CN110846291A - Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof - Google Patents

Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof Download PDF

Info

Publication number
CN110846291A
CN110846291A CN202010034188.7A CN202010034188A CN110846291A CN 110846291 A CN110846291 A CN 110846291A CN 202010034188 A CN202010034188 A CN 202010034188A CN 110846291 A CN110846291 A CN 110846291A
Authority
CN
China
Prior art keywords
ile
gly
glu
val
leu
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202010034188.7A
Other languages
Chinese (zh)
Other versions
CN110846291B (en
Inventor
马富强
郭天杰
张艺凡
杨广宇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Institute of Biomedical Engineering and Technology of CAS
Original Assignee
Suzhou Institute of Biomedical Engineering and Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Institute of Biomedical Engineering and Technology of CAS filed Critical Suzhou Institute of Biomedical Engineering and Technology of CAS
Priority to CN202010034188.7A priority Critical patent/CN110846291B/en
Publication of CN110846291A publication Critical patent/CN110846291A/en
Application granted granted Critical
Publication of CN110846291B publication Critical patent/CN110846291B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
    • C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/001—Amines; Imines
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
    • C12Y104/99—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with other acceptors (1.4.99)
    • C12Y104/99003—Amine dehydrogenase (1.4.99.3)

Abstract

The invention belongs to the technical field of biology, and particularly relates to an amine dehydrogenase mutant with improved thermal stability and construction and application of a genetic engineering bacterium thereof. The amine dehydrogenase mutant provided by the invention comprises 4 single-point mutants and 11 combined mutants, and compared with wild amine dehydrogenase, the single-point mutants and the combined mutants have longer half lives at 42 ℃; in particular, the combination mutant showed a superimposed effect of thermal stability of the single-point mutant, with a half-life of approximately 5 times that of the wild-type deaminase. The amine dehydrogenase mutant obtained by the construction method provided by the invention has better thermal stability, shows excellent stereoselectivity, regioselectivity and catalytic activity when catalyzing and synthesizing chiral amine at higher temperature, and has better application prospect.

Description

Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an amine dehydrogenase mutant with improved thermal stability and construction and application of a genetic engineering bacterium thereof.
Background
Chiral amine is a very important amine compound, widely exists in medicines, pesticides, synthetic intermediates, natural products and compounds with biological activity, especially plays an important role in the field of chiral drugs, and about 40 percent of optically active drugs contain chiral amine structures at present. Different enantiomers of chiral amines have very similar physical properties, but the difference of the stereo structures can lead different chiral enantiomers to have different biological activities, so that the metabolic, transformation or activation routes in organisms are different, and the physiological activities and the toxic effects expressed when the chiral amines act on organisms are different. It is therefore of great importance to obtain single isomers with high enantioselectivity or high diastereoselectivity. The traditional chemical synthesis method is to split a racemate by adding a chiral reagent, and the method needs the chiral reagent with equivalent weight, has the highest yield of only 50 percent and low atom economy; compared with a chemical synthesis method, the biological catalysis method has better catalysis effect, and particularly has obvious technical advantages in the aspect of identifying two enantiomers of chiral amine.
Amine dehydrogenase (AmDH) can catalyze prochiral ketone and free amine to asymmetrically synthesize chiral amine under the action of coenzyme, and is an effective biocatalyst. However, amine dehydrogenases are natural biological enzymes, and it is known that natural enzymes all function in a relatively mild environment in the body, but if amine dehydrogenases are applied in an industrially harsh environment (e.g., high temperature, extreme ph, organic solvents, non-natural substrates, product inhibition, etc.), they have poor thermal stability and thus catalytic activity is not high.
The protein engineering is based on the relationship between the structural rule and the biological function of protein molecules, and carries out gene modification or gene synthesis by means of chemistry, physics and molecular biology to modify the existing protein or manufacture a new protein to meet the requirements of human on production and life. The commonly used protein engineering methods include rational design (rational design) and irrational design (irrational design), wherein the rational design requires understanding of the structure, function and function of the protein, but the structure-function relationship of the protein is too complicated, and people still lack sufficient knowledge of the protein, so the accuracy is poor. How to improve the thermal stability of the amine dehydrogenase through protein engineering becomes a problem to be solved urgently.
Disclosure of Invention
Therefore, the technical problem to be solved by the present invention is to overcome the defect of poor thermal stability of the existing amine dehydrogenase, thereby providing an amine dehydrogenase mutant with improved thermal stability, a construction method of a genetically engineered bacterium of the amine dehydrogenase mutant, and an application of the amine dehydrogenase mutant in preparation of chiral amine.
In order to solve the technical problems, the invention adopts the technical scheme that:
the invention provides an amine dehydrogenase mutant with improved thermostability, which is (a 1) or (a 2):
(a1) a derived protein obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.2 and having the same function with the amino acid sequence shown in SEQ ID NO. 2;
(a2) a derived protein obtained by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO.2 and having at least 90% homology with the amino acid sequence shown in SEQ ID NO. 2;
the amine dehydrogenase mutant is mutated on an amino acid sequence shown in SEQ ID NO.2, and the mutation site is selected from one or more of A35D, L53R, S210A and T321P.
Preferably, the mutant of the amine dehydrogenase with improved thermostability has mutation sites of A35D, L53R, S210A, T321P, A35P/L53P, A35P/S210P, A35P/T321P, L53P/S210P, L53P/T321P, S210P/T321P, A35P/L53P/S210P, A35P/L53P/T321P, A35P/S210P/T321P, L53P/S210P/T321P, or A35P/L53P/S210P/T321P.
The present invention also provides a gene encoding an amine dehydrogenase mutant having improved thermostability as described above.
The invention also provides a recombinant plasmid containing the gene.
The invention also provides a soluble protein, immobilized enzyme or engineering bacterium containing the amine dehydrogenase mutant with improved thermal stability.
The invention also provides a construction method of the amine dehydrogenase mutant with improved thermal stability, which comprises the following steps:
searching an amino acid sequence shown by SEQ ID NO.2 in a Pfam database and an NCBI database, removing a repeated identical sequence, selecting an amino acid sequence with the consistency of more than 30% with the amino acid sequence shown by SEQ ID NO.2, then performing multi-sequence comparison through Clusalx1.83 software, arranging the residual amino acid sequence into a fasta file, uploading the fasta file to a Consensus Maker v2.0.0 server, and modifying setting parameters according to needs, wherein the online software generates a Consensus sequence which can be edited at a later stage;
predicting the three-dimensional structure of the obtained protein shown by SEQ ID NO.2 by a swisscodel online tool, observing the crystal structure of the protein shown by SEQ ID NO.2 by adopting PyMOL, and screening out mutation sites related to thermal stability as follows: a35D, L53R, S210A, T321P.
Preferably, the method for constructing the amine dehydrogenase mutant with improved thermostability,
the sequences of the amplification primers of the mutation site A35D are SEQ ID NO.20 and SEQ ID NO. 21;
the sequences of the amplification primers of the mutation site L53R are SEQ ID NO.22 and SEQ ID NO. 23;
the sequences of the amplification primers of the mutation site S210A are SEQ ID NO.24 and SEQ ID NO. 25;
the sequences of the amplification primers of the mutation site T321P are SEQ ID NO.26 and SEQ ID NO. 27.
Further preferably, a method for constructing the amine dehydrogenase mutant having improved thermostability,
the amino acid sequence of the single-point mutant corresponding to A35D is SEQ ID NO. 3;
the amino acid sequence of the single-point mutant corresponding to the L53R is SEQ ID NO. 4;
the amino acid sequence of the single-point mutant corresponding to S210A is SEQ ID NO. 5;
the amino acid sequence of the single-point mutant corresponding to the T321P is SEQ ID NO. 6;
the amino acid sequence of the combined mutant corresponding to A35D/L53R is SEQ ID NO. 7;
the amino acid sequence of the combined mutant corresponding to A35D/S210A is SEQ ID NO. 8;
the amino acid sequence of the combined mutant corresponding to A35D/T321P is SEQ ID NO. 9;
the amino acid sequence of the combined mutant corresponding to L53R/S210A is SEQ ID NO. 10;
the amino acid sequence of the combined mutant corresponding to L53R/T321P is SEQ ID NO. 11;
the amino acid sequence of the combined mutant corresponding to S210A/T321P is SEQ ID NO. 12;
the amino acid sequence of the combined mutant corresponding to A35D/L53R/S210A is SEQ ID NO. 13;
the amino acid sequence of the combined mutant corresponding to A35D/L53R/T321P is SEQ ID NO. 14;
the amino acid sequence of the combined mutant corresponding to A35D/S210A/T321P is SEQ ID NO. 15;
the amino acid sequence of the combined mutant corresponding to L53R/S210A/T321P is SEQ ID NO. 16;
the amino acid sequence of the combined mutant corresponding to A35D/L53R/S210A/T321P is SEQ ID NO. 17.
The invention also provides application of the amine dehydrogenase mutant with improved thermal stability in catalytic synthesis of chiral amine.
The technical scheme of the invention has the following advantages:
1. the amine dehydrogenase mutant with improved thermal stability provided by the invention comprises a single-point mutant and a combined mutant, and compared with wild amine dehydrogenase, the single-point mutant and the combined mutant have longer half-life at 42 ℃; in particular, the combination mutant showed a superimposed effect of thermal stability of the single-point mutant, with a half-life of approximately 5 times that of the wild-type deaminase. Based on the above, the amine dehydrogenase mutant provided by the invention has better thermal stability and is suitable for catalytic synthesis of chiral amine at higher temperature.
2. The construction method of the amine dehydrogenase mutant with improved thermal stability provided by the invention is different from the rational design based on the precise structure-function relationship of protein, the construction method takes the Consensus Concept as a guiding idea, analyzes information capable of improving the thermal stability of enzyme from the aspect of evolution, performs integrated analysis on an amine dehydrogenase family sequence, and combines the assistance of bioinformatics and crystallography methods to obtain the novel amine dehydrogenase mutant with high stability.
3. The amine dehydrogenase mutant with improved thermal stability provided by the invention has excellent stereoselectivity, regioselectivity and catalytic activity when being applied to catalytic synthesis of chiral amine, and has a good application prospect.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.
FIG. 1 is a schematic diagram of a simulated crystal structure of the ANDD-TDO protein and a schematic diagram of distribution of mutation sites on the crystal structure, provided in example 2 of the present invention.
Detailed Description
In order to facilitate understanding of the objects, technical solutions and gist of the present invention, embodiments of the present invention will be described in further detail below. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, this embodiment is provided so that this disclosure will be thorough and complete and will fully convey the concept of the invention to those skilled in the art, and the present invention will only be defined by the appended claims.
Example 1
The embodiment provides an amine dehydrogenase mutant with improved thermal stability, wherein the amine dehydrogenase is a wild-type amine dehydrogenase derived from Thermosedimicactor oceani and is named as ANDD-TDO protein, the nucleic acid sequence of the ANDD-TDO protein is SEQ ID No.1, and the amino acid sequence of the ANDD-TDO protein is SEQ ID No. 2.
The amine dehydrogenase mutants with improved thermostability provided by the embodiment comprise: the amino acid sequence shown in SEQ ID NO.2 is substituted, deleted or added with one or more amino acids to form a derivative protein with the same function as the amino acid sequence shown in SEQ ID NO.2 (namely ANDD-TDO protein), or the amino acid sequence shown in SEQ ID NO.2 is substituted, deleted or added with one or more amino acids to form a derivative protein with at least 90 percent of homology with the amino acid sequence shown in SEQ ID NO.2 (namely ANDD-TDO protein).
Specifically, a certain site is selected from the amino acid sequence shown in SEQ ID No.2 for single-point mutation to obtain 5 amine dehydrogenase single-point mutants, wherein the mutation sites are as follows: A35D, S41V, L53R, S210A and T321P, and the 5 amine dehydrogenase single-point mutants are subjected to activity measurement to screen 4 amine dehydrogenase mutants with improved heat stability, wherein the mutation sites are as follows: A35D, L53R, S210A and T321P, wherein the amino acid sequences are SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 respectively.
Or selecting a plurality of mutation sites from the amino acid sequence shown in SEQ ID NO.2 for combination, for example, selecting 2 mutation sites from the 4 mutation sites for combination, and obtaining the following 6 amine dehydrogenase mutants with improved thermal stability respectively, wherein the combined mutation sites are as follows: A35D/L53R, A35D/S210A, A35D/T321P, L53R/S210A, L53R/T321P and S210A/T321P, and the amino acid sequences are SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO.12 respectively.
If 3 mutation sites are selected from the 5 mutation sites for combination, 4 amine dehydrogenase mutants with improved thermostability are respectively obtained, and the combined mutation sites are as follows: A35D/L53R/S210A, A35D/L53R/T321P, A35D/S210A/T321P and L53R/S210A/T321P, and the amino acid sequences are SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO.16 respectively.
For example, 4 mutation sites are selected from the 4 mutation sites and combined to obtain 1 amine dehydrogenase mutant with improved thermostability, and the combined mutation sites are: A35D/L53R/S210A/T321P, and the amino acid sequence thereof is SEQ ID NO. 17.
Example 2
The embodiment provides a method for constructing an amine dehydrogenase mutant with improved thermostability, which comprises the following steps:
1. cloning of wild-type amine dehydrogenase ANDD-TDO Gene
Carrying out codon optimization on a wild type amine dehydrogenase gene by taking escherichia coli as a host cell to obtain an optimized ANDD-TDO gene, wherein the nucleic acid sequence of the optimized ANDD-TDO gene is SEQ ID NO.1, and the expressed amino acid sequence of the optimized ANDD-TDO gene is SEQ ID NO. 2; using SEQ ID NO.1 as a target gene, and adopting an upstream amplification primer SEQ ID NO.18 and a downstream amplification primer SEQ ID NO.19 to amplify the target gene;
the nucleic acid sequence of SEQ ID NO.18 is:
5’-ACTGCTCATATGGAAAAAATCCGTGTTATCATC-3' (wherein the restriction enzyme NdeI recognition site is underlined);
the nucleic acid sequence of SEQ ID NO.19 is:
5’-TCAGCTCTCGAGTTAAGCGTTGTTAACACCG-3' (wherein the restriction enzyme XhoI recognition site is underlined).
The amplification conditions were: amplification was carried out at 95 ℃ for 2min, followed by amplification at 56 ℃ for 20sec, at 72 ℃ for 90sec for 30 cycles, and finally at 72 ℃ for 10 min.
After the reaction is finished, detecting the PCR amplification product by 1.5% agarose gel electrophoresis to obtain a 1.0kb band, wherein the length of the band accords with an expected result. Recovering and purifying the target fragment according to the standard operation of a kit, carrying out double digestion on the target fragment and a pET28a plasmid by using restriction endonucleases XhoI and NdeI, then adopting T4 DNA ligase to carry out ligation, transforming the obtained ligation product into escherichia coli BL21(DE3) competent cells, coating the transformed cells on an LB plate containing 50 mu g/ml kanamycin, extracting positive clone plasmids, and carrying out sequencing, wherein the result shows that the cloned amine dehydrogenase ANDD-TDO gene has correct sequence and is correctly accessed into the pET28a plasmid, so as to obtain a recombinant plasmid pET28 a-ANDD-TDO;
wherein, the wild-type amine dehydrogenase is derived from Thermosediinibacter oceani;
the ANDD-TDO gene is provided by Jinzhi Biotechnology, Inc., Suzhou;
the PCR amplification enzyme is KOD high-fidelity polymerase provided by Toyo Boseki.
2. Expression and purification of ANDD-TDO protein
Inoculating the engineering bacteria in the glycerin pipe into a 4mL LB culture medium test tube containing 100 mu g/mL Kan according to the volume ratio of 1%, and culturing for 12h at 37 ℃ and 220 rpm; transferring 4mL of the bacterial liquid into a shake flask containing 1L LB culture medium containing 50 mu g/mL Kan, culturing at 37 ℃ and 220rpm for 2.5h to make OD600 about 0.9, adding 0.1mM IPTG inducer, and performing induction culture at 25 ℃ and 200rpm for 14 h. Carrying out ultrasonic crushing on the escherichia coli thallus suspension obtained after fermentation, and carrying out one-step Ni-NTA affinity chromatography treatment to obtain the ANDD-TDO protein with the purity of more than 95%, wherein the amino acid sequence is SEQ ID No. 2.
3. Multiple sequence alignment and Consensus analysis of ANDD-TDO homologous proteins
3.1. Entering a Pfam database homepage (http:// Pfam. xfam. org /), inputting an amino acid SEQUENCE of ANDD-TDO in a SEQUENCE SEARCH tool for searching, directly feeding back an alignment result of the amino acid SEQUENCE of the whole family of the protein by a server, displaying the abundance of various amino acids of each mutation site in a bar graph mode, and automatically generating a consensus SEQUENCE of the protein family by the website;
3.2. inputting an amino acid sequence shown by SEQ ID NO.2 into an NCBI protein database and a Pfam database, finding out all protein sequences with the consistency of more than 30 percent with an amino acid sequence (SEQ ID NO. 2) of the ANDD-TDO protein by using a Blast tool, deleting the repeated identical sequences in the protein sequences, arranging the rest amino acid sequences into a fasta format, inputting Clustalx1.83 software for multi-sequence comparison, and outputting comparison results in an aln, dnd and fasta format, wherein the dnd file is an evolutionary tree file, and the aln and fasta files are sequence files with different forms;
uploading the fasta. file to a Consensus Maker v2.0.0 (http:// www.hiv.lanl.gov/content/sequence/CONSENSUS/Consensus. html) server, and after setting parameters are modified as required, generating a Consensus sequence which can be edited later by the online software.
3.3. The amino acid sequence of the ANDD-TDO protein (SEQ ID NO. 2) was compared to the consensus sequence of the family and to the amino acid abundance map at each site.
Simulation of three-dimensional structure of ANDD-TDO protein and selection of mutational hot spots
4.1. The prediction of the three-dimensional structure of the ANDD-TDO protein (amino acid sequence SEQ ID NO. 2) is obtained through swissmodel online tool pair;
4.2. PyMOL is used for observing the crystal structure of the ANDD-TDO protein (amino acid sequence SEQ ID NO. 2), the mutation site to be selected and the mutation form are reexamined according to the structural information, and the mutant site which is most likely to improve the heat stability of the ANDD-TDO protein is screened out under the following screening conditions:
(1) the standard for judging a certain locus as a candidate locus is as follows:
① most proteins of this family have a high overall amino acid abundance at this site;
② the amino acids at this position are conserved;
③ the amino acid with higher frequency of appearance at the site has larger difference of physicochemical properties, such as charge difference, polarity intensity, steric hindrance and the like, with the amino acid of the ANDD-TDO protein at the site.
(2) Amino acid residues near the active center, i.e., within 10 Å from the catalytic residue (glutamic acid at position 104), are removed, and amino acid residues in an embedded or semi-embedded state are removed.
After the two-step screening, 28 different sites are remained, most of which are located on the surface of the ANDD-TDO protein molecule, and the mutation sites are indicated by arrows as shown in FIG. 1.
(3) And (3) according to the crystal structure of the ANDD-TDO protein, analyzing the 28 mutation forms in detail one by one, and screening out mutants capable of improving the heat stability of the ANDD-TDO protein.
The main judgment criteria are that ① mutant should eliminate the original action form which is not beneficial to thermal stability, such as electrostatic repulsion, charge aggregation, etc., ② mutant should not destroy the existing action form which is beneficial to thermal stability and stable protein structure, and ③ mutant should introduce a new action form which is beneficial to thermal stability, such as hydrogen bond, salt bridge, hydrophobic interaction, etc.
Totally designing 5 single-point mutants, wherein the mutation sites are respectively as follows:
A35D、S41V、L53R、S210A、T321P；
and (3) carrying out activity determination on the 5 amine dehydrogenase single-point mutants, and screening 4 amine dehydrogenase mutants with improved heat stability, wherein the mutation sites are as follows: the amino acid sequences of the single-point mutants corresponding to A35D, L53R, S210A and T321P are SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 respectively.
5. Construction, expression and purification of mutants
5.1. Construction of ANDD-TDO protein single-point mutant
Taking the recombinant plasmid pET28a-ANDD-TDO in the step 1 as a template, taking a pair of complementary oligonucleotides with mutation sites as amplification primers, and carrying out whole plasmid PCR amplification by using KOD high fidelity enzyme to obtain a recombinant plasmid with a specific mutation site;
the amplification primer pairs used were:
(1) the nucleic acid sequences of the upstream amplification primer SEQ ID NO.20 and the downstream amplification primer SEQ ID NO.21 of mutation site A35D are as follows:
SEQ ID NO.20：
5' -GAAATCGTTGGTGCTATCGACTCTCGTCCGGAAAAATCT- 3'；
SEQ ID NO.21：
5'- AGATTTTTCCGGACGAGAGTCGATAGCACCAACGATTTC -3'；
(2) the nucleic acid sequences of the upstream amplification primer SEQ ID NO.22 and the downstream amplification primer SEQ ID NO.23 of mutation site L53R are as follows:
SEQ ID NO.22：
5' -GAAGTTCTGGACCTGGGTCGTAAAACCGGTGTTACCATC -3'；
SEQ ID NO.23：
5' -GATGGTAACACCGGTTTTACGACCCAGGTCCAGAACTTC -3'；
(3) the nucleic acid sequences of the upstream amplification primer SEQ ID NO.24 and the downstream amplification primer SEQ ID NO.25 of mutation site S210A are as follows:
SEQ ID NO.24：
5' -GAATCTATCTCTCTGATCGCTGAAGCTCTGGGTCTGGAA -3'；
SEQ ID NO.25：
5' -TTCCAGACCCAGAGCTTCAGCGATCAGAGAGATAGATTC -3'；
(4) the nucleic acid sequences of the upstream amplification primer SEQ ID NO.26 and the downstream amplification primer SEQ ID NO.27 of the mutation site T321P are as follows:
SEQ ID NO.26：
5' -AAAGTTATCTCTGCTAACCCTGGTCTGGTTACCATGAAA -3'；
SEQ ID NO.27：
5' -TTTCATGGTAACCAGACCAGGGTTAGCAGAGATAACTTT -3'；
the amplification conditions were: amplifying at 95 ℃ for 2min, then at 56 ℃ for 20sec, at 72 ℃ for 90sec for 30 cycles, and finally at 72 ℃ for 10 min; recovering PCR amplification products by glue, digesting the glue recovery products for 2h at 37 ℃ by using DpnI enzyme, and degrading the initial template; transforming the digestion product into escherichia coli BL21(DE3) competent cells, coating the competent cells on an LB agar plate containing 50 mu g/mL kanamycin, carrying out overnight culture at 37 ℃, screening positive clones, and carrying out sequencing verification to obtain a recombinant bacterium containing the amine dehydrogenase single-point mutant;
wherein the KOD Hi-Fi enzyme is provided by Takara;
the DpnI enzyme is supplied by Fermentas.
5.2. Construction of ANDD-TDO protein combination mutant
And (2) accumulating and combining the single-point mutants with improved stability by using a construction method similar to the single-point mutants, selecting a plurality of mutation sites for combination in an amino acid sequence shown in SEQ ID NO.2, and selecting 2-4 mutation sites from the 4 mutation sites for combination to respectively obtain different amine dehydrogenase combined mutants:
(1) 2 mutation sites are selected for combination, 6 amine dehydrogenase mutant amine dehydrogenase combined mutants with improved heat stability can be constructed, and the combined mutation sites are respectively as follows:
A35D/L53R、A35D/S210A、A35D/T321P、L53R/S210A、L53R/T321P、S210A/T321P，
the amino acid sequences of the 6 amine dehydrogenase combined mutants with improved thermal stability are respectively SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11 and SEQ ID NO. 12;
(2) selecting 3 mutation sites for combination, 4 amine dehydrogenase combined mutants with improved thermal stability can be constructed, wherein the combined mutation sites are respectively as follows:
A35D/L53R/S210A、A35D/L53R/T321P、A35D/S210A/T321P、L53R/S210A/T321P，
the amino acid sequences of the 4 amine dehydrogenase combined mutants with improved thermal stability are respectively SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO. 16;
(3) 4 mutation sites are selected for combination, 1 amine dehydrogenase combined mutant with improved heat stability can be constructed, and the combined mutation sites are respectively:
A35D/L53R/S210A/T321P，
the amino acid sequence of the 1 amine dehydrogenase combined mutant with improved heat stability is SEQ ID NO. 17.
Example 3
This example provides a gene encoding an amine dehydrogenase mutant with improved thermostability as described in example 1:
(1) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D is SEQ ID NO. 28;
(2) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of L53R is SEQ ID NO. 29;
(3) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of S210A is SEQ ID NO. 30;
(4) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of T321P is SEQ ID NO. 31;
(5) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D/L53R is SEQ ID NO. 32;
(6) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D/S210A is SEQ ID NO. 33;
(7) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D/T321P is SEQ ID NO. 34;
(8) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of L53R/S210A is SEQ ID NO. 35;
(9) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of L53R/T321P is SEQ ID NO. 36;
(10) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of S210A/T321P is SEQ ID NO. 37;
(11) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D/L53R/S210A is SEQ ID NO. 38;
(12) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D/L53R/T321P is SEQ ID NO. 39;
(13) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D/S210A/T321P is SEQ ID NO. 40;
(14) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of L53R/S210A/T321P is SEQ ID NO. 41;
(15) the nucleic acid sequence of the amine dehydrogenase mutant with the mutation site of A35D/L53R/S210A/T321P is SEQ ID NO. 42.
Test example 1
1. Characterization of enzymatic Properties of amine dehydrogenase mutants
The wild-type amine dehydrogenase and various amine dehydrogenase mutants provided in example 2 were subjected to a thermostability test according to a conventional amine dehydrogenase activity assay (see the literature, cat. sci. technol. 2016:10.1039.C6CY 01625A), specifically:
incubating the enzyme solution at a certain temperature, sampling at different treatment times, determining the residual activity percentage of the amine dehydrogenase or the amine dehydrogenase mutant, and plotting the ln value of the residual activity percentage to the time t (min), wherein the slope of a straight line is an inactivation constant acto, and the half life of the wild-type amine dehydrogenase or the amine dehydrogenase mutant at the temperature is obtained from t1/2= ln 2/acto.
The experimental result shows that the thermal stability of 4 single-point mutants and 11 combined mutants in the above amine dehydrogenase mutants is obviously improved, as shown in table 1:
TABLE 1 characterization of the enzymatic Properties of wild-type amine dehydrogenase, Single-site mutants and combination mutants
ANDD-TDO Half life (min) at 42 DEG C
Wild type 8
A35D 10
L53R 17
S210A 23
T321P 19
A35D/L53R 25
A35D/S210A 27
A35D/T321P 29
L53R/S210A 25
L53R/T321P 31
S210A/T321P 32
A35D/L53R/S210A 40
A35D/L53R/T321P 33
A35D/S210A/T321P 35
L53R/S210A/T321P 37
A35D/L53R/S210A/T321P 38
As shown in Table 1, the amine dehydrogenase mutants provided by the invention comprise single-point mutants and combined mutants, and compared with wild-type amine dehydrogenase, the single-point mutants and the combined mutants have longer half-lives at 42 ℃; in particular, the combination mutant showed a superimposed effect of thermal stability of the single-point mutant, with a half-life of approximately 5 times that of the wild-type deaminase. Based on the above, the amine dehydrogenase mutant provided by the invention has better thermal stability and is suitable for catalytic synthesis of chiral amine at higher temperature.
It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications therefrom are within the scope of the invention.
Sequence listing
<110> institute of biomedical engineering technology of Suzhou, China academy of sciences
<120> amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof
<160>42
<170>SIPOSequenceListing 1.0
<210>1
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>1
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>2
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>2
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile LeuGln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp GluPhe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val AsnAsn Ala
340 345 350
<210>3
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>3
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>4
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>4
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>5
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>5
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>6
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>6
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>7
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>7
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro IleVal Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>8
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>8
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>9
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>9
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu AlaAla Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu ThrGly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>10
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>10
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>11
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>11
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly ThrThr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala AlaLeu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>12
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>12
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>13
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>13
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Thr Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>14
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>14
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ser Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>15
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>15
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Leu Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>16
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>16
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Ala Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145 150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305 310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>17
<211>350
<212>PRT
<213> Artificial Synthesis (artificial seqference)
<400>17
Met Glu Lys Ile Arg Val Ile Ile Trp Gly Leu Gly Ala Met Gly Gly
1 5 10 15
Gly Met Ala Arg Met Ile Leu Gln Lys Lys Gly Met Glu Ile Val Gly
20 25 30
Ala Ile Asp Ser Arg Pro Glu Lys Ser Gly Lys Asp Leu Gly Glu Val
35 40 45
Leu Asp Leu Gly Arg Lys Thr Gly Val Thr Ile Ser Cys Asp Pro Glu
50 55 60
Thr Val Leu Lys Gln Pro Ala Asp Ile Val Leu Leu Ala Thr Ser Ser
65 70 75 80
Phe Thr Arg Glu Val Tyr Pro Gln Leu Gln Arg Ile Ile Ala Ser Gly
85 90 95
Lys Asn Val Ile Thr Ile Ala Glu Glu Met Ala Tyr Pro Ala Tyr Arg
100 105 110
Glu Pro Glu Leu Ala Ala Lys Ile Asp Lys Met Ala Lys Asp His Gly
115 120 125
Val Thr Val Leu Gly Thr Gly Ile Asn Pro Gly Phe Val Leu Asp Thr
130 135 140
Leu Ile Ile Ala Leu Ser Gly Val Cys Met Asp Ile Lys Lys Ile Thr
145150 155 160
Ala Arg Arg Ile Asn Asp Leu Ser Pro Phe Gly Thr Thr Val Met Arg
165 170 175
Thr Gln Gly Val Gly Thr Thr Val Asp Glu Phe Arg Lys Gly Leu Glu
180 185 190
Glu Gly Thr Ile Val Gly His Ile Gly Phe Pro Glu Ser Ile Ser Leu
195 200 205
Ile Ala Glu Ala Leu Gly Leu Glu Ile Asp Glu Ile Arg Glu Met Arg
210 215 220
Glu Pro Ile Val Ser Asn Val Tyr Arg Glu Thr Pro Tyr Ala Arg Val
225 230 235 240
Glu Pro Gly Met Val Ala Gly Cys Lys His Thr Gly Ile Gly Tyr Arg
245 250 255
Lys Gly Glu Pro Val Ile Val Leu Glu His Pro Gln Gln Ile Arg Pro
260 265 270
Glu Leu Glu Asp Val Glu Thr Gly Asp Tyr Ile Glu Ile Glu Gly Thr
275 280 285
Pro Asn Ile Lys Leu Ser Ile Lys Pro Glu Ile Pro Gly Gly Ile Gly
290 295 300
Thr Ile Ala Ile Ala Val Asn Met Ile Pro Lys Val Ile Ser Ala Asn
305310 315 320
Pro Gly Leu Val Thr Met Lys Asp Leu Pro Val Pro Ala Ala Leu Met
325 330 335
Gly Asp Ile Arg Lys Leu Ala Lys Asp Gly Val Asn Asn Ala
340 345 350
<210>18
<211>33
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>18
actgctcata tggaaaaaat ccgtgttatc atc 33
<210>19
<211>31
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>19
tcagctctcg agttaagcgt tgttaacacc g 31
<210>20
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>20
gaaatcgttg gtgctatcga ctctcgtccg gaaaaatct 39
<210>21
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>21
agatttttcc ggacgagagt cgatagcacc aacgatttc 39
<210>22
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>22
gaagttctgg acctgggtcg taaaaccggt gttaccatc 39
<210>23
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>23
gatggtaaca ccggttttac gacccaggtc cagaacttc 39
<210>24
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>24
gaatctatct ctctgatcgc tgaagctctg ggtctggaa 39
<210>25
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>25
ttccagaccc agagcttcag cgatcagaga gatagattc 39
<210>26
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>26
aaagttatct ctgctaaccc tggtctggtt accatgaaa 39
<210>27
<211>39
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>27
tttcatggta accagaccag ggttagcaga gataacttt 39
<210>28
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>28
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgtatcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>29
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>29
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>30
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>30
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>31
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>31
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccggttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>32
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>32
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>33
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>33
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>34
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>34
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>35
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>35
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>36
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>36
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>37
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>37
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>38
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>38
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
accggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>39
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>39
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatctct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>40
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>40
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtctga aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>41
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>41
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgcttctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgttaccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053
<210>42
<211>1053
<212>DNA
<213> Artificial Synthesis (artificial seqference)
<400>42
atggaaaaaa tccgtgttat catctggggt ctgggtgcta tgggtggtgg tatggctcgt 60
atgatcctgc agaaaaaagg tatggaaatc gttggtgcta tcgattctcg tccggaaaaa 120
tctggtaaag acctgggtga agttctggac ctgggtcgta aaaccggtgt taccatctct 180
tgcgacccgg aaaccgttct gaaacagccg gctgacatcg ttctgctggc tacctcttct 240
ttcacccgtg aagtttaccc gcagctgcag cgtatcatcg cttctggtaa aaacgttatc 300
accatcgctg aagaaatggc ttacccggct taccgtgaac cggaactggc tgctaaaatc 360
gacaaaatgg ctaaagacca cggtgttacc gttctgggta ccggtatcaa cccgggtttc 420
gttctggaca ccctgatcat cgctctgtct ggtgtttgca tggacatcaa aaaaatcacc 480
gctcgtcgta tcaacgacct gtctccgttc ggtaccaccg ttatgcgtac ccagggtgtt 540
ggtaccaccg ttgacgaatt ccgtaaaggt ctggaagaag gtaccatcgt tggtcacatc 600
ggtttcccgg aatctatctc tctgatcgct gaagctctgg gtctggaaat cgacgaaatc 660
cgtgaaatgc gtgaaccgat cgtttctaac gtttaccgtg aaaccccgta cgctcgtgtt 720
gaaccgggta tggttgctgg ttgcaaacac accggtatcg gttaccgtaa aggtgaaccg 780
gttatcgttc tggaacaccc gcagcagatc cgtccggaac tggaagacgt tgaaaccggt 840
gactacatcg aaatcgaagg taccccgaac atcaaactgt ctatcaaacc ggaaatcccg 900
ggtggtatcg gtaccatcgc tatcgctgtt aacatgatcc cgaaagttat ctctgctaac 960
cctggtctgg ttaccatgaa agacctgccg gttccggctg ctctgatggg tgacatccgt 1020
aaactggcta aagacggtgt taacaacgct taa 1053

Claims (9)

1. An amine dehydrogenase mutant having improved thermostability,
the amine dehydrogenase mutant is mutated on an amino acid sequence shown in SEQ ID NO.2, and the mutation site is selected from one or more of A35D, L53R, S210A and T321P.
2. The amine dehydrogenase mutant with improved thermostability according to claim 1, wherein the mutation sites are a35D, L53R, S210A, T321P, a35D/L53R, a35D/S210A, a35D/T321P, L53R/S210A, L53R/T321P, S210A/T321P, a35D/L53R/S210A, a35D/L53R/T321P, a35D/S210A/T321P, L53R/S210A/T321P or a 35D/L53R/S210A/T321P.
3. A gene encoding the thermostable amine dehydrogenase mutant as claimed in claim 1 or 2.
4.A recombinant plasmid comprising the gene of claim 3.
5. A soluble protein, immobilized enzyme or engineered bacterium comprising the improved thermostability amine dehydrogenase mutant according to claim 1 or 2.
6. The method for constructing an amine dehydrogenase mutant having improved thermostability according to claim 1 or 2, comprising the steps of:
searching an amino acid sequence shown by SEQ ID NO.2 in a Pfam database and an NCBI database, removing a repeated identical sequence, selecting an amino acid sequence with the consistency of more than 30% with the amino acid sequence shown by SEQ ID NO.2, then performing multi-sequence comparison through Clusalx1.83 software, arranging the residual amino acid sequence into a fasta file, uploading the fasta file to a Consensus Maker v2.0.0 server, and modifying setting parameters according to needs, wherein the online software generates a Consensus sequence which can be edited at a later stage;
predicting the three-dimensional structure of the obtained protein shown by SEQ ID NO.2 by a swisscodel online tool, observing the crystal structure of the protein shown by SEQ ID NO.2 by adopting PyMOL, and screening out mutation sites related to thermal stability as follows: a35D, L53R, S210A, T321P.
7. The method of constructing an amine dehydrogenase mutant having improved thermostability according to claim 6,
the sequences of the amplification primers of the mutation site A35D are SEQ ID NO.20 and SEQ ID NO. 21;
the sequences of the amplification primers of the mutation site L53R are SEQ ID NO.22 and SEQ ID NO. 23;
the sequences of the amplification primers of the mutation site S210A are SEQ ID NO.24 and SEQ ID NO. 25;
the sequences of the amplification primers of the mutation site T321P are SEQ ID NO.26 and SEQ ID NO. 27.
8. The method of constructing an amine dehydrogenase mutant having improved thermostability according to claim 7,
the amino acid sequence of the single-point mutant corresponding to A35D is SEQ ID NO. 3;
the amino acid sequence of the single-point mutant corresponding to the L53R is SEQ ID NO. 4;
the amino acid sequence of the single-point mutant corresponding to S210A is SEQ ID NO. 5;
the amino acid sequence of the single-point mutant corresponding to the T321P is SEQ ID NO. 6;
the amino acid sequence of the combined mutant corresponding to A35D/L53R is SEQ ID NO. 7;
the amino acid sequence of the combined mutant corresponding to A35D/S210A is SEQ ID NO. 8;
the amino acid sequence of the combined mutant corresponding to A35D/T321P is SEQ ID NO. 9;
the amino acid sequence of the combined mutant corresponding to L53R/S210A is SEQ ID NO. 10;
the amino acid sequence of the combined mutant corresponding to L53R/T321P is SEQ ID NO. 11;
the amino acid sequence of the combined mutant corresponding to S210A/T321P is SEQ ID NO. 12;
the amino acid sequence of the combined mutant corresponding to A35D/L53R/S210A is SEQ ID NO. 13;
the amino acid sequence of the combined mutant corresponding to A35D/L53R/T321P is SEQ ID NO. 14;
the amino acid sequence of the combined mutant corresponding to A35D/S210A/T321P is SEQ ID NO. 15;
the amino acid sequence of the combined mutant corresponding to L53R/S210A/T321P is SEQ ID NO. 16;
the amino acid sequence of the combined mutant corresponding to A35D/L53R/S210A/T321P is SEQ ID NO. 17.
9. Use of the improved thermostability amine dehydrogenase mutant according to claim 1 or 2 in the catalytic synthesis of a chiral amine.
CN202010034188.7A 2020-01-14 2020-01-14 Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof Active CN110846291B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010034188.7A CN110846291B (en) 2020-01-14 2020-01-14 Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010034188.7A CN110846291B (en) 2020-01-14 2020-01-14 Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof

Publications (2)

Publication Number Publication Date
CN110846291A true CN110846291A (en) 2020-02-28
CN110846291B CN110846291B (en) 2020-04-07

Family

ID=69610662

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010034188.7A Active CN110846291B (en) 2020-01-14 2020-01-14 Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof

Country Status (1)

Country Link
CN (1) CN110846291B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112301014A (en) * 2020-11-04 2021-02-02 上海绅道生物科技有限公司 Esterase mutant with improved thermal stability and application thereof
CN113846069A (en) * 2021-10-28 2021-12-28 华东理工大学 Amphetamine dehydrogenase mutant and application thereof in chiral amine synthesis
CN114438049A (en) * 2022-03-07 2022-05-06 河北工业大学 Amine dehydrogenase and coding nucleic acid and application thereof
CN114686451A (en) * 2022-02-28 2022-07-01 华东理工大学 Amine dehydrogenase mutant and application thereof in preparation of (S) -5-methyl-2-pyrrolidone

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011100265A3 (en) * 2010-02-10 2011-12-29 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
CN109022381A (en) * 2018-08-17 2018-12-18 凯莱英生命科学技术(天津)有限公司 Amino acid dehydrogenase mutant and its application
CN109609474A (en) * 2018-12-28 2019-04-12 浙江工业大学 A kind of amino acid dehydrogenase mutant and its application in synthesis L-glufosinate-ammonium

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011100265A3 (en) * 2010-02-10 2011-12-29 Codexis, Inc. Processes using amino acid dehydrogenases and ketoreductase-based cofactor regenerating system
CN109022381A (en) * 2018-08-17 2018-12-18 凯莱英生命科学技术(天津)有限公司 Amino acid dehydrogenase mutant and its application
CN109609474A (en) * 2018-12-28 2019-04-12 浙江工业大学 A kind of amino acid dehydrogenase mutant and its application in synthesis L-glufosinate-ammonium

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MICHAEL J. ABRAHAMSON: "DEVELOPMENT OF AN AMINE DEHYDROGENASE", 《GEORGIA INSTITUTE OF TECHNOLOGY博士论文》 *
OMBELINE MAYOL等: "Asymmetric reductive amination by a wild-type amine dehydrogenase from the thermophilic bacteria Petrotoga mobilis", 《CATALYSIS SCIENCE & TECHNOLOGY》 *
谢东芳等: "删除 Loop 区域表面不稳定氨基酸提高 (R)-ω-转氨", 《生物工程学报》 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112301014A (en) * 2020-11-04 2021-02-02 上海绅道生物科技有限公司 Esterase mutant with improved thermal stability and application thereof
CN113846069A (en) * 2021-10-28 2021-12-28 华东理工大学 Amphetamine dehydrogenase mutant and application thereof in chiral amine synthesis
CN114686451A (en) * 2022-02-28 2022-07-01 华东理工大学 Amine dehydrogenase mutant and application thereof in preparation of (S) -5-methyl-2-pyrrolidone
CN114686451B (en) * 2022-02-28 2024-03-08 华东理工大学 Amine dehydrogenase mutant and application thereof in preparation of (S) -5-methyl-2-pyrrolidone
CN114438049A (en) * 2022-03-07 2022-05-06 河北工业大学 Amine dehydrogenase and coding nucleic acid and application thereof
CN114438049B (en) * 2022-03-07 2023-09-15 河北工业大学 Amine dehydrogenase and encoding nucleic acid and application thereof

Also Published As

Publication number Publication date
CN110846291B (en) 2020-04-07

Similar Documents

Publication Publication Date Title
CN110846291B (en) Amine dehydrogenase mutant with improved thermal stability and construction and application of genetically engineered bacterium thereof
CN110982801B (en) Transaminase mutant and construction method and application thereof
CN108728421B (en) Carbonyl reductase mutant and application thereof
CN112877307B (en) Amino acid dehydrogenase mutant and application thereof
CN113801858B (en) Dehydrogenase mutant L283V/L286V and preparation method and application thereof
CN111073871B (en) DNA polymerase mutant with improved thermal stability as well as construction method and application thereof
CN112359032B (en) Mutant esterase and application thereof, recombinant vector and preparation method and application thereof, recombinant engineering bacteria and application thereof
CN114790452B (en) Nitrile hydratase mutant with high stability to nitrile compounds
CN113249349B (en) Mutant alcohol dehydrogenase, recombinant vector, preparation method and application thereof
CN112301014B (en) Esterase mutant with improved thermal stability and application thereof
CN108034646B (en) PvEH3 mutant with improved catalytic activity and improved enantiotropic normalization
CN112626044B (en) Mutant and construction method and application thereof
CN112481320B (en) Method for preparing (-) gamma-lactam with high catalytic efficiency
CN114250206B (en) Methyltransferase mutant, recombinant vector, recombinant engineering bacterium and application thereof
CN112646791B (en) Mutant and construction method and application thereof
CN116574709A (en) DNA polymerase BstX mutant and construction method and application thereof
CN116590254A (en) DNA polymerase mutant and construction method and application thereof
CN116694596A (en) DNA polymerase BstX mutant with improved thermal stability, construction method and application thereof
CN112899255B (en) DNA polymerase and application thereof, recombinant vector and preparation method and application thereof, recombinant engineering bacteria and application thereof
CN114369587B (en) Vaccinia virus capping enzyme mutant, recombinant vector, recombinant engineering bacterium and application thereof
CN113999827B (en) Leucine dehydrogenase mutant and preparation method and application thereof
CN114317485B (en) Recombinant murine leukemia virus reverse transcriptase mutant, preparation method and application
CN114480342A (en) Mutant PET hydrolase, recombinant vector, recombinant engineering bacterium and application thereof
CN114480311A (en) Catechol dioxygenase mutant, recombinant vector, preparation method and application thereof
CN114480345A (en) MazF mutant, recombinant vector, recombinant engineering bacterium and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant