecting highly specific regions of a plurality of genes in series not only has higher specificity, but also greatly improves the detection sensitivity because the probe can be simultaneously hybridized with a plurality of specific fragments.

Description

Salmonella typhimurium specific gene probe for diagnosing human intestinal pathogenic bacteria infection

Technical Field

The invention relates to the technical field of genes, in particular to a salmonella typhimurium specific gene probe for diagnosing human intestinal pathogenic bacteria infection.

Background

The traditional detection method for the intestinal pathogenic bacteria is to identify the intestinal pathogenic bacteria according to biochemical reaction and serological test of the pathogenic bacteria on the basis of bacterial culture, and has a plurality of defects at present: (1) due to the limitation of conditions, the culture of a plurality of bacteria such as anaerobes can be performed in only a few laboratories, and most clinical examination laboratories have the problem of missing detection; (2) the detection period is long, and particularly when acute severe patients are encountered, the clinical medication guidance is often not good due to the fact that accurate diagnosis results of pathogenic bacteria cannot be obtained in time; (3) the method has the advantages that the workload is large, the efficiency is low, the most commonly used culture media for inspecting the excrement in the microbial laboratory in China are Mac agar, SS agar, alkali peptone water, No. 4 agar and the like, the detection is mainly aimed at the detection of salmonella, Shigella and vibrio, and the inspection of other bacteria needs to select other special culture media for inspection with pertinence according to clinical symptoms provided by a clinician on the basis of the selective culture negative; (4) fungi were missed. Therefore, the positive rate of pathogenic bacteria culture in diarrhea feces in the current clinical microbiological laboratory is low. In addition, most of the current third-class hospitals purchase imported microorganism identification systems, and carry out identification based on bacterial culture and biochemical reaction, the microorganism identification systems have to grow pathogenic bacteria on a proper culture medium, then select a proper identification card, after incubation for a period of time, identify the bacteria by automatically judging the biochemical reaction of the pathogenic bacteria, and identify some bacteria only to belong to, and also need to combine with corresponding serological tests to identify the species. Therefore, the labor and time are not saved when the microorganism identification system is used for detecting the intestinal pathogenic bacteria, and the positive rate of detection cannot be improved. Under the condition that an exact pathogenic bacterium detection result cannot be obtained, a clinician can only adopt the combined use of antibacterial drugs according to general symptoms so as to obtain a good treatment effect, and the treatment is also a main reason for aggravating the drug resistance problem of the intestinal pathogenic bacteria. Therefore, research and application of new technologies are urgently needed to improve the detection rate of intestinal pathogenic bacteria and reduce the threat of intestinal pathogenic bacteria infection to human health.

With the development of cell and molecular biology in recent years, many commonly used molecular biology techniques, such as PCR, multiplex PCR, fluorescent quantitative PCR, etc., are used in clinical laboratories for the detection of pathogenic bacteria. When PCR is used for detecting pathogenic bacteria of intestinal infection, although the PCR has the advantages of rapidness, sensitivity and the like, the PCR also has the defects of easy cross contamination, incapability of quantifying, capability of detecting only one gene at a time and the like; although the fluorescent quantitative PCR can be used for rapid quantification, only one gene (bacterium) can be detected at a time; the multiplex PCR technique can detect a plurality of genes (bacteria) at a time, but since the detection is based on the molecular size of the PCR product, the detection is generally not more than 6 genes (bacteria) at a time, and even in the multiplex quantitative PCR, the number of target genes (bacteria) detected at a time is still limited, and is generally not more than 10.

The gene chip analysis technology has been reported in many studies in the aspects of bacterial molecular epidemiology investigation, bacterial gene identification, gene mutation and polymorphism analysis, gene expression profile analysis and the like, and has also been tried in the aspect of pathogenic microorganism detection. Previous researches show that the sensitivity is low when the gene chip is used for directly detecting bacteria, and 10 times is needed for one time^5～6For increasing the sensitivity, the bacterial load is often combined with PCR, for example, a universal primer is designed to amplify various bacterial conserved genes, such as 16SRNA or 23SrRNA genes, and the amplified product is labeled by fluorescence and then hybridized with various specific probes fixed on a chip and designed according to the local variable region of the conserved genes. Although the detection sensitivity can be obviously improved by using the method, the difference of rRNA genes among different strains in the same genus is very small, so that the species difference in the genus is difficult. Moreover, the secondary structure and the tertiary structure of rRNA gene also influence the hybridization efficiency, resulting in many false negative and false positive results. In addition, there is also a report of the application of combining gene chip with multiplex PCR, according to the specific marker gene of various pathogenic bacteria, such as toxic factor gene, etc., preparing chip probe to fix on the chip, utilizing specific primer to make multiplex PCR amplification on the sample, and making fluorescence at the same time, then making hybridization with gene chip. Although the method gives consideration to the specificity and sensitivity of detection, the method has certain limitations, mainly because the types of the genes amplified at one time are limited when the target genes are amplified by multiple PCR, because the number of the primer pairs is too large, dimers are easily formed among the primers to influence the amplification efficiency, so that the method usually needs to carry out multiple PCR amplification on one sample in the detection, and the high efficiency of a gene chip is weakened to a certain extent. Therefore, no well-developed gene chip is used for the differential diagnosis of clinical enteropathogenic bacteria at present.

Disclosure of Invention

The invention aims to solve the technical problem of overcoming the defect that labor and time are not saved when a microorganism identification system is used for detecting the enteric pathogenic bacteria in the prior art, and provides a salmonella typhimurium specific gene probe for diagnosing human enteric pathogenic bacteria infection.

The invention relates to a salmonella typhimurium (S.typhimurium) specific probe, which has a nucleotide sequence shown as SEQID: 1 is shown.

(ii) SEQ ID: 1 salmonella typhimurium (s. typhimurium) specific probe nucleotide sequence TTAAAATTTGATGATACGAC TGGAAAATAT TACGCCAAAG TTACCGTTAC GGGGGGAACT GGTAAAGATG GCTATTATGAAGTTTCCGTT GATAAGACGA ACGGTGAGGT GACTCTTGCT GGCGGTGCGA CTTCCCCGCT TACAGGTGGACTACCTGCGA CAGCAACTGA GGATGTGAAA AATGTACAAG TTGCAAATGC TGATTTGACA GAGGCTAAAGCCGCATTGAC AGCAGCAGGT TGGTGAAAAC CAGAAGGTAA CGGCGGAACT GCAAAAAGCC ATGTCTTCTGACCAGTCGAA AGCATCCGCA CTCGCTGCTA TCGCAGGCAA TATTCGCGCT

The preparation method of the specific probe comprises the following steps:

s1 preliminary selection of DNA sequence

Selecting corresponding sequence from the specificity DNA sequence information base, combining with the virulence gene or antigen coding gene which is found according to the related literature and is peculiar to the strain, and further determining the specificity area of each gene, and taking the specificity area as the candidate sequence for probe design.

S2 DNA sequence verification

Designing specific primers according to the initially selected DNA sequence, and selecting standard and clinically separated wild strains for PCR investigation and corresponding sequence analysis verification.

According to the verified pathogenic bacteria specific probe sequence, a synthetic primer is designed, corresponding specific nucleotide fragments are amplified through PCR, each specific nucleotide fragment is about 200 nucleotides in length, and 3 to 5 specific fragments of a certain pathogenic bacteria are amplified and linked through overlap extension PCR to serve as the specific probes of various pathogenic bacteria. Because the specific region of a single gene is often limited, the specificity and the weakening are inevitably caused by only expanding the length of a specific gene to obtain the sensitivity, and the probe prepared by connecting the highly specific regions of a plurality of genes in series not only has higher specificity, but also greatly improves the detection sensitivity because the probe can be simultaneously hybridized with a plurality of specific fragments.

The invention has the following beneficial effects:

the project improves the probe design, improves the nucleic acid extraction process, marks fluorescence and other researches, is comprehensively applied to improve the sensitivity of the gene chip for detecting pathogenic bacteria directly, and establishes a gene chip analysis system aiming at the specificity of various common intestinal pathogenic bacteria of China, so that various intestinal pathogenic bacteria can be directly detected from the fecal specimen without multiple PCR amplification. In addition, the signal intensity obtained from the gene chip can reflect the abundance of various bacteria in the sample, thereby providing more diagnosis and treatment information for intestinal tract complex infection, dysbacteriosis and other diseases. With the popularization of chip scanners in hospitals, the specific and broad-spectrum gene chip for diagnosing the intestinal pathogens has a wide market prospect, and the popularization and the application of the gene chip can generate great social and economic values.

On the basis of a bacteria specificity DNA sequence information base, a gene chip analysis system for diagnosing the intestinal bacterial infection is designed and developed, so that the important intestinal bacterial inspection work aiming at the complexity in clinic at present can be overcome, a plurality of defects of the prior application technology can be overcome, the detection efficiency and the accuracy of a clinic inspection center room can be fully improved, and the significance and the effect of establishing the bacteria specificity DNA sequence information base can be further verified and exerted.

Detailed Description

The following description of the preferred embodiments of the present invention is provided for the purpose of illustration and description, and is in no way intended to limit the invention.

Examples

The invention provides a salmonella typhimurium specific probe for diagnosing human intestinal pathogenic bacteria infection, which has a nucleotide sequence shown as SEQ ID NO: 1 is shown. The probe can be used for detecting the content of the salmonella typhimurium by a chemiluminescence method, the content of the salmonella typhimurium is obtained by chemiluminescence intensity, and the detection effect is evaluated by a standard addition method, so that the result shows that the method has the characteristic of high precision in the detection of the salmonella typhimurium, the probe has high precision on the surface, and the recovery rate of a sample is 97-102%.

During specific evaluation, the designed and prepared salmonella typhimurium DNA probe, vibrio parahaemolyticus, shigella dysenteriae, salmonella typhimurium, salmonella paratyphi A, staphylococcus aureus, salmonella paratyphi C and salmonella typhimurium are spotted on the surface of a glass chip, each probe is spotted in duplicate and in parallel, 10 mu g of DNA extracted from a sample of the feces of healthy people is added with 1.0ng of salmonella typhimurium genome DNA to be used as a sample, 8-linked random primers and a Kelnow enzyme exosome are used for fluorescence (Cy3) labeling, and then the sample is hybridized with the chip probe, and is cleaned and scanned for analysis, wherein the fluorescence scanning results are shown in the following table. After the fluorescent signal is digitized, the average fluorescence intensity of the salmonella typhimurium probe is 100%, and the relative fluorescence intensities of other probes are less than 15%, which shows that the salmonella typhimurium probe has good sensitivity and specificity.

By adopting the same method, the DNA probes of salmonella typhi, salmonella paratyphi A, salmonella paratyphi B and salmonella paratyphi C are respectively hybridized with the specific DNA probe of salmonella typhimurium after being fluorescently labeled, the relative fluorescence intensity is less than 15% of the target probe signal, and the result is as follows:

DNA hybridization with Salmonella paratyphi B

DNA hybridization with Salmonella paratyphi A

Hybridization with Salmonella paratyphi C

Hybridization with Salmonella typhi

Therefore, the DNA probe of the salmonella typhimurium has better discrimination with the DNAs of salmonella paratyphi B, salmonella paratyphi A, salmonella paratyphi C and salmonella typhi, and further shows that the specificity of the salmonella typhimurium DNA probe is higher.

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that changes may be made in the embodiments and/or equivalents thereof without departing from the spirit and scope of the invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Jiangsu Yinuo Biotech Co., Ltd

<120> Salmonella typhimurium specific gene probe for diagnosing human intestinal pathogen infection

<130>BXK20191012

<141>2019-12-24

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>340

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ttaaaatttg atgatacgac tggaaaatat tacgccaaag ttaccgttac ggggggaact 60

ggtaaagatg gctattatga agtttccgtt gataagacga acggtgaggt gactcttgct 120

ggcggtgcga cttccccgct tacaggtgga ctacctgcga cagcaactga ggatgtgaaa 180

aatgtacaag ttgcaaatgc tgatttgaca gaggctaaag ccgcattgac agcagcaggt 240

tggtgaaaac cagaaggtaa cggcggaact gcaaaaagcc atgtcttctg accagtcgaa 300

agcatccgca ctcgctgcta tcgcaggcaa tattcgcgct 340

Claims

1. The salmonella typhimurium specific gene probe for diagnosing human intestinal pathogenic bacteria infection is characterized in that the nucleotide sequence is shown as SEQ ID NO: 1 is shown.

2. The method for preparing a salmonella typhimurium specific gene probe for diagnosing human enteropathogenic bacteria infection according to claim 1, comprising the steps of:

s1 preliminary selection of DNA sequence

Selecting corresponding sequences from a specific DNA sequence information base, searching specific virulence genes or antigen coding genes of strains according to related documents, and further determining specific regions of the genes to be used as candidate sequences for probe design;

s2 DNA sequence verification

According to the verified pathogenic bacteria specific probe sequence, a synthetic primer is designed, corresponding specific nucleotide fragments are amplified through PCR, each specific nucleotide fragment is about 200 nucleotides in length, and 3 to 5 specific fragments of a certain pathogenic bacteria are amplified and linked through overlap extension PCR to serve as the specific probes of various pathogenic bacteria.

3. Use of the salmonella typhimurium-specific gene probe for diagnosis of human enteropathogenic infection according to claim 1 or 2 for detecting the content of salmonella typhimurium.