CN110831611A - Methods and compositions for modifying Assembly Activation Protein (AAP) dependency of viruses - Google Patents

Abstract

The present disclosure describes and demonstrates the utility of specific sequence motifs within adeno-associated virus (AAV) capsid proteins that are capable of modifying the Assembly Activation Protein (AAP) dependency of AAV. Thus, the sequence motif can be used to address and mitigate at least one bottleneck encountered in the production of viral vectors. In particular, the present disclosure describes minimal motifs defined by novel phenotypic-phylogenetic mapping methods that can be used to modify the AAP-dependence of viruses.

Description

Methods and compositions for modifying Assembly Activation Protein (AAP) dependency of viruses

Cross Reference to Related Applications

Priority of us application No. 62/504,318 filed 2017, month 5 and 10 and us application No. 62/669,901 filed 2018, month 5 and 10, both of which are incorporated herein by reference in their entirety, are claimed in the present application in accordance with 35u.s.c. 119 (e).

Technical Field

The present disclosure relates generally to viral vector systems.

Background

Adeno-associated virus (AAV) is the dominant platform for therapeutic gene transfer, primarily for in vivo gene therapy approaches. While preclinical and clinical studies continue to demonstrate the potential of AAV as an agent for safe and effective gene delivery to alleviate many diseases, the bottleneck for its broader application is the generation of sufficient amounts of vector to treat these patient populations.

Disclosure of Invention

In general, the present disclosure describes and demonstrates the utility of specific sequence motifs within AAV capsid proteins, which motifs are capable of modifying the Assembly Activation Protein (AAP) dependence of AAV. Thus, the sequence motif can be used to address and mitigate at least one bottleneck encountered in the production of viral vectors. In particular, the present disclosure describes minimal motifs defined by novel phenotypic-phylogenetic mapping methods that can be used to modify the AAP dependence of viruses. Briefly, a number of ancestral AAVs have been developed (see, e.g., WO2015/054653 and WO2017/019994, the entire contents of which are incorporated herein by reference) for checking AAP dependencies across broad structural differences. This analysis allows the identification of the minimal motifs that determine AAP dependence.

In one aspect, the disclosure features an adeno-associated virus (AAV) capsid polypeptide comprising a sequence identical to SEQ id no:3, has at least 95% sequence identity (e.g., at least 99% sequence identity). In some embodiments, the AAV capsid polypeptide has the amino acid sequence of SEQ ID NO: 3. In some embodiments, the AAV capsid polypeptide consists of SEQ ID NO: 4. In some embodiments, the AAV capsid polypeptide has the amino acid sequence of SEQ id no:1, but contains the amino acid residue at the position indicated in table 6 for "independence" or "dependency" relative to AAP.

The disclosure also features viral particles that include any of the adeno-associated virus (AAV) capsid polypeptides described herein. Such viral particles may further comprise a transgene.

In another aspect, the disclosure features a nucleic acid molecule that includes a nucleotide sequence identical to SEQ ID NO:4, and encodes an adeno-associated virus (AAV) capsid polypeptide, and has at least 95% sequence identity (e.g., at least 99% sequence identity). In some embodiments, the nucleic acid molecule has the sequence of SEQ ID NO: 4. In some embodiments, the nucleic acid molecule encodes SEQ ID NO: 3.

The present disclosure also provides vectors comprising any of the nucleic acid molecules described herein, and host cells comprising any of the nucleic acid molecules and/or vectors described herein. In some embodiments, the host cell is a packaging cell.

In another aspect, the disclosure features a packaging cell that includes a nucleic acid molecule encoding an adeno-associated virus (AAV) capsid polypeptide, wherein the AAV capsid polypeptide has a sequence identical to SEQ ID NO:3 has at least 95% sequence identity. In some embodiments, the packaging cell lacks an Assembly Activating Protein (AAP).

In another aspect, the disclosure includes a method of reducing the Assembly Activating Protein (AAP) dependency of an adeno-associated virus (AAV). These methods include providing an AAV having a capsid polypeptide that differs from the capsid polypeptide of SEQ ID NO:3 has at least 95% sequence identity.

In another aspect, the disclosure features a method of at least partially reducing Assembly Activation Protein (AAP) dependency of an adeno-associated virus (AAV), the method comprising: integrating the capsid polypeptide into an AAV that hybridizes to SEQ id no:3 has at least 95% sequence identity.

In yet another aspect, the present disclosure provides a method of engineering an adeno-associated virus (AAV) to reduce its dependence on an Assembly Activating Protein (AAP), comprising: engineering an AAV comprising a capsid polypeptide that differs from the capsid polypeptide of SEQ id no:3 has at least 95% sequence identity.

Any of the methods described herein can further comprise culturing an adeno-associated virus (AAV) in the absence of an Assembly Activating Protein (AAP). Any of the methods described herein can further comprise sequencing the engineered adeno-associated virus (AAV). Any of the methods described herein can further comprise comparing the Assembly Activation Protein (AAP) dependency of an engineered adeno-associated virus (AAV) to a non-engineered or wild-type AAV. Any of the methods described herein can further comprise aligning the engineered adeno-associated virus (AAV) with a non-engineered or wild-type AAV.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods and compositions of matter belong. Suitable methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the methods and compositions of matter. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

Drawings

Figure 1 is a schematic, gel and bar graph of a series of data, showing that the range of requirements for AAP broadly encompasses all clades of AAV. Panel A is a schematic representation of the AAPstop60 and AAP-HA construct maps. Black arrows: transcription start sites at the p5, p19 and p40 viral promoters. Ash ofColor arrow: the translation initiation codon of the cap gene product. Early stop codons (red) were introduced into the AAP ORF by site-directed mutagenesis 60 aa. The HA tag (orange) was inserted into the conserved BsiWI site near the AAP C-terminus. Panel B is a photograph of a gel showing production of AAV1 and AAV3 AAP-HA constructs in both WT AAP and AAPstop60 backgrounds. After 36 hours, lysates were collected from transfected HEK293 cells, clarified by centrifugation, and interrogated for AAP by Western blotting with anti-HA antibodies. FIG. C is a graph showing the quantification of DNase resistant particles by titre determination by qPCR of vectors generated from WT or AAPstop60rep-cap constructs. AAPstop60 titers are reported as a percentage of the titer of each WT serotype and represent the mean ± SEM of at least 3 independent experiments. The bar colors correspond to the heat map colors on the y-axis. For at least one of the tests it was found that,titers were below background levels (no cap gene control). See table 2 for statistics. Panel D is a graph of titers determined by A20 capsid ELISA for vectors produced from the AAPstop60 constructs of WT and AAV2 and AAV3, reported as a percentage of WT titers (mean of two experiments; see Table 1 for separate data for titers determined by ELISA and qPCR). See also fig. 11.

FIG. 2 is a series of gel and experimental data plots showing VP protein levels in native serotypes. HEK293 cells were transfected with helper and rep-cap plasmids as shown in the upper lane: (WT) WT AAP; (s) AAPstop 60; (r) AAPstop60 plus CMV-driven AAP 2. Whole cell lysates were harvested after 36 hours, clarified by centrifugation, and probed for VP levels with B1 antibody (VP 1/2/3). Actin was used as loading control. Each blot of serotypes of the rep-cap plasmid indicated above, (panel A) AAPstop60 titres ≧ 10% WT titres, and (panel B) AAPstop60 titres < 10% WT titres. Panel C is a blot showing RNA quantified from AAV2 transfection as described above, normalized to GAPDH, reported relative to AAV2 WT. Detection of small and large splice isoforms as well as unspliced transcript levels, as shown on the x-axis and in the right panel; the primers are indicated by arrows. The figures represent mean ± SEM of three independent experiments; there were no statistically significant differences between groups (see statistics in table 2). Panel D is a blot of HEK293 cells transfected with helper plasmid and either AAV8 WT or AAPstop60rep-cap plasmid, as shown in lanes above, AAPstop60 transfected cells were treated with varying concentrations of Bortezomib (Bortezomib), MLN7243 or Bafilomycin at 24 hours and incubated for an additional 8 hours before collecting whole cell lysates as in panels (A) and (B). VP levels were interrogated by Western blotting using the B1 antibody (upper). The blot was stripped and ubiquitin was detected again (bottom). Actin was used as loading control (middle). The E panel is a dot blot of lysates from panels D treated with DMSO or 1 μ M bortezomib, MLN7243, or bavaomycin, as listed below, analyzed for the presence of assembled capsids by dot blot with the ADK8 antibody (recognizing conformational epitopes present only in the assembled AAV8 capsids). The experiment was repeated in the presence of AAP to control any effect of the drug on capsid assembly (right panel). See also fig. 8.

Fig. 3 is a series of gels, graphs and schematics representing experimental data showing that the requirement for AAP in the context of putative AAV phylogeny shows branch specificity. Panel a is a graph showing AAPstop60s production for 9 putative ancestral AAV. The vector produced from the WT or AAPstop60rep-cap constructs was titered by qPCR to quantify DNase resistant particles. AAPstop60 titers were reported as a percentage of WT titers for each serotype and represent the mean ± SEM of at least 3 independent experiments. The bar colors correspond to the heat map colors on the y-axis and are also used in (D-panel) and (E-panel). For at least one of the tests it was found that,titers were below background (no cap gene control). See table 2 for statistics. Anc126 consistently produced low titers of WT and AAPstop60 (below 1e9 GC/mL). Panel B is a graph showing the production of AAPstop20s for AAV4 and all AAV variants by introducing an early stop codon at-20 aa into the AAP ORF, with an AAPstop60 titer ≧ 10%. Vector titers were prepared and determined as in panel A, with the addition of AAPstop20 conditions (light grey bars) and AAPstop20 plus CMV driver construct expressing homologous AAP (dark grey bars) (average of two experiments; numbers determined for individual AAPstop60, stop20 and AAP rescue vector titersSee, table 3, accordingly). For at least one of the tests,

titers were below background (no cap gene control).

Rescue was performed with AAP 2. Panel C is a gel of HEK293 cells transfected with helper and rep-cap plasmids, as shown in the upper lane: (WT) WT AAP; (s60) AAPstop 60; (s20) AAPstop 20; (r) AAPstop20 plus CMV-driven homologous AAP. Whole cell lysates were harvested after 36 hours and VP levels were interrogated by Western blot. Tubulin was used as loading control. D is the classification of AAP phenotype. The box below each serotype represents the percentage of AAPstop60 as WT titer. Black boxes indicate AAP-independence (AAPstop20 potency)>>1%). AAPstop60 Titers>10% of the serotypes (green) showed assembly in the absence of the C-terminal two-thirds of AAP (AAPC independent). Panel E is the reconstructed AAV phylogeny, branches as indicated by color in panel D. Grey numbers on the branches indicate the number of different amino acids between the two serotypes flanking the branched segment. See also fig. 8, 9, 10 and 12.

FIG. 4 is a series of schematic, graphical and gel experimental data showing characterization of 82DI, AAPC dependent gain of function mutants. Panel A is a schematic representation of 82DI generated by introducing Branch I residue identity into the Anc82 rep-cap plasmid by site-directed mutagenesis. Panel B is a map of vectors produced by Anc82, 82DI, their AAPstop60s titrated by quantitative DNase Resistant Particles (DRP) and reported as a percentage of Anc82 WT titers. The figures represent the mean ± SEM of four independent experiments. See table 2 for statistics. Panel C is a graph of individual restoration of the identity of each of 82DI and 82 diapstop 60 to its Anc82 by site-directed mutagenesis. The vector titers for the quantification of DRP were reported as a percentage of 82DI WT titers and represent the average of 2 trials (see table 4, data for individual 82DI single recovery vector titer determinations). Panel D is a photograph of a gel of HEK293 cells transfected with helper and rep-cap plasmids, as shown in the upper lane: (WT) a WT AAP; (s60) AAPstop 60; (s20) AAPstop 20; (r) AAPstop20 plus CMV-driven AAP 2. Whole cell lysates were harvested after 36 hours and VP levels were interrogated by Western blot. Tubulin was used as loading control. E plot is the normalization obtained from Anc82 and 82DI

Orange fluorescence signal. The F diagram is 1X 10¹¹Photographs of GFP fluorescence detected in murine livers 30 days after systemic injection of either Anc82, 82DI or AAV8 in vg/mouse. Each image represents a single animal. See also fig. 12 and 13.

FIG. 5 is a series of molecular and atomic level diagrams, indicating that the site of interest is located at the trimer interface, demonstrating stronger monomer-monomer interactions in AAPC-independent serotypes. Panel a is a summary of 10 sites (12 residues) identified by branch D/branch I multiple sequence alignment, numbered starting from the VP1 start codon. Branch D residues include Anc80, Anc81, Anc82, Anc83, Anc84, AAV8, and rh 10; branch I residues include Anc110, rh8, and AAV 9. Changes in the identity of AAV8 and AAV9 are shown in parentheses and are excluded from these members of their respective branches. Panel B is a side view of the AAV9 trimer, showing the plane of view in panel C. Each monomer is represented as a color, and each site of interest is in the darker shade of that color. The numbered arrows indicate each site in the red monomer. Panel D-F is an atomic level view of the selection site in AAV8 and AAV9 trimer.

FIG. 6 is a schematic representation of a series of experimental data and gels demonstrating that AAP promotes VP-VP interactions. Panel A is a schematic representation of the expression constructs for AAP2 and VP1 and VP3 for AAV2, AAV3, Anc82 and 82DI. In CMV-HA-VP1, the VP2 and VP3 start codons were modified to silence their expression, and included the AAPstop60 mutation (red rectangle). Panel B is a photograph of HEK293 cells transfected with serotypes CMV-HA-VP1 and CMV-VP3, +/-CMV-AAP2 shown in each lane above, and lysates collected after 48 hours. Immunoprecipitation using anti-HA antibody; VP was detected by Western blot using B1 antibody. Panel C is a photograph of lysates of HEK293 cells transfected with CMV-HA-VP1, CMV-VP3, +/-CMV-AAP2 (all AAV2 proteins) treated with DMSO, 5mM disuccinimidyl glutarate (DSG) or 5mM disuccinimidyl suberate (DSS) as indicated above. VP was detected by Western blotting using the B1 antibody. Approximate molecular weights are shown to the right of each row. See also fig. 13.

Figure 7 is a schematic model of the early steps of capsid assembly across the AAP phenotype. Whether the serotype is AAP-dependent, AAP-independent, or AAPC-independent, nucleated capsid assembly may depend on the stability and oligomerization of the VP protein. The findings herein demonstrate that AAP is active in both functions. Whether these functions are separated is unclear and is indicated by a question mark in the model.

Figure 8 is a schematic representation of a series of gels showing degradation of AAV8 and AAV3 VP. In connection with fig. 2 and 3. Panel A is a photograph of HEK293 cells transfected with the helper plasmid shown and either AAV8 wt or AAPstop60rep-cap plasmid. At 24 hours, AAPstop60 transfected cells were treated with 50 μ M Cycloheximide (CHX) and lysates were harvested at progressive time points. VP levels were analyzed by Western blot with B1 antibody and p62 blot was used as a positive control for CHX efficacy. For cells transfected with AAV8AAPstop60, the exposures shown were long exposures with more sensitive detection reagents to demonstrate that AAV8VP could not be detected in the absence of AAP. Panel B is a photograph of HEK293 cells transfected with a helper plasmid and AAV3 wt or the indicated AAPstop20 rep-cap plasmid. At 24 hours, AAPstop20 transfected cells were treated with different concentrations of bortezomib, MLN7243 or Bafilomycin as shown in the lanes above and incubated for an additional 8 hours before collection of whole cell lysates. VP levels were interrogated by Western blotting using the B1 antibody (upper). The blot was stripped and ubiquitin was detected again (bottom). Actin was used as loading control (middle).

Figure 9 is a schematic showing AAP conservation among 21 serotypes. In connection with fig. 1, 2, 3, 6 and 7. In this study, a multi-protein sequence alignment (ClustalW) of AAPs of all 21 serotypes was examined. Reconstruction of the ancestral sequence from which an Anc-AAV (and, Anc-AAP) is produced is described in detail elsewhere (Zinn et al, 2015, Cell Rep., 12: 1056-68). Briefly, the VP coding sequence of AncAAV is first determined at the protein level and then reverse translated into DNA for subsequent synthesis using a codon table from the most similar existing AAV sequences available. The previously identified conserved core (black bar) retains the high degree of conservation between Anc-AAP (Naumer et al, 2012, j.virol., 86: 13038-48) and can confer chaperone function as indicated by the AAPN data (purple bar) in this study. The work described herein also points to the scaffold function of AAPs, which may be contained primarily in the C-terminal two thirds of AAPs (AAPC, gray bar).

Fig. 10 is a schematic and graph of a series of experimental data demonstrating that AAV3 AAPN was unable to rescue AAP-dependent virus production. In connection with fig. 3. Panel a is an AAP-only construct generated by adding an early stop codon to the VP1, VP2 and VP3 ORFs of the AAV3 genome, including the AAPstop60 mutation to generate an AAPN-only construct. The VP3 early stop codon is a silent mutation in the AAP ORF. Panel B is a graph (green and red bars) from the constructs used in (a) for trans-complementary AAPstop20 virus production in AAV2 and AAV3, and the virus titers are reported as a percentage of their WT titers. The graph represents the average of two experiments. In at least one of the tests that was carried out,titers were below background (no cap gene control). Panel C shows separate data for two experiments.

Fig. 11 is a series of microscope images and graphs showing experimental data demonstrating that the AAPstop60 virus is indistinguishable from the wt AAP virus. In connection with fig. 1. Panel a is a photograph of AAV3 and aav3aapstop60.cmv.egfp.t2a. luciferase vectors stained with uranyl acetate and imaged by TEM. Panels B and C are the results of incubation of HEK293 cells with hAd5(MOI ═ 20) overnight, followed by addition of AAV3, AAV3AAPstop60, AAV9 or aav9aapstop60.cmv. egfp. t2a luciferase to GC/well as indicated on the x-axis in panel C. At 48 hours, GFP fluorescence was imaged (panel B; image represents the highest titer of each vector). Luciferase activity was quantified at 48 hours (C panels). Panel D is a normalized panel obtained from AAV3 and AAV9 WT and AAPstop60 vectors

Orange fluorescence signal.

Figure 12 is a series of graphs showing experimental data for Anc82 versus Anc82DI in vitro and in vivo as follows. In connection with fig. 4. Panel a HEK293 cells were incubated with hAd5(MOI ═ 20) overnight and then at 1 × 10⁹Or 1x 10⁸GC/well add Anc82 or anc82di.cmv.egfp.t2a.luciferase vector. Luciferase activity was measured after 48 hours. B is 1X 10¹¹Graph of either Anc82, 82DI or aav8.cb7.ci. egfp. ff2a. halat. rbg systemically injected mice human α -1 antitrypsin (hA1AT) levels were measured by ELISA in sera sampled at the time points indicated on the x-axis.

Fig. 13 is a bar graph of a pair of experimental data showing that the IP fraction does not contain fully assembled capsids. In connection with fig. 6. The Rep, helper plasmid, and ITR-CMV-EGFP-T2A-Luc _ ITR reporter genomic plasmid were transfected with the AAV2 protein expression construct shown in the x-axis. The fully assembled vectors in the input, IP and supernatant fractions were quantified by qPCR (panel a) or a20 capsid ELISA on dnase resistant genomes (panel B). The graph represents two independent experiments. At least one measurement is below the detection limit.

Detailed Description

Gene transfer for experimental or therapeutic purposes relies on a vector or vector system to deliver genetic information into a target cell. The vector or vector system is considered to be a major determinant of the efficiency, specificity, host response, pharmacology and longevity of the gene transfer reaction. Currently, the most efficient and effective way to accomplish gene transfer is through the use of vectors or vector systems based on viruses that have been made replication-defective. One of the most common viruses to be made replication-defective and used for gene transfer is adeno-associated virus (AAV).

The AAV capsid is an icosahedral 60 mer of three repeating protein monomer subunits called viral protein 1(VP1), VP2, and VP3, without an envelope. A single transcript expressed from an AAV cap gene containing a nested Open Reading Frame (ORF) is alternatively spliced to produce three different protein products having C-termini that are the same length as VP 3. The 1: 10 stoichiometry of VP 1: VP 2: VP3 in the assembled capsids is believed to be the result of the relative abundance of each protein, which in turn is regulated by the abundance of the splice product and the unconventional ACG translation start codon of VP 2.

Assembly Activating Protein (AAP) is a non-structural protein expressed by the non-canonical CTG initiation codon of the overlapping reading frame embedded in the capsid (cap) gene of AAV. AAV serotypes have different requirements for AAP, with some AAV serotypes exhibiting AAP dependency (e.g., AAV8, rh10, Anc80, Anc81, Anc82, Anc83, and Anc84), while other AAV serotypes exhibit AAP independence (e.g., AAV9, rh8, and Anc 110).

As used herein, an ancestral scaffold sequence refers to a sequence that has been constructed using evolutionary probability and evolutionary modeling, and is not known to have ever existed or exist at present in nature. These scaffold sequences are used herein to interrogate AAP function and to delineate structural determinants within the capsid that are relevant to the viral requirement for AAP.

The present disclosure provides methods of modifying AAP dependency of AAV. For example, AAV capsid sequences can be engineered to include the motifs identified herein, which reduce AAP dependence (or, conversely, increase AAP independence) during packaging of AAV. This provides benefits in a number of production processes, including, but not limited to, the ability to reduce the number of components required for productive particle assembly in any AAV production system (e.g., mammalian, yeast, insect cells), the ability to optimize AAV capsid structure with reduced restrictions imposed by AAP, the ability of AAV capsids to self-assemble from minimal components, and the reduction of AAP contamination issues in final vector preparation.

Adeno-associated virus (AAV) nucleic acid and polypeptide sequences conferring modified AAP-dependency

AAV capsid sequences originally based on the sequence of Anc82 (SEQ ID NO:1, encoded by SEQ ID NO: 2) exhibit AAP-dependence during packaging, which have been modified as described herein to produce Anc82DI (SEQ ID NO:3, encoded by SEQ ID NO: 4). Anc82DI showed AAP independence during packaging, but appeared to retain functionality as a potent gene transfer vector. AAP-dependent sequence motifs that confer AAP-dependent sequences are provided in table 6.

TABLE 6 motifs for modification of AAP-dependence

Anc82 protein(SEQ ID NO：1)

MAADGYLPDWLEDNLSEGIREWWDLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRVLEPLGLVEEGAKTAPGKKRPVEQSPQREPDSSTGIGKKGQQPAKKRLNFGQTGDSESVPDPQPLGEPPAAPSGVGSNTMAAGGGAPMADNNEGADGVGNSSGNWHCDSTWLGDRVITTSTRTWALPTYNNHLYKQISNGTSGGSTNDNTYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTTNEGTKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTAGTQTLQFSQAGPSSMANQAKNWLPGPCYRQQRVSTTTNQNNNSNFAWTGATKYHLNGRDSLVNPGVAMATHKDDEDRFFPSSGVLIFGKQGAGNDNVDYSNVMITSEEEIKTTNPVATEEYGVVATNLQSANTAPQTGTVNSQGALPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQAKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTNVDFAVNTEGVYSEPRPIGTRYLTRNL

Anc82 DNA(SEQ ID NO：2)

ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGACCTGAAACCTGGAGCCCCGAAACCCAAAGCCAACCAGCAAAAGCAGGACGACGGCCGGGGTCTGGTGCTTCCTGGCTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGGGAGCCCGTCAACGCGGCGGACGCAGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAAGCGGGTGACAATCCGTACCTGCGGTATAATCACGCCGACGCCGAGTTTCAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGGCCGGTAGAGCAGTCACCACAGCGTGAGCCCGACTCCTCCACGGGCATCGGCAAGAAAGGCCAGCAGCCCGCCAAAAAGAGACTCAATTTCGGTCAGACTGGCGACTCAGAGTCAGTCCCCGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGATCTAATACAATGGCTGCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGTGCCGACGGAGTGGGTAATTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACCTCGGGAGGCAGCACCAACGACAACACCTACTTTGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAACTTCAAGCTCTTCAACATCCAGGTCAAAGAGGTCACGACGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCGTCCAGGTGTTTACGGACTCGGAATACCAGCTGCCGTACGTCCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTCTTCATGATTCCTCAGTACGGCTACCTGACTCTCAACAACGGTAGTCAGGCCGTGGGACGTTCCTCCTTCTACTGCCTGGAGTACTTCCCCTCTCAGATGCTGAGAACGGGCAACAACTTTCAATTCAGCTACACTTTCGAGGACGTGCCTTTCCACAGCAGCTACGCGCACAGCCAGAGTTTGGACAGGCTGATGAATCCTCTCATCGACCAGTACCTGTACTACCTGTCAAGAACCCAGACTACGGGAGGCACAGCGGGAACCCAGACGTTGCAGTTTTCTCAGGCCGGGCCTAGCAGCATGGCGAATCAGGCCAAAAACTGGCTGCCTGGACCCTGCTACAGACAGCAGCGCGTCTCCACGACAACGAATCAAAACAACAACAGCAACTTTGCCTGGACTGGTGCCACCAAGTATCATCTGAACGGCAGAGACTCTCTGGTGAATCCGGGCGTCGCCATGGCAACCCACAAGGACGACGAGGACCGCTTCTTCCCATCCAGCGGCGTCCTCATATTTGGCAAGCAGGGAGCTGGAAATGACAACGTGGACTATAGCAACGTGATGATAACCAGCGAGGAAGAAATCAAGACCACCAACCCCGTGGCCACAGAAGAGTATGGCGTGGTGGCTACTAACCTACAGTCGGCAAACACCGCTCCTCAAACGGGGACCGTCAACAGCCAGGGAGCCTTACCTGGCATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCTATTTGGGCCAAGATTCCTCACACAGATGGCAACTTTCACCCGTCTCCTTTAATGGGCGGCTTTGGACTTAAACATCCGCCTCCTCAGATCCTCATCAAAAACACTCCTGTTCCTGCGGATCCTCCAACAACGTTCAACCAGGCCAAGCTGAATTCTTTCATCACGCAGTACAGCACCGGACAAGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGAGAACAGCAAGCGCTGGAACCCAGAGATTCAGTATACTTCCAACTACTACAAATCTACAAATGTGGACTTTGCTGTTAATACTGAGGGTGTTTACTCTGAGCCTCGCCCCATTGGCACTCGTTACCTCACCCGTAATCTGTAA

Anc82DI protein(SEQ ID NO：3)：

MAADGYLPDWLEDNLSEGIREWWDLKPGAPKPKANQQKQDDGRGLVLPGYKYLGPFNGLDKGEPVNAADAAALEHDKAYDQQLKAGDNPYLRYNHADAEFQERLQEDTSFGGNLGRAVFQAKKRVLEPLGLVEEGAKTAPGKKRPVEQSPQREPDSSTGIGKSGQQPAKKRLNFGQTGDSESVPDPQPLGEPPAAPSGVGSNTMASGGGAPMADNNEGADGVGNSSGNWHCDSTWLGDRVITTSTRTWALPTYNNHLYKQISNGTSGGSTNDNTYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTTNEGTKTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMIPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFQFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTQTTGGTAGTQTLQFSQAGPSSMANQARNWVPGPCYRQQRVSTTTNQNNNSNFAWTGATKYHLNGRDSLMNPGVAMASHKDDEDRFFPSSGVLIFGKQGAGNDNVDYSNVMITSEEEIKTTNPVATEEYGVVATNHQSANTQAQTGTVQNQGILPGMVWQNRDVYLQGPIWAKIPHTDGNFHPSPLMGGFGLKHPPPQILIKNTPVPADPPTTFNQAKLNSFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYYKSTNVDFAVNTEGVYSEPRPIGTRYLTRNL

Anc82DI DNA(SEQ ID NO：4)：

ATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACAACCTCTCTGAGGGCATTCGCGAGTGGTGGGACCTGAAACCTGGAGCCCCGAAACCCAAAGCCAACCAGCAAAAGCAGGACGACGGCCGGGGTCTGGTGCTTCCTGGCTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGGGAGCCCGTCAACGCGGCGGACGCAGCGGCCCTCGAGCACGACAAGGCCTACGACCAGCAGCTCAAAGCGGGTGACAATCCGTACCTGCGGTATAATCACGCCGACGCCGAGTTTCAGGAGCGTCTGCAAGAAGATACGTCTTTTGGGGGCAACCTCGGGCGAGCAGTCTTCCAGGCCAAGAAGCGGGTTCTCGAACCTCTCGGTCTGGTTGAGGAAGGCGCTAAGACGGCTCCTGGAAAGAAGAGGCCGGTAGAGCAGTCACCACAGCGTGAGCCCGACTCCTCCACGGGCATCGGCAAGAGCGGCCAGCAGCCCGCCAAAAAGAGACTCAATTTCGGTCAGACTGGCGACTCAGAGTCAGTCCCCGACCCTCAACCTCTCGGAGAACCTCCAGCAGCGCCCTCTGGTGTGGGATCTAATACAATGGCTTCAGGCGGTGGCGCACCAATGGCAGACAATAACGAAGGTGCCGACGGAGTGGGTAATTCCTCGGGAAATTGGCATTGCGATTCCACATGGCTAGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAGCAAATCTCCAACGGGACCTCGGGAGGCAGCACCAACGACAACACCTACTTTGGCTACAGCACCCCCTGGGGGTATTTTGACTTTAACAGATTCCACTGCCACTTCTCACCACGTGACTGGCAGCGACTCATCAACAACAACTGGGGATTCCGGCCCAAGAGACTCAACTTCAAGCTCTTCAACATCCAGGTCAAAGAGGTCACGACGAATGAAGGCACCAAGACCATCGCCAATAACCTCACCAGCACCGTCCAGGTGTTTACGGACTCGGAATACCAGCTGCCGTACGTCCTCGGCTCTGCCCACCAGGGCTGCCTGCCTCCGTTCCCGGCGGACGTCTTCATGATTCCTCAGTACGGCTACCTGACTCTCAACAACGGTAGTCAGGCCGTGGGACGTTCCTCCTTCTACTGCCTGGAGTACTTCCCCTCTCAGATGCTGAGAACGGGCAACAACTTTCAATTCAGCTACACTTTCGAGGACGTGCCTTTCCACAGCAGCTACGCGCACAGCCAGAGTTTGGACAGGCTGATGAATCCTCTCATCGACCAGTACCTGTACTACCTGTCAAGAACCCAGACTACGGGAGGCACAGCGGGAACCCAGACGTTGCAGTTTTCTCAGGCCGGGCCTAGCAGCATGGCGAATCAGGCCAGAAACTGGGTGCCTGGACCCTGCTACAGACAGCAGCGCGTCTCCACGACAACGAATCAAAACAACAACAGCAACTTTGCCTGGACTGGTGCCACCAAGTATCATCTGAACGGCAGAGACTCTCTGATGAATCCGGGCGTCGCCATGGCAAGCCACAAGGACGACGAGGACCGCTTCTTCCCATCCAGCGGCGTCCTCATATTTGGCAAGCAGGGAGCTGGAAATGACAACGTGGACTATAGCAACGTGATGATAACCAGCGAGGAAGAAATCAAGACCACCAACCCCGTGGCCACAGAAGAGTATGGCGTGGTGGCTACTAACCACCAGTCGGCAAACACCCAGGCTCAAACGGGGACCGTCCAAAACCAGGGAATCTTACCTGGCATGGTCTGGCAGAACCGGGACGTGTACCTGCAGGGTCCTATTTGGGCCAAGATTCCTCACACAGATGGCAACTTTCACCCGTCTCCTTTAATGGGCGGCTTTGGACTTAAACATCCGCCTCCTCAGATCCTCATCAAAAACACTCCTGTTCCTGCGGATCCTCCAACAACGTTCAACCAGGCCAAGCTGAATTCTTTCATCACGCAGTACAGCACCGGACAAGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGAGAACAGCAAGCGCTGGAACCCAGAGATTCAGTATACTTCCAACTACTACAAATCTACAAATGTGGACTTTGCTGTTAATACTGAGGGTGTTTACTCTGAGCCTCGCCCCATTGGCACTCGTTACCTCACCCGTAATCTGTAA

In addition to having SEQ ID NO:1 and 3, provides a polypeptide having the amino acid sequence set forth in SEQ ID NO:1 and 3 (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity). Similarly, a polypeptide similar to SEQ ID NO: 2 and 4 (e.g., at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity).

In calculating percent sequence identity, two sequences are aligned and the number of identical matches of nucleotides or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned regions (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to give a percentage sequence identity value. It will be appreciated that the length of the aligned regions may be a fraction of one or both sequences up to the full length of the shortest sequence. It will also be appreciated that a single sequence may be aligned with more than one other sequence and may therefore have a different percentage value of sequence identity over each aligned region.

Alignment of two or more sequences to determine percent sequence identity can be performed using the algorithm described by Altschul et al (1997, Nucleic Acids, Res., 25: 33893402), which incorporates the BLAST (basic local alignment tool) program, available on the world Wide Web at ncbi. A BLAST search can be performed using the algorithm of Altschul et al to determine the percent sequence identity between a sequence (nucleic acid or amino acid) and any other sequence or portion thereof. BLASTN is a program for aligning and comparing identities between nucleic acid sequences, and BLASTP is a program for aligning and comparing identities between amino acid sequences. When using the BLAST program to calculate percent identity between a sequence and another sequence, the default parameters for each program are typically used.

The disclosure also provides vectors containing nucleic acid molecules encoding the polypeptides. Vectors, including expression vectors, are commercially available or can be produced by recombinant techniques. A vector containing a nucleic acid molecule can have one or more elements operably linked to the nucleic acid molecule for expression, and can also include sequences, such as sequences encoding a selectable marker (e.g., an antibiotic resistance gene), and/or those that can be used to purify the polypeptide (e.g., a 6x His tag). Elements useful for expression include nucleic acid sequences that direct and regulate the expression of a nucleic acid coding sequence. An example of an expression element is a promoter sequence. Expression elements may also include one or more introns, enhancer sequences, response elements or inducible elements that regulate expression of the nucleic acid molecule. The expression elements may be of bacterial, yeast, insect, mammalian or viral origin, and the vector may contain a combination of expression elements from different sources. As used herein, operably linked means that the elements for expression are positioned in the vector relative to the coding sequence in a manner that directs or modulates expression of the coding sequence.

Nucleic acid molecules, e.g., nucleic acid molecules in a vector (e.g., an expression vector, such as a viral vector), can be introduced into a host cell. The term "host cell" refers not only to the particular cell into which a nucleic acid molecule has been introduced, but also to the progeny or potential progeny of such a cell. Many suitable host cells are known to those skilled in the art; the host cell can be a prokaryotic cell (e.g., e.coli) or a eukaryotic cell (e.g., yeast cell, insect cell, plant cell, mammalian cell). Representative host cells may include, but are not limited to, a549, WEHI, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC40, BMT 10, VERO, WI38, HeLa, 293 cells, Saos, C2C12, L cells, HT1080, HepG2, and primary fibroblasts, hepatocytes, and myoblasts derived from mammals including humans, monkeys, mice, rats, rabbits, and hamsters. Methods for introducing nucleic acid molecules into host cells are well known in the art and include, but are not limited to, calcium phosphate precipitation, electroporation, heat shock, lipofection, microinjection, and virus-mediated nucleic acid transfer (e.g., transduction).

With respect to a polypeptide, "purified" refers to a polypeptide (i.e., a peptide or polypeptide) that has been isolated or purified from cellular components with which it naturally accompanies. Generally, a polypeptide is considered "purified" when it is at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) free of the polypeptide and naturally-occurring molecules with which it is naturally associated, on a dry weight basis. A chemically synthesized polypeptide is considered "purified" because it is separated in nature from the components with which it naturally accompanies, but can be further removed from the components (e.g., amino acid residues) used to synthesize the polypeptide. With respect to nucleic acid molecules, "isolated" refers to a nucleic acid molecule that is separated from other nucleic acid molecules with which it is ordinarily associated in the genome. In addition, an isolated nucleic acid molecule can include an engineered nucleic acid molecule, such as a recombinant or synthetic nucleic acid molecule.

The polypeptide can be obtained (e.g., purified) from a natural source (e.g., a biological sample) by known methods such as DEAE ion exchange, gel filtration, and/or hydroxyapatite chromatography. Purified polypeptides can also be obtained, for example, by expressing the nucleic acid molecule in an expression vector or by chemical synthesis. The purity of the polypeptide may be measured using any suitable method, such as column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. Similarly, nucleic acid molecules can be obtained (e.g., isolated) using conventional methods such as, but not limited to, recombinant nucleic acid techniques (e.g., restriction enzyme digestion and ligation) or polymerase chain reaction (PCR; see, e.g., PCR Primer: A Laboratory Manual, editors of Dieffenbach & Dveksler, Cold spring Harbor Laboratory Press, 1995). In addition, isolated nucleic acid molecules can be chemically synthesized.

Method for producing viral particles with modified AAP dependence

After determining the desired (e.g., having modified AAP-dependent) sequence of the virus or portion thereof, the actual nucleic acid molecule and/or polypeptide can be generated, e.g., synthesized. Methods for generating artificial nucleic acid molecules or polypeptides based on, for example, computer-derived sequences are known in the art and include, for example, chemical synthesis or recombinant cloning. Other methods of producing nucleic acid molecules or polypeptides are known in the art and will be discussed in more detail below.

Once the polypeptide is produced, or once the nucleic acid molecule is produced and expressed to produce the polypeptide, the polypeptide can be assembled into viral particles using, for example, a packaging host cell. Components of the viral particles (e.g., rep sequences, cap sequences, Inverted Terminal Repeat (ITR) sequences) can be transiently or stably introduced into a packaging host cell using one or more of the vectors described herein.

Viral particles can be purified using conventional methods. As used herein, "purified" viral particles refer to viral particles removed from components in the mixture from which they are prepared, such as, but not limited to, viral components (e.g., rep sequences, cap sequences), packaging host cells, and partially or incompletely assembled viral particles.

Once assembled, the viral particles can be, for example, replication competent; gene transfer characteristics; receptor binding capacity; and/or prevalence of serum in a population (e.g., a human population). Determining whether a viral particle can replicate is routine in the art and generally involves infecting a host cell with an amount of viral particle and determining whether the number of viral particles increases over time. Determining whether a viral particle is capable of gene transfer is also routine in the art and generally involves infecting a host cell with a viral particle that contains a transgene (e.g., a detectable transgene, such as a reporter gene, discussed in more detail below). Following viral infection and clearance, the host cell can be assessed for the presence or absence of the transgene. Determining whether a viral particle binds to its receptor is routine in the art, and these methods can be performed in vitro or in vivo.

Determining the seroprevalence of a viral particle is routinely performed in the art, and typically involves the use of immunoassays to determine the prevalence of one or more antibodies in a sample (e.g., a blood sample) from a particular population of individuals. Seroprevalence is understood in the art to refer to the proportion of subjects in a population that are seropositive (i.e., have been exposed to a particular pathogen or immunogen), and is calculated as the number of subjects in the population that produce antibodies to the particular pathogen or immunogen divided by the total number of individuals in the population examined. Immunoassays are well known in the art and include, but are not limited to, immunoblotting, Western blotting, Enzyme Immunoassay (EIA), enzyme-linked immunosorbent assay (ELISA), or Radioimmunoassay (RIA). For simple example, see Xu et al 2007, am.j.obstet.gynecol., 196: 43, e 1-6); paul et al (1994, J.Infect.Dis., 169: 801-6); sauerbori et al (2011, Eurosurv, 16 (44): 3); boutin et al (2010, hum. gene ther., 21: 704-12); calcedo et al (2009, j.infect.dis., 199: 381-90); and Sakhria et al (2013, PLoS negl. trop. dis., 7: e2429), each of which determines the seroprevalence of a particular antibody in a given population.

As described herein, the viral particles can be neutralized by the human (e.g., patient) immune system. There are several methods to determine the extent of neutralizing antibodies in serum samples. For example, a neutralizing antibody assay measures the titer at which an experimental sample contains an antibody concentration that neutralizes infection by 50% or more, as compared to a control sample without antibody. See also, Fisher et al (1997, Nature Med, 3: 306-12) and Manning et al (1998, Human Gene ther., 9: 477-85).

Methods of using viruses or portions thereof with modified AAP dependence

Viruses or portions thereof having modified AAP dependence as described herein can be used in a number of research and/or therapeutic applications. For example, viruses or portions thereof having modified AAP dependence as described herein can be used in human or animal medicine for gene therapy (e.g., vectors or vector systems for gene transfer) or for vaccination (e.g., for antigen presentation). More specifically, viruses or portions thereof having modified AAP-dependence as described herein can be used for gene addition, gene enhancement, genetic delivery of polypeptide therapeutics, genetic vaccination, gene silencing, genome editing, gene therapy, RNAi delivery, cDNA delivery, mRNA delivery, miRNA sponge adsorption, gene immunization, optogenetic gene therapy, transgenics, DNA vaccination, or DNA immunization.

The host cell can be transduced or infected in vitro (e.g., grown in culture) or in vivo (e.g., in a subject) with a virus or portion thereof having a modified AAP dependence. Described herein are host cells that can be transduced or infected in vitro with a virus or portion thereof having a modified AAP-dependence; host cells that can be transduced or infected in vivo with the progenitor virus or a portion thereof include, but are not limited to, brain, liver, muscle, lung, eye (e.g., retina, retinal pigment epithelium), kidney, heart, gonads (e.g., testis, uterus, ovary), skin, nasal tract, digestive system, pancreas, islet cells, neurons, lymphocytes, ear (e.g., inner ear), hair follicles, and/or glands (e.g., thyroid).

A virus or portion thereof having modified AAP-dependence as described herein can be modified to include a transgene (in cis or trans with other viral sequences) a transgene can be, for example, a reporter gene (e.g., β -lactamase, β -galactosidase (LacZ), alkaline phosphatase, thymidine kinase, Green Fluorescent Polypeptide (GFP), Chloramphenicol Acetyl Transferase (CAT), or luciferase, or a fusion polypeptide including an antigen-tag domain, such as hemagglutinin or Myc) or a therapeutic gene (e.g., encoding a hormone or receptor thereof, a growth factor or receptor thereof, a differentiation factor or receptor thereof, an immune system modulator (e.g., a cytokine and an interleukin) or receptor thereof, an enzyme, an RNA (e.g., inhibitory or catalytic RNA), or a target antigen (e.g., an oncogenic antigen, an autoimmune antigen)).

The particular transgene will depend, at least in part, on the particular disease or defect being treated. By way of simple example, gene transfer or gene therapy can be used to treat hemophilia, retinitis pigmentosa, cystic fibrosis, leber congenital amaurosis, lysosomal storage disorders, congenital metabolic defects (e.g., congenital defects in amino acid metabolism including phenylketonuria, congenital defects in organic acid metabolism including propionemia, congenital defects in fatty acid metabolism including medium chain acyl-coa dehydrogenase defect (MCAD)), cancer, color blindness, cone dystrophy, macular degeneration (e.g., age-related macular degeneration), lipopeptide lipase defects, familial hypercholesterolemia, spinal muscular atrophy, Duchenne-type muscular dystrophy, alzheimer's disease, parkinson's disease, obesity, inflammatory bowel disease, diabetes, congestive heart failure, hypercholesterolemia, hearing loss, coronary heart disease, familial renal amyloidosis, chronic myelogenous degeneration, Equine syndrome, fatal familial insomnia, creutzfeldt-jakob disease, sickle cell disease, Huntington's chorea, frontotemporal lobar degeneration, Usher syndrome, lactose intolerance, lipid storage disorders (e.g., niemann-pick disease type C), barter's disease, choroidal defects, glycogen storage disease type II (pompe disease), ataxia telangiectasia (Louis-Bar syndrome), congenital hypothyroidism, Severe Combined Immunodeficiency (SCID), and/or Amyotrophic Lateral Sclerosis (ALS).

The transgene may also be, for example, an immunogen for immunizing a subject (e.g., a human, an animal (e.g., a companion animal, a farm animal, an endangered animal)). For example, the immunogen may be obtained from an organism (e.g., a pathogenic organism) or an immunogenic portion or component thereof (e.g., a toxin polypeptide or a byproduct thereof). By way of example, pathogenic organisms from which immunogenic polypeptides can be obtained include viruses (e.g., picornaviruses, enteroviruses, orthomyxoviruses, reoviruses, retroviruses), prokaryotes (e.g., pneumococci, staphylococci, listeria, pseudomonas), and eukaryotes (e.g., amebiasis, malaria, leishmaniasis, nematodes). It will be understood that the methods described herein and the combinations produced by these methods are not limited by any particular transgene.

Viruses or portions thereof with modified AAP dependence, typically suspended in a physiologically compatible vector, can be administered to a subject (e.g., a human or non-human mammal). Suitable carriers include saline, which can be formulated with a variety of buffer solutions (e.g., phosphate buffered saline), lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, and water. Viruses or portions thereof having modified AAP dependence are administered in sufficient amounts to transduce or infect cells and provide sufficient levels of gene transfer and expression to provide therapeutic benefit without undue side effects. Conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to an organ, e.g., liver or lung, oral, intranasal, intratracheal, by inhalation, intravenous, intramuscular, intraocular, subcutaneous, intradermal, transmucosal, or by other routes of administration. The routes of administration may be combined, if desired.

The dose of virus or portion thereof with modified AAP dependence administered to a subject will depend primarily on factors such as the condition being treated and the age, weight and health of the subject. For example, the therapeutically effective dose of a virus or portion thereof having modified AAP-dependence for administration to a human subject is typically in the range of about 0.1ml to about 10 ml of a solution having a concentration of about 1X 10¹To 1X 10¹²Individual viral Genome Copies (GC) (e.g., about 1X 10³To 1X 10⁹GC). Transduction and/or expression of the transgene can be monitored by DNA, RNA or protein analysis at various time points after administration. In some cases, the expression level of the transgene can be monitored to determine the frequency and/or amount of the dose. Dosage regimens similar to those described for therapeutic purposes may also be used for immunization.

According to the present invention, conventional molecular biology, microbiology, biochemistry and recombinant DNA techniques within the skill of the art may be used. These techniques are explained fully in the literature. The invention will be further described in the following examples, which do not limit the scope of the combination of methods and materials described in the claims.

Examples

Example 1 vectors and sequences

The adeno-associated viral vector is pseudotyped with an existing or ancestral viral capsid. Existing capsids include AAV1(Genbank [ GB ] AAD27757.1), AAV2(GB AAC03780.1), AAV3(GB U48704.1), AAV4(GB U89790.1), AAV5(GB AAD13756.1), AAV6(GB AF028704.1), AAV7(NC _006260.1) rh.10(GB AAO88201.1), AAV8(GB AAN03857.1), AAV9(GB AAS99264.1), and rh32.33(GB EU 368926). Ancestral AAV capsids include Anc80L65, Anc81, Anc82, Anc83, Anc84, Anc110, Anc113, Anc126, and Anc127(KT235804-KT 235812). In this study, Anc83 was found in the putative AAP ORF: Q1L has the following mutation (83 AAP-KI).

Example 2 site-directed mutagenesis

AAPstop60, AAPstop20 and 82DI single-repeat mutations were used

II site-directed mutagenesis kit according to the manufacturer's instructions generated. To generate 82DI, use is made according to the manufacturer's instructions

The Lightning multipoint directed mutagenesis kit is divided into two stages: first, five sites were mutated on the Anc82 backbone, and then the remaining five mutations were introduced into the quintuple mutant backbone.

Example 3 crude Virus preparation/titration

Virus preparations assayed for production in all serotypes and mutants were prepared as follows: transfection of the AAV cis ITR-CMV-EGFP-T2A-Luc-ITR (2. mu.g), AAV trans rep-cap (2. mu.g) and adenovirus helper plasmid (4. mu.g) with polyethyleneimine was performed on HEK293 cells at 90% confluence in 6-well dishes. The PEI Max (Polysciences)/DNA ratio was maintained at 1.375: 1(w/w) in serum-free medium. After 72 hours the virus was harvested by three freeze/thaw cycles followed by centrifugation at 15000 × g.

For DRP titers, the crude preparation was treated with dnase i and the preparation was titrated with primers and probes that detect the CMV promoter region of the transgene cassette by TaqMan qPCR amplification (Applied Biosystems7500, Life Technologies) using resistant (packaged) vector genome copies.

Example 4 thermal stability assay (AAV-ID)

The thermostability of the purified vector was determined by AAV-ID (Pacouret et al, 2017, mol. Ther., 25: 1375-86). Briefly, PBS was used²⁺(21-030-CV，Corning Inc.，Corning，NY) as solvent to prepare 500. mu.L

Sample of Orange 50X. mu.L of the sample was loaded into a 96-well plate, supplemented with 5. mu.L of Sypro Orange 50X. Separately using PBS²⁺And 0.25mg/mL lysozyme (L6876, SIGMA-ALDRICH, St. Louis, MO, USA) solution as negative and positive controls. The plates were sealed and centrifuged at 3000rpm for 2 minutes before being loaded into the 7500 real-time PCR system (ThermoFisher SCIENTIFIC). Samples were incubated at 25 ℃ for 2 minutes while monitoring using a ROX filter cube available on both qPCR systems, before being subjected to a temperature gradient (25 to 99 ℃, -2 ℃/10 minutes, step and hold mode with 0.4 ℃ temperature increment)

Fluorescence of Orange. The fluorescence signal F is normalized between 0 and 100%, and the melting temperature is defined as the temperature at which the numerical derivative dF/dT reaches its maximum.

Example 5 enzyme-linked immunosorbent assay

A20 capsid ELISA was performed on the virus crude preparation using PROGEN AAV2 Titration ELISA kit (ref # PRATV) according to the manufacturer's instructions, hA1AT ELISA was performed on mouse sera serially diluted 1: 1250-1: 10000 using the Cloud-Clone ELISA kit against α -1 antitrypsin (SEB697Hu, 96 assay) according to the manufacturer's instructions.

Example 6 animal study

C57BL/6 Male mice (6-8 weeks) were purchased from Jackson Laboratories. All experimental procedures were performed according to protocols approved by the animal Care and use Committee (IACUC) of Schepens Eye Research Institute.

Mice were anesthetized with intraperitoneal administration of ketamine/xylazine. Each animal was injected retroorbitally (100 μ l) with 1.00E +11 VG/mouse with the following vehicle: Anc82.CB7.CI.EGFP.FF2A.h1AT.RBG and Anc82DI.CB7.CI.EGFP.FF2A.h1AT.RBG. Blood was collected via submandibular bleeding using golden rod animal lancets (MEDIpoint, Inc.) before and 3, 7, 15, and 28 days after injection. The sample was centrifuged at 8,000rpm for 7.5 minutes, and serum was collected.

Animals were euthanized, livers were collected and immersed in 4% paraformaldehyde solution (Electron microscopical sciences) for 30 minutes, then placed in 30% sucrose overnight. The following day, the liver was fixed in Tissue-Tek o.c.t. compound (Sakura Finetek) and snap frozen in cold isopentane.

Example 7 histology

To observe eGFP expression in the liver, 15 μ M sections were used

Hard Set^TMThe fixed medium was fixed with DAPI (H-1500) and imaged with Zeiss Axio Imager M2 at the same gain and intensity for all sections.

Example 8 molecular representation

All molecular representations in this study were generated using PyMOL and Protein Data Bank files 2QA0(AAV8) and 3UX1(AAV 9).

Example 9 production and purification of AAV3, AAV3s, AAV9, and AAV9s

The vectors were purified by affinity chromatography using either AVB Sepharose HP (25-4112-11, GEHealthcare) (AAV3 and AAV3s) or POROS CaptureSelect AAV9 affinity resin (Thermo Fisher) according to the manufacturer's instructions (AAV9 and AAV9 s).

Prior to the centrifugation step (1h, 10,000rpm, 20 ℃), the large-scale crude preparation was treated with Benzonase (250U/mL, 1h, 37 ℃) and then filtered using a 0.2 μm Nalgene Rapid-Flow filter. The vector was purified by affinity chromatography using either HiTrap columns (AAV3 and AAV3s) pre-packed with 1mL of AVB Sepharose HP (25-4112-11, GE Healthcare) (AAV3 and AAV3s) or 5X 125mm Econoline columns (TAC05/125PE0-AB-3, essentiaLife solution) (AAV9 and AAV9s) pre-packed with 1mL of POROS CaptureSelect AAV9 affinity resin (Thermo Fisher) according to the manufacturer's instructions. With 0.1M H of 5 Column Volumes (CV)₃PO₄The column was purified with 1M NaCl, pH 2(1mL/min), and equilibrated with 5CV of PBS (21-030-CV, Corning) (1 mL/min). The clarified lysate was injected at 1 mL/min. The column was further washed with 10 CVPBS (1 mL/min). The carrier particles were washed in 3mL of 0.1M NaOAc, 0.5M NaCl, pHEluted in 2.5(1mL/min) and immediately neutralized with 400. mu.L of 1M Tris-HCl, pH 10. The samples were further buffer exchanged in PBS and concentrated by Amicon filtration (UFC910024, EMD Millipore) according to the manufacturer's instructions. Sample purity was assessed by SDS-PAGE, while DNAse I resistance vector genomes were quantified by quantitative polymerase chain reaction (qPCR), using taqman (life technologies) system, targeting SV40 or eGFP with primers and probes.

Example 10 statistical methods

All data were analyzed using R for reporting in the figures (unless otherwise stated) prior to normalization. P values are reported in table 2, comparing viral titers using paired single-tailed student's t-test, and RNA levels using paired two-tailed student's t-test.

Table 2 shows the statistical analysis associated with figures 1, 2, 3 and 4. All statistical analyses were performed in R, on data before normalization, and reported on the main graph shown on the left side of the table. Panel a compares WT and AAPstop60 virus titers measured by qPCR after background subtraction (no cap gene control). P values from paired single tail t test. ND ═ undetermined; in the case where one or more of the tests were within 3 standard deviations of the background measured, t-tests could not be performed on the serotypes. Panel B compares AAPstop60 or rescue to WT levels of RNA (all normalized to GAPDH). P values from paired two-tailed t-test.

Example 11 expression constructs

AAP-HA: complementary oligonucleotides encoding Hemagglutinin (HA) tags (5 'GTAC, 3' CATG) with BsiWI overhangs were annealed from 95 ℃ to 25 ℃ at 5 °/min in T4 ligase buffer, PNK treated, and ligated into BsiWI digested and CIP treated AAV1, AAV3 wt and AAPstop60rep-cap plasmids.

CMV-HA-VP1 and CMV-VP 3: gene fragments (IDTs) of bp #4-696 of VP1 of AAV2, AAV3, Anc82 and 82DI were obtained with the following modifications: the EcoRI site, the initiation codon and the HA sequence were added to the 5' end, the ACG to ACC mutation of the initiation codon of VP2, and the ATG to CTG mutation of the initiation codon of VP 3.(ii) comprises a BsrDI restriction site conserved in cap; gBlocks were digested with EcoRI and BsrDI. The VP3 sequence was PCR amplified from the appropriate AAPstop60rep-cap plasmid with primers containing 5 'EcoRI and 3' HindIII restriction sites, followed by digestion with EcoRI and HindIII (for CMV-VP3) or BsrDI and HindIII (for CMV-HA-VP 1). The fragments were ligated in the appropriate combination into pCDNA3.1 (-). For CMV-AAP2, AAP was amplified from AAV2 rep-cap plasmid and ligated into pCDNA3.1 (-).

Example 12 protein lysate preparation and degradation/renewal Studies

Such as transfection in crude virus preparations. At 36 hours, the supernatant was aspirated and cells were lysed on plates with 100 μ L (FIG. 2) or 150 μ L (FIGS. 3 and 4) lysis buffer (1% Triton X-100, 150mM NaCl, 50mM Tris, pH8, plus cOmplete Mini protease inhibitor). Lysates were clarified by centrifugation at 15,000x g, diluted 1: 50 in lysis buffer for actin or 1: 100 in lysis buffer for tubulin-loaded control blots, and diluted 4X

LDS sample buffer + 0.5% □ ME was denatured at 90 ℃. 100 μ g (FIG. 2) or 50 μ g (FIGS. 3 and 4) total protein per well (or its dilution for control blot loading) was loaded and stored

4-12% Bis-Tris gel. For proteasome and lysosome inhibition experiments, media was removed 24 hours post transfection and replaced with media containing appropriate concentrations of bortezomib (Selleckchem PS-341), MLN7243 (Chemwood C-1233), Bafilomycin (EnzoBML-CM110-0100) or DMSO (for wt and AAPstop untreated samples) and incubated for a further 8 hours. Mu.g of total protein was added per well (1: 10 dilution for loading control). For protein turnover experiments by blocking protein synthesis, media was removed 24 hours after transfection and replaced with media containing 50 μ g/mL CHX (Sigma C7698) and used as described above for 1, 2, 4, 6 and 8 hoursLysates were harvested at a point, and the medium was not replaced at the 0 hour time point, but instead the lysates were harvested. 10% FBS was maintained during all transfection and drug incubations described herein.

Example 13 Western/dot blot

The electrophoresed proteins were transferred onto PVDF membrane, incubated overnight with primary antibodies (B1, 1: 250, ARP # 03-65158; actin, 1: 20000, Abcam 8227; tubulin, 1: 20000, Abcam 7291; HA, 1: 5000, Abcam 9110; p62, 1: 1000, cell Signal 5114), and incubated with anti-mouse (GE Healthcare LNXA931/AE) or anti-rabbit (Sigma A0545) HRP-conjugated secondary antibodies and Thermo Super

West Pico or Femto assay.

For dot blot, protein lysates were diluted 1: 100 and 2 μ L were spotted onto nitrocellulose membranes, dried, blocked in 5% milk, and incubated overnight with ADK8(ARP # 03-651160).

Example 14 immunoprecipitation

PEI transfection of 80% confluent HEK293 cells on 10cm dishes was performed with 10. mu.g each of the appropriate serotypes of CMV-HA-VP1, CMV-VP3 and CMV-AAP2 plasmids (CMV-AAP 2 was added only where indicated). The PEI Max (Polysciences)/DNA ratio was maintained at 1.375: 1(w/w) in serum-free medium. 24 hours after transfection, cells were pelleted and resuspended in 1mL lysis buffer (1% Triton X-100, 150mM NaCl, 50mM Tris, pH8, plus cOmplete Mini^TMProtease inhibitors). Immunoprecipitation was performed with rb anti-HA antibody (Abcam9110) and Pierce protein A/G plus agarose beads. Precipitated protein at 4 ×

LDS sample buffer + 0.5% □ ME at 90 ℃ for 10 minutes. Load 10 μ L (IP) or 30 μ L (input) and add

4-12% Bis-Tris gels were run on and detected in the Western blot above. To detect integrityThe ITR-CMV-EGFP-T2A-Luc-ITR and pRep plasmids were added to the above plasmid transfected with AAV2 (FIG. 6C). To avoid thermal denaturation of the AAV2 capsid, instead the complex was eluted with 0.2M glycine, pH2.8, and the eluate was neutralized with an equal volume of Tris, pH 8.5. The purified AAV2 preparation was treated with elution buffer and neutralization buffer in parallel to ensure that these conditions did not denature the capsid. Control, IP, input and supernatant fractions were treated with dnase i and resistant (packaged) vector genomic copies were amplified with TaqMan qPCR (Applied Biosystems7500, life technologies) and quantified with primers and probes that detect the CMV promoter region of the transgene cassette.

Example 15 crosslinking

The 6-well plate-80% confluent HEK293 cells were PEI-transfected with 2. mu.g of each of the appropriate serotypes of CMV-HA-VP1, CMV-VP3 and CMV-AAP2 plasmids (CMV-AAP 2 was added only where indicated). The PEIMax (Polysciences)/DNA ratio was maintained at 1.375: 1(w/w) in serum-free medium. After 36 hours, with supplementation with cOmplete^TMM-PER of mini-proteinase inhibitors^TM(Thermo) buffer was used for on-plate lysis. The lysate was divided into three portions and treated with bis-succinimidyl glutarate (DSG, Thermo), bis-succinimidyl suberate (DSS, Thermo) or an equal volume of DMSO at a final concentration of 5mM as a mock treatment. The reaction was incubated on ice for 1 hour, mixed periodically, and then quenched with 1M Tris. LDS sample buffer + 2-mercaptoethanol was added, the samples boiled for 10 minutes, loaded onto SDS-PAGE gels, and analyzed by Western blotting with B1 antibody.

Example 16 RNA quantification

Transfection was performed as described in crude virus preparations/titration. RNA was collected after 36 hours using Qiagen RNeasy kit according to the manufacturer's instructions. TURBO uses DNA-free^TMThe kit (Invitrogen) was used according to the manufacturer's instructions (stringent dnase treatment protocol) to remove contaminating DNA from the sample. With iScript^TMThe kit (BioRad) used 250ng of total RNA from each sample for cDNA synthesis. The reaction was then diluted 10-fold and 5 μ L of the diluted cDNA was used for each qPCR reaction with PowerUp^TMSYBR^TMGreen Master Mix (Applied Biosystems) and intron, intron-spanning or GAPDH primers were prepared to detect unspliced, spliced or housekeeping gene products.

Example 17 Transmission Electron microscope

For negative staining on chromatographically purified AAV3 and AAV3stop, the carrier samples (5 μ L or 50 μ L drops) and blank buffer control were adsorbed onto 200 mesh carbon and formvar coated nickel grids, rinsed, and stained with 2% aqueous uranyl acetate for 30 seconds, then absorbed on filter paper and air dried. All grids were imaged using a FEI Tecnai G2 Spirit transmission electron microscope (FEI, Hillsboro, Oregon) at 100kV acceleration voltage, connected with an AMT XR41 digital CCD camera (Advanced Microscopy Techniques, Woburn, Massachusetts) for digital TIFF file image acquisition. TEM imaging of AAV samples was evaluated and digital images were captured at 2k × 2k pixels at 16 bit resolution.

Example 18 in vitro transduction

The appropriate serotype of AAV-CMV-EGFP-T2A-Luc and GC particles were added 24 hours prior to a multiplicity of infection of 20 particles/cell to HEK-293 cells on 96-well plates pre-infected with human adenovirus 5(hAD 5). At 24 and 48 hoursThe cells were imaged by the imaging system, then a buffer containing D-fluorescein was added and luminescence was measured using a SynergyH1 microplate reader (BioTek; Winooski, VT).

Example 19 Table

TABLE 1

TABLE 2

TABLE 3

TABLE 4

Example 20-AAP Range requirements that broadly span all AAV clades

To test whether AAP requires assembly of capsids from the full complement of VP proteins (i.e., VP1, 2, and 3), AAP expression was eliminated from the rep-cap trans plasmid by an early stop codon in the AAP reading frame (silent mutation in VP). AAPstop60s was generated against 12 serotypes including at least one member of each AAV clade with the aim of fully assessing the AAP requirements of mammalian AAV serotypes. In view of the non-canonical CTG initiation codon of AAP, AAPstop60 was mutated at a position such that it was sufficiently downstream of the potential replacement initiation codon, but still upstream of the region shown to be essential for AAP2 function (Naumer et al, 2012, J.Virol., 86: 13038-48). To confirm loss of AAP protein, hemagglutinin tags were inserted into the C-terminal regions of the AAP ORFs of two representative serotypes (fig. 1A, AAP-HA). Whole cell lysates transfected with these constructs were analyzed by Western blot (fig. 1B), confirming that AAPstop60 resulted in loss of full-length AAP or any shorter protein product translated from the alternative initiation. The double band in the AAP-HA lane supports the possibility of other downstream initiation codons and ensures a late position of the stop codon (FIG. 1B).

Recombinant AAV vectors were generated from AAPstop60 and wild type aap (wt) plasmids and titrated by qPCR quantification of DNase Resistant Particles (DRP). AAPstop60 vector titers showed that AAP is not strictly required for assembly of virions in several serotypes when all three VP proteins are present (fig. 1C). In contrast, the range of AAP requirements broadly encompasses serotypes in which the AAPstop60 vector produces up to 39% of the WT titer against rh32.33 and as low as 0.035% of the WT titer against AAV8. This observation is in contrast to previous findings which demonstrate that AAP absolutely requires assembly of a VP 3-only capsid, particularly AAV9 and AAV1(Sonntag et al, 2011, j.virol., 85: 12686-97).

The advantage of DRP titration is the ability to quantify viruses of any capsid serotype with the same vector genome without differential bias in the measurements. However, DRP measurements also undergo the amount of assembled particles that are packaged by the viral genome, a process that occurs downstream of capsid assembly. Furthermore, DRP cannot evaluate non-packaged empty AAV virions. To directly determine capsid assembly and rule out the possibility of serotypes with low AAPstop60 titers being defective due to packaging, an a20 capsid ELISA was performed that recognizes conformational epitopes present only in the assembled AAV2 capsid. A20 cross-reacts with AAV3, allowing us to directly determine the assembly of AAP-requiring AAV (AAV2) and AAV (AAV3) that completes assembly in the context of AAPstop60. The a20 ELISA data for both serotypes confirmed indirect measurement of assembled DRP (fig. 1D).

Example 21 Effect of AAP on VP protein stability

To ensure that the range of AAP dependencies observed for assembly was not due to changes in VP translation efficiency caused by alternative codon usage in the AAPstop60 mutant, VP protein levels produced by the WT and AAPstop60 constructs were interrogated. The B1 monoclonal antibody detects conserved linear epitopes on VP protein under denaturing conditions that encompass all AAV tested in this study, except AAV4 and rh32.33, allowing determination of almost all serotypes. For AAPstop60 that produced 10% or greater of their respective WT titers, no significant difference was observed at VP2 or VP3 protein levels, and a slight decrease was observed at VP1 level (fig. 2A), while AAPstop60 with titers below this threshold showed a significant decrease in VP protein levels (fig. 2B). To test whether the observed reduction in VP levels was due to a potential translational defect, AAP2 was co-expressed in trans with AAPstop60 (rescue; FIG. 2B). For all affected serotypes, significant recovery of VP protein was observed. Furthermore, no difference was observed between WT, AAPstop60 or rescue transcript levels (fig. 2C), suggesting that VP protein loss in the absence of AAP is most likely to occur post-translationally (or concurrently).

To interrogate the degradation as a mechanism of instability, AAV8AAPstop60 transfected cells were treated with increasing concentrations of the proteasome inhibitor bortezomib, the E1 inhibitor MLN7243, or the vacuolar-specific H + atpase inhibitor bamamicin (fig. 2D). This allows to examine the earliest and latest steps of the ubiquitin-proteasome pathway, as well as the later steps of degradation or autophagy by inhibition of lysosomes requiring acidification. Inhibition of lysosomal acidification resulted in a mild but dose-dependent rescue of AAV8VP 3 protein. Proteasome inhibition was accompanied by a potent rescue of AAV8VP protein in a dose-dependent manner, but this did not coincide with a rescue of assembled capsids (fig. 2E). E1 inhibition provided the same mild to moderate VP rescue independent of drug concentration. Taken together, these results indicate that the instability of VP protein in the absence of AAP is largely due to proteasomal degradation, and this may be partially ubiquitin independent. Lysosomal or autophagosomal degradation may also degrade a proportion of VP protein.

In an attempt to examine the rate of AAV8VP degradation, protein synthesis was blocked with Cycloheximide (CHX) and protein lysates were collected at progressive time points (fig. 8A). As expected in the AAPstop60 lysate, VP protein levels were too low to detect even without CHX treatment and despite long exposure with highly sensitive detection reagents. However, VP protein levels remained consistent at all time points of CHX treatment in the presence of AAP. This is probably because the capsid assembles rapidly in the presence of AAP and because the assembled VP protein is not readily degraded, the VP band persists.

In view of the AAP phenotypic profile observed on the major clade, 9 putative evolutionary intermediates (AncAAV) of the major AAV serotypes were also tested in order to understand which elements of VP structure impose the observed requirements for AAP, or to confer some VP with the ability to independently perform these functions (Zinn et al, 2015, Cell Rep, 12: 1056-68). As with the native serotype, a wide range of AAP requirements was observed for AAPstop60AncAAV (fig. 3A).

Although the AAPstop60 early stop codon is located upstream of the domain required to demonstrate AAP2 function, it is located downstream of the highly conserved region (residues 52-57) in AAP (fig. 9, conserved core). Deletion analysis indicated that this domain is important for AAP2 function, but is not sufficient to assemble VP3 alone without the capsid of the C-terminal part where more AAP is present (Naumer et al, 2012, j.virol., 86: 13038-48). Because AAPs in other serotypes have not been tested by deletion analysis, and because the algorithm to generate AncAAV only applies to the VP ORF and may have unpredictable results for AAP (Zinn et al 2015, cellrep., 12: 1056-68), we wanted to check whether a partially functional N-terminal AAP (aapn) is expressed from some AAPstop60 constructs, which resulted in different requirements for AAP being observed in the 21 AAVs examined. For 6 AAPstop60 producing titers of at least 10% WT and for AAV4, it was recently demonstrated that the capsid of VP3 alone was assembled without AAP (Earley et al, 2017, j.virol., 91: e01980-16), generating an additional upstream termination construct (AAPstop20), placing the early termination codon at residue-23 in the AAP ORF (silent mutation in VP). Among these, AAV5, rh32.33, and AAV4AAPstop20 produced virus, while AAV3, AAV9, Anc110, and Anc113 did not (fig. 3B). Although the B1 antibody did not detect AAV4 and rh32.33, VP protein levels produced from the remaining AAPstop20 construct reflected titers (fig. 3C). In connection with fig. 2, these results demonstrate that stability is a serotype-specific property of VP proteins belonging to one of three classes: independent stabilization, (ii) requires only AAPN for stability, or (iii) requires full-length AAP. These results clearly illustrate the role of AAP in VP stability and provide an explanation for the broad range of requirements for AAP. The difference between AAPstop60 and WT titers, particularly for serotypes that require only AAPN, points to other disadvantages in VP of some serotypes that are compensated for AAP, and potentially discrete functions are primarily contained in AAPN as compared to the C-terminal two thirds of AAP. For clarity, AAP phenotypes were classified as (i) AAP-independent, (ii) AAPC-independent, and (iii) AAP-dependent, considering VP stability, AAPstop60 titer, and AAPstop20 titer (fig. 3D). In addition, by demonstrating that AAPN from AAPC-independent serotypes cannot rescue virus production from AAP-dependent serotypes, it was shown that the AAPC-independent phenotype is a property of VP protein, rather than the result of fully functional AAPN (fig. 10).

To test whether serotypes of VPs with different AAP phenotypes undergo the same degradation mechanism, the degradation of AAV3 protein was blocked in the same manner as previously performed for AAV8 (fig. 8B). Inhibition of proteasome by bortezomib provided a dose-responsive, robust rescue as much as AAV8, while inhibition of E1 by MLN7243 rescued VP at the highest dose. Unlike AAV8, inhibition of lysosomal acidification with bardanamycin robustly rescued AAV3 VP levels in a dose-dependent manner, suggesting that AAPC-independent serotypes (or at least AAV3) may be more susceptible to lysosomal degradation or autophagy. These results also indicate that AAPN promotes proteasomes in some way as the primary way of degradation, whether by blocking lysosomal degradation or by other means, because AAPN is present in the AAV8AAPstop60 lysate, but not in the AAV3AAPstop 20 lysate.

Example 22 AAPC does not affect virosomal morphology, infectivity or stability

While AAPN alone contributes to the production of appreciable amounts of virus by many serotypes, it is next discussed whether the AAPN assembled particles maintain proper morphology and infectious function. TEM imaging of AAV3 WT and AAV3AAPstop60 vectors showed the same overall particle morphology (fig. 11A). To examine whether loss of AAPC affects infectivity, HEK293 cells in culture were tested for AAV9, AAV3, and their AAPstop60 vectors (fig. 11B, C), demonstrating that assembled viruses retain infectivity in the absence of AAPC. In addition, the melting temperatures of these particles were tested and no significant difference was observed (fig. 11D).

Example 23-requirement for AAP shows Branch specificity in the case of putative AAV phylogeny

As a next step to identify VP structures responsible for assembly function, an overview of how the AAP phenotypes differ over the broad genetic range of tested AAV capsids was sought, with the aim of identifying phenotypic differences over small genetic distances. AAP phenotypes of 12 native serotypes and 9 progenitor variants correlated with reconstituted phylogeny (fig. 3E). This reveals a branch-specific AAP-dependent profile, in which phylogenetic nodes account for significant divergence in AAP phenotypes. In other clear trends, Anc80, Anc81, Anc82, Anc83, and Anc84 comprise a fully dependent lineage that terminates at AAV8 and rh.10, and thus will be referred to as branch D (fig. 3E, red arrow). In section Anc82, a phenotype switch from AAP-dependent to AAPC-independent was observed in its successor Anc 110. Serotypes branching from Anc110, rh8, and AAV9 are also AAPC independent; this branch is named branch I (fig. 3E, green arrow).

Example 24-phenotypic-phylogenetic mapping analysis reveals a group of roles in AAPC-independent assembly Residue of

The observation that AAP phenotypes have a branch-specific tendency in phylogeny provides an opportunity for an easy method of identifying VP building elements that are critical for assembly function. Assuming that the VP sequences diverge in small increments along each of these branches, it is assumed that a set of residues that are homologous only within the members of their respective branches may functionally contribute to capsid assembly. To this end, multiple sequence alignments were generated with branch D and branch I members. In the alignment, a total of 149 positions were different, however, residues were conserved within branch I only at 12 positions, 8 individual residues and two pairs of adjacent residues contained 10 sites on VP with different but shared identity on branch D. At some of these sites, residue identity differs within the branch I members; however, they have the opposite chemical properties of branch D, e.g., for Anc110 and rh8, position 1 is a basic lysine in branch D serotypes compared to threonine in branch I, and serine in AAV9, both hydroxyl residues. The method of identifying phenotypic switches that occur along the reconstituted phylogeny, and then interrogating the conserved differences between two different lineages of the phenotype of interest in order to map the responsible structural determinants is referred to as phenotype-phylogeny mapping.

Example 25-functional motifs conferring AAPC-independent Assembly and VP protein stability can be transferred to heterologous capsids In

To test whether 10 sites constitute a motif that plays a role in capsid assembly, the identity of branch I was moved to members of branch D and tested to determine whether the resulting hybrid acquired AAPC-independent assembly function. Anc82, node branching off branch I, was selected as the background for these mutations; as the closest branch I serotype, it is more likely to tolerate several target mutations and retain functionality than more distant serotypes. All 10 sites in Anc82 were all mutated to branch I homologues by site-directed mutagenesis, resulting in a variant named 82DI (fig. 4A). 82DIAAPstop60 acquired AAPC-independent assembly function (FIG. 4B). To determine the minimal motif required to confer this phenotype, each site was individually reverted to its branch D identity. All revertants were AAP-dependent (fig. 4C), confirming that the 10 sites identified using phenotype-phylogenetic mapping constitute not only functional motifs critical for capsid assembly, but also the minimal motifs required for AAPC-independent assembly in this subgroup of serotypes.

It was then assessed whether the DI motif affects VP protein stability. Consistent with other AAP-dependent serotypes (fig. 2B), Anc82 showed a significant reduction in VP levels in AAPstop60 disorders, while 82 diapstop 60 did not (fig. 4D). To correctly classify the AAP phenotype of 82DI, Anc82 and DI's AAPstop20 were generated and protein loss in 82 dstop 20 was observed, indicating that 82DI is AAPC-independent (fig. 4D).

To evaluate the broader effect of AAPC-independent assembly on the capsid as a whole, the biophysical properties and transduction potential of 82DI were further characterized, compared to its parent strain Anc82. T of 82DI_mLower by 5 ℃ than Anc82 (fig. 4E), which is the main indicator of a biophysically distinct entity (Pacouret et al, 2017, mol. ther, 25: 1375-86). Consider T for Anc82 versus 82DI_mAnd significant changes in AAP phenotype, both variants were tested for infectivity. 82DI in vitro (FIG. 12A) and in vivo (FIG. 4F)&12B) Both remain infectious and transduction can be modestly increased compared to Anc82.

Example 26 candidate residues for AAP-independent Assembly at the VP trimer interface

To examine how this motif affects particle assembly, the positions of these residues within the three-dimensional folds of the VP and within the assembled capsid were located. Although the crystal structure of AncAAV is not available, terminal branch D (AAV8) and branch I serotype (AAV9) (DiMattia et al, 2012, J.Virol., 86: 6947-58; Nam et al, 2007, J.Virol., 81: 12260-71) have been resolved and used as a surrogate to locate the DI motif. Two of the 10 sites are located in the unstructured region at the VP N-terminus, but only site 1 is outside VP 3. Of the eight sites within the structural region of VP, seven are located at the triple interface of the VP trimer and are in contact with the adjacent monomer (FIGS. 5A-C). Comparing AAV8 (AAP-dependent) trimer and AAV9 (AAPC-independent) trimer at the atomic level, most of these sites showed strong evidence of inter-monomer interactions within the AAPC-independent trimer that were stronger than the AAP-dependent trimer (fig. 5D-F). For example, the conserved glutamate forms a salt bridge with the histidine of the adjacent monomer at position 7 in the AAV9 trimer, but not with the leucine at position 7 in AAV8 (fig. 5D). On AAV9, a hydrogen bond is formed between the conserved asparagine and glutamine at position 8 adjacent to the VP monomer. In AAV8, this bond was not achieved due to Gln substitution to Ala (fig. 5E). Position 10 is in the tri-fold axis and, under the conservation of phenylalanine, the valine residue in AAV9 creates a much larger network of hydrophobic interactions than the alanine residue in AAV8 (fig. 5F). In addition, site 10 interactions exist simultaneously between all three monomers of the trimer. These observations suggest that this motif contributes to trimer stabilization in AAPC-independent serotypes, and may contribute to nucleated capsid assembly in the absence of full-length AAP.

Example 27 AAPC-independent Shell nucleation

Next, it is hypothesized that VP of AAPC-independent AAV can associate into oligomers without AAPC, whereas VP of AAP-dependent serotypes do not strongly associate unless full-length AAP is present. To test this theory, the VP-VP interactions of AAP-dependent and AAPC-independent AAV were evaluated by co-immunoprecipitation of VP3 with HA-labeled VP1 (as bait) (fig. 6A-B). The tested AAPC-independent VP1s, AAV3 and 82DI, were able to co-precipitate VP3 in the absence of full-length AAP, despite low levels of VP3 in the input. In contrast, neither AAP-dependent AAV2 nor Anc82 VP1 co-precipitated significant VP3, although the input levels were appreciable (fig. 6B). Addition of AAP2 allowed for VP3 co-precipitation in AAP-dependent serotypes, and unknown VP species (labeled with x, fig. 6B) co-precipitated between the predicted molecular weights of VP2 and VP3 in AAPC-independent serotypes. These may be VP 2-like proteins translated from another start codon, or VP 1N-terminal cleavage/degradation products stabilized by AAP. These data support the above hypothesis, despite significant increases in Anc82 and AAV3 VP3 input levels under + AAP conditions.

To begin to examine whether AAP promotes oligomerization into geometrically defined species, such as trimers or pentamers, or whether the increase in VP-VP interactions observed through coinp is a more random association, a cross-linking agent was added to transfected cell lysates and VP species analyzed by Western blot (fig. 6C). In the presence of AAP, a hyper-shifted VP band of about 97kDa appears when DSG (7 angstrom cross-linking arms) is added, while a slightly larger hyper-shifted doublet appears when DSS (11 angstrom cross-linking arms) is added. Although it is difficult to determine the molecular weight of the cross-linked species due to unpredictable migration patterns, the discrete bands indicate that AAP promotes VP-VP interactions of defined geometry or number of monomers, but may also indicate increased binding of VP to host proteins involved in capsid assembly, which is AAP-promoted binding.

To further ensure that VP oligomerization processes were performed separately from their assembly into complete capsids, IP experiments were repeated with AAV2 VP, adding rep, aap2, helper and ITR flanking reporter genomic plasmids in trans to allow quantification of the assembled DRP (fig. 13A). Only appreciable amounts of the genome were detected in the input and supernatant fractions, but not in the IP fraction. ELISA quantification of fully assembled capsids reflects these results (fig. 13B), indicating that only oligomerized VP was precipitated. Taken together, these data support that, in addition to the role of AAP in VP protein stability, AAP promotes oligomerization of VP protein to nucleate the assembly of icosahedrons, which could potentially increase the efficiency of the capsid assembly process.

Other embodiments

It will be understood that while the combination of methods and materials has been described herein in connection with a number of different aspects, the foregoing description of the various aspects is intended to illustrate and not limit the scope of the combination of methods and materials. Other aspects, advantages, and modifications are within the scope of the following claims.

The disclosed methods, combinations, and other materials are disclosed as described herein, but it is understood that combinations, subsets, interactions, groups, etc. of these methods, combinations, and other materials are also disclosed. That is, although specific reference may not have been explicitly made to various individual and collective combinations and permutations of these combinations and methods, each is specifically contemplated and described herein. For example, if a particular combination of materials or a particular method is disclosed and discussed and a number of combinations or methods are discussed, each and every combination and method and all combinations and permutations are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed.

Claims (23)

1. An adeno-associated virus (AAV) capsid polypeptide comprising an amino acid sequence having at least 95% sequence identity with the amino acid sequence of SEQ ID NO. 3.

2. The AAV capsid polypeptide of claim 1, having at least 99% sequence identity to the amino acid sequence of SEQ ID No. 3.

3. The AAV capsid polypeptide of claim 1, having the amino acid sequence of SEQ ID NO 3.

4. The AAV capsid polypeptide of claim 1, encoded by the nucleic acid sequence of SEQ ID NO 4.

5. A viral particle comprising an adeno-associated virus (AAV) capsid polypeptide according to any of claims 1-4.

6. The viral particle according to claim 5, further comprising a transgene.

7. A nucleic acid molecule comprising a nucleic acid sequence having at least 95% sequence identity to the nucleic acid sequence of SEQ ID No. 4 and encoding an adeno-associated virus (AAV) capsid polypeptide.

8. The nucleic acid molecule of claim 7, having at least 99% sequence identity to the nucleic acid sequence of SEQ ID NO. 4.

9. The nucleic acid molecule of claim 7 having the nucleic acid sequence of SEQ ID NO 4.

10. The nucleic acid molecule of claim 7 encoding the amino acid sequence of SEQ ID NO 3.

11. A vector comprising the nucleic acid molecule of any one of claims 7-10.

12. A host cell comprising the nucleic acid molecule of any one of claims 7-10 or the vector of claim 11.

13. The host cell of claim 12, wherein the host cell is a packaging cell.

14. A packaging cell comprising a nucleic acid molecule encoding an adeno-associated virus (AAV) capsid polypeptide, wherein the AAV capsid polypeptide has at least 95% sequence identity to the amino acid sequence of SEQ ID No. 3.

15. The packaging cell of claim 14, wherein the packaging cell lacks the Assembly Activating Protein (AAP).

16. A method of reducing Assembly Activating Protein (AAP) dependency of an adeno-associated virus (AAV), the method comprising providing an AAV having a capsid polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 3.

17. A method of at least partially alleviating Assembly Activating Protein (AAP) dependency of an adeno-associated virus (AAV), the method comprising incorporating into the AAV a capsid polypeptide having at least 95% sequence identity to the amino acid sequence of SEQ ID No. 3.

18. A method of engineering an adeno-associated virus (AAV) to reduce its dependence on an Assembly Activating Protein (AAP), the method comprising engineering an AAV comprising a capsid polypeptide having at least 95% sequence identity with the amino acid sequence of SEQ ID NO: 3.

19. The method of any one of claims 16-18, further comprising culturing the adeno-associated virus (AAV) in the absence of the Assembly Activating Protein (AAP).

20. The method of claim 18, further comprising sequencing the engineered adeno-associated virus (AAV).

21. The method of claim 18, further comprising comparing the Assembly Activating Protein (AAP) dependence of the engineered adeno-associated virus (AAV) relative to a non-engineered or wild-type AAV.

22. The method of claim 18, further comprising aligning the engineered adeno-associated virus (AAV) with a non-engineered or wild-type AAV.

An AAV capsid polypeptide comprising the amino acid sequence of SEQ ID NO 1 and further comprising an amino acid residue at a specified position for AAP dependency shown in Table 6.

Images