CN110819712B - Application of piRNA-26131 in preparation of thyroid cancer diagnosis and prognosis marker - Google Patents
Application of piRNA-26131 in preparation of thyroid cancer diagnosis and prognosis marker Download PDFInfo
- Publication number
- CN110819712B CN110819712B CN201911054695.0A CN201911054695A CN110819712B CN 110819712 B CN110819712 B CN 110819712B CN 201911054695 A CN201911054695 A CN 201911054695A CN 110819712 B CN110819712 B CN 110819712B
- Authority
- CN
- China
- Prior art keywords
- pirna
- thyroid cancer
- cells
- application
- blood
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an application of piRNA-26131 in preparing a thyroid cancer diagnosis and prognosis marker. The second aspect of the invention provides an application of piRNA-26131 in preparing a kit for diagnosing thyroid cancer or judging whether thyroid cancer recurs. In addition, the invention also provides a method for detecting piRNA-26131 in thyroid cancer tissues or blood for non-diagnostic and therapeutic purposes. After the piRNA-26131 is over-expressed or knocked down, the proliferation and invasive metastasis capacities of thyroid cancer cells are obviously enhanced or weakened, and the recurrence probability of a patient with high piRNA-26131 expression is high, so that the piRNA-26131 can be used as a blood screening molecular marker for early screening and tumor recurrence indexes of thyroid cancer patients, and has important significance and application prospect.
Description
Technical Field
The invention relates to the field of biological medicine, in particular to application of piRNA-26131 in preparation of a thyroid cancer diagnosis and prognosis marker.
Background
Thyroid cancer is one of the most common malignant tumors of the endocrine system, accounts for about 2% of the malignant tumors of the whole body, is mostly developed in young and middle-aged people of about 40 years old, and is statistically shown to have an increasing trend of the incidence rate year by year. At present, the clinical early diagnosis of thyroid cancer still adopts limited examination methods such as physical examination and imaging, has certain limitation and lacks early warning value. The commonly used diagnostic markers are easily confused with thyroiditis and thyroid nodules, so misdiagnosis is easily caused. With the continuous progress of molecular biology technology, in order to meet the requirements of clinical diagnosis for improving sensitivity and specificity, the development of new blood tumor markers is imperative.
The PIWI-interacting RNA (PiRNA for short) is a newly discovered small molecular RNA, has a length of 26-31 nt single-stranded non-coding RNA, and plays an important functional role in gene expression regulation and transposon inhibition. Although early studies suggest that piRNA plays an important role in reproductive development, more and more studies report that piRNA is closely associated with tumorigenesis. At present, researches prove that piRNA is abnormally expressed in various tumors such as endometrial cancer, pancreatic cancer, gastric cancer, liver cancer, breast cancer and the like, and that specific piRNA in tumor cells can be disturbed to influence cell malignant phenotypes such as proliferation, metastasis, invasion and the like. In addition, the piRNA plays an important role in maintaining the stability of the genome and ensuring the normal function of the cell. It is known that DNA or mRNA having transposon (Transposons) sequences is present in mammals, and that one DNA sequence can be inserted into another. The research finds that the rotor sequence accounts for nearly 40% of the genome, and once the jumping genes are disordered, the genome is caused to be devastating, and tumors are generated. However, there are currently no reports of thyroid cancer and associated pirnas.
Disclosure of Invention
In order to overcome the defects in the prior art, the invention provides the application of the piRNA-26131 in the preparation of a thyroid cancer diagnosis and prognosis marker, the piRNA-26131 has excellent tissue specificity and correlation, and an enlarged sample is quantitatively detected in real time by an RT-PCR method, so that a novel molecular marker is provided for early diagnosis and recurrence of thyroid cancer.
In order to realize the purpose, the invention adopts the following technical scheme:
the first aspect of the invention is the application of piRNA-26131 in the preparation of a thyroid cancer diagnosis and prognosis marker.
Further, the gene sequence of piRNA-26131 is:
TTTGGCAATGGTAGAACTCACACTGGTGAGGT。
the second aspect of the invention provides an application of piRNA-26131 in preparing a marker for diagnosing thyroid cancer or judging whether thyroid cancer recurs.
In a third aspect, the invention provides the use of piRNA-26131 in the preparation of a kit for diagnosing thyroid cancer or determining whether thyroid cancer is recurrent, said kit comprising reagents for detecting the expression level of piRNA-26131 in a tissue of a subject.
Further, the kit comprises reagents for detecting the expression level of piRNA-26131 in the blood of a subject.
In a fourth aspect, the invention provides a method for detecting piRNA-26131 in thyroid cancer tissue or blood for non-diagnostic and therapeutic purposes, comprising the steps of:
(1) Blood and tissue sample collection and processing;
(2) RNA extraction;
(3) Quantification and reverse transcription of RNA: after the concentration of RNA is measured by using a spectrophotometer, preparing reverse transcription reaction liquid and setting program parameters;
(4) The cDNA obtained by reverse transcription is used as a template, and the expression level of the piRNA-26131 is detected and analyzed by a qPCR technology.
Further, the tissue includes tissue that is thyroid cancer or tissue adjacent to the cancer.
Further, the thyroid cancer is TPC1, BCPAP cell line.
Further, the primer used in the process of step (3) is a primer reverse transcribed with piRNA-26131 as a template.
Further, the program parameters in step (3) are: 60min at 42 ℃, and 10min at 70 ℃.
Further, the primer used in the process of step (4) is a primer for amplifying a template, which is a cDNA reverse transcribed from piRNA-26131.
Further, the program parameters set in the qPCR process of step (4) are: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 2sec, annealing at 60 ℃ for 20sec, elongation at 70 ℃ for 10sec, and 40 cycles.
Compared with the prior art, the invention has the following beneficial effects by adopting the technical scheme:
the invention discloses the application of the piRNA-26131 in the preparation of thyroid cancer diagnosis and prognosis markers for the first time, and the kit for detecting the piRNA-26131 is prepared, so that a new strategy can be provided for the diagnosis and recurrence of thyroid cancer.
Drawings
FIG. 1 is a graph showing the results of high throughput sequencing of piRNA in 5 pairs of abnormally expressed piRNA in thyroid cancer and its paired paraneoplastic tissues in an embodiment of the present invention;
FIG. 2 is a graph showing the difference between the expression of piRNA-26131 in thyroid cancer tissue and in the tissue adjacent to the cancer detected by qRT-PCR method according to an embodiment of the present invention;
FIG. 3 is a graph showing the results of the qRT-PCR method for detecting the expression level of piRNA-26131 in the blood of normal volunteers, the preoperative blood of thyroid cancer patients and the blood of relapsed patients in one embodiment of the present invention;
FIG. 4 is a graph showing the expression of piRNA-26131 in TPC1 cells, BCPAP cells and normal thyroid cells after treatment with mimetics and inhibitors of piRNA-26131 in one embodiment of the present invention;
FIG. 5 is a graph showing the results of measuring the effect of piRNA-26131 expression on the proliferation of TPC1 and BCPAP cells in thyroid cancer cells in one embodiment of the present invention;
FIG. 6 is a graph showing the results of examining the Invasion and migration capabilities of both the invadeion and Transwell cells of thyroid cancer cells after transfection of a mimic and inhibitor of piRNA-26131 in one embodiment of the present invention;
FIG. 7 is a graph showing the results of testing the apoptotic ability of thyroid cancer cells transfected with a mimic and inhibitor of piRNA-26131 in one embodiment of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The invention is further described with reference to the following drawings and specific examples, which are not intended to be limiting.
The thyroid cancer piRNA marker piRNA-26131 provided by the invention is verified to be used as a diagnostic and prognostic marker of thyroid cancer through the following specific examples.
Example one
In this example, differentially expressed piRNAs were screened in thyroid cancer tissues and paired paracarcinoma tissue samples by high throughput sequencing. Wherein, all thyroid cancer and paired paracancerous tissues are collected in the ten people hospital pathology department in Shanghai city and verified by pathological examination. Patients informed and agreed to the samples for this study, and the study was approved and conducted by the ethical scientific committee of the university of congruence.
As can be seen from fig. 1, the expression level of 23 pirnas was significantly down-regulated, and 5 pirnas were significantly highly expressed in thyroid cancer tissues, including piRNA-26131. Therefore, the expression difference of the piRNA-26131 in the thyroid cancer and the paracancerous tissues of the thyroid cancer and the expression difference of the blood of a normal volunteer, the preoperative blood of a thyroid cancer patient and the blood of a thyroid cancer relapse patient are detected by a qPCR method to verify that the piRNA-26131 is positively correlated with the thyroid cancer.
The specific experimental procedure is as follows:
(1) Extraction of RNA
Among them, the thyroid cancer tissue sample was miRNeasy Mini Kit (Cat #217004, qiagen) and the Blood sample was RNA Blood Mini Kit (Cat #52304, qiagen).
1) The extraction of RNA in tissues comprises the following specific steps:
1. about 50mg of the tissue was added to 700. Mu.l of QIAzol lysate, ground and left at room temperature (15-25) ℃ for 5 minutes, then added to 140. Mu.l of chloroform solution, immediately vortexed and mixed, then left at room temperature for 2-3 minutes, centrifuged at 4 ℃ for 12000, X g for 15 minutes, and then the supernatant was collected in another new 1.5ml centrifuge tube, added to 525. Mu.l of 100% absolute ethanol, and mixed several times by inversion.
2. Mu.l of the mixture was taken out and put into RNeasy Mini spin column (RNeasy Mini spin column), centrifuged at room temperature 8000X g for 15 seconds, and the precipitate was discarded (this step was repeated when the first step was larger than 700. Mu.l).
3. To RNeasy Mini spin column was added 700. Mu.l Buffer RWT, centrifuged at 8000X g at room temperature for 15 seconds, and the precipitate was discarded.
4. To RNeasy Mini spin column was added 500. Mu.l Buffer RPE, centrifuged at room temperature 8000X g for 15 seconds, and the precipitate was discarded.
5. To RNeasy Mini spin column was added 500. Mu.l Buffer RPE, centrifuged at room temperature 8000X g for 2 minutes, and the precipitate was discarded.
6. RNeasy Mini spin column was placed in another new 2ml collection tube, centrifuged at 8000X g at room temperature for 1 min, and the pellet was discarded.
7. Then putting RNeasy Mini spin column into another new 1.5ml centrifuge tube, adding 30-50 μ l of water for removing RNase, and centrifuging at room temperature of 8000X g for 1 min to obtain the precipitate as RNA.
8. RNA concentration was measured spectrophotometrically using NanoDrop ND-1000 for future use.
2) The extraction of RNA in blood comprises the following steps:
1. fresh blood and EL Buffer 1:5 times are evenly mixed and placed on ice for 10-15 minutes, then 4-degree 400X g is centrifuged for 10 minutes, supernatant is discarded, 2 times EL Buffer is added and evenly mixed and placed on ice for 10-15 minutes, then 4-degree 400X g is centrifuged for 10 minutes, and the supernatant is discarded.
2. Add 600 u l RLT lysate vortex mixing, and then transferred to the QIAshredder spin column in the maximum speed centrifugation for 2 minutes, collect the centrifugate, then added 600 u l 70% ethanol and mixed, then transferred to new QIAamp spin column, room temperature 8000X g centrifugation for 15 seconds, abandon the precipitation (if the liquid is greater than 700 u l repeat the step).
3. The QIAamp spin column was transferred to another new 2ml collection tube and centrifuged for 15 seconds in 500. Mu.l RPE Buffer at room temperature 8000X g.
4. To the QIAamp spin column, 500. Mu.l of RPE Buffer was added and centrifuged at room temperature 20000X g for 3 minutes.
5. The QIAamp spin column was then placed in another new 2ml collection tube and centrifuged at room temperature 20000X g for 3 minutes
6. And then the QIAamp spin column is put into another new centrifugal tube with 1.5ml, 30-50 mul of water for removing the RNase is added, and the mixture is centrifuged for 1 minute at room temperature of 8000X g, and the precipitation solution is RNA.
7. RNA concentration was measured spectrophotometrically using NanoDrop ND-1000 for future use.
(2) Reverse transcription: the following reverse transcription reaction solution was prepared in 200. Mu.l of RNase-free centrifuge tube
Reverse transcription reactions were performed on a PCR instrument according to the following procedure: 60min at 42 ℃, and 10min at 70 ℃.
The reverse transcription product was stored at-20 ℃ or used in subsequent experiments.
(3) qPCR: and (3) detecting and analyzing the expression level of the piRNA-26131 by using cDNA obtained by reverse transcription in the step (2) as a template through a qPCR (quantitative polymerase chain reaction) technology.
The reaction solution was prepared according to the following qPCR reaction system
The reaction procedure was as follows: pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 2sec, annealing at 60 ℃ for 20sec, extension at 70 ℃ for 10sec,40 cycles.
As can be seen from FIG. 2, the expression level of piRNA-26131 in 78.8% of thyroid cancer tissues is significantly higher than that in paraneoplastic tissues.
As can be seen from FIG. 3, the expression level of piRNA-26131 in the blood of normal volunteers, preoperative blood of thyroid cancer patients and the blood of thyroid cancer recurrence patients was significantly increased in this order.
Example 2
This example demonstrates the effect of piRNA-26131 on the metastatic potential of thyroid cancer cells.
The method specifically comprises the following steps:
(1) Thyroid cancer cell culture: TPC1 cells were cultured in RPMI1640 medium containing 10% fetal bovine serum, BCPAP cells were cultured in RPMI1640 medium containing 10% fetal bovine serum and NEAA, and thyronormal cells were cultured in DMEM medium containing 10% fetal bovine serum, all cells were at 37 ℃ and 5% CO 2 And culturing in a saturated humidity cell constant temperature incubator.
(2) CCK8 proliferation assay: the CCK8 assay was performed 24 hours after transient transfection of the mimic and inhibitor of piRNA-26131 into thyroid cancer cells: the old medium was poured off and rinsed 1 time with PBS; adding appropriate amount of 0.25% trypsin, digesting at 37 deg.C until the cell is withdrawn and the processes become round or the cell gap is enlarged,immediately adding a complete culture medium to stop digestion to form a cell suspension; sucking into a 15ml centrifuge tube, and centrifuging for 5min at 1000 r/m; the supernatant was decanted, 1ml of complete medium was added to resuspend the cells, and the cells were counted; diluting cells with complete medium to 50000 cells/ml medium, adding cells to a 96-well plate, making 3 multiple wells with 100 μ l cell suspension per well; 37 ℃ and 5% of CO 2 Culturing in incubator for 24, 48, 72, 96h, adding 10 μ l CCK8 reagent into each well, culturing for 2h, and measuring absorbance at 450 nm.
(3) Transwell experiment (tumor cell migration invasion experiment): transwell experiments were performed 24 hours after transient transfection of mimics and inhibitors of piRNA-26131 into thyroid cancer cells: the old medium was poured off and rinsed 1 time with PBS; adding a proper amount of 0.25% trypsin, digesting at 37 ℃ until the cells are recovered, and immediately adding a complete culture medium to stop digestion to form a single cell suspension; sucking into a 15ml centrifuge tube, and centrifuging for 5min at 1000 r/m; the supernatant was decanted, 1ml of Opti-MEM serum-free medium was added to resuspend the cells, and the cells were then diluted to 1.0X 10 with Opti-MEM serum-free medium after counting 5 Cells/ml, 200. Mu.l cell suspension/well inoculated into the upper chamber (membrane pore size 8 μm) of a Transwell plate, 600. Mu.l complete medium containing 10% serum in the lower chamber; 37 ℃ and 5% of CO 2 Performing conventional culture in an incubator; after 24h, the Transwell plate was removed, rinsed 2 times with PBS, the upper chamber was stained with 0.1% crystal violet at room temperature for 20min, rinsed 2-3 times with PBS, the cells on the upper layer of the filter membrane were gently wiped off with a cotton swab, and photographed under an inverted microscope after drying.
(4) Invasion assay (tumor cell Invasion assay): the invasion experiment was performed 24 hours after transient transfection of the mimic and inhibitor of piRNA-26131 into thyroid cancer cells: to a Chamber pre-coated with Matrigel was added 300. Mu.l of serum-free basal medium, hydrated at 37 ℃ in an incubator for 1 hour, and the medium was removed. The old medium was poured off and rinsed 1 time with PBS; adding a proper amount of 0.25% trypsin, digesting at 37 ℃ until the cells are recovered, and immediately adding a complete culture medium to stop digestion to form a single cell suspension; sucking into a 15ml centrifuge tube, and centrifuging for 5min at 1000 r/m; the supernatant was decanted off and 1ml of Opti-MEM was addedResuspending the cells in clear medium, then after counting the cells, diluting the cells to 1.0X 105 cells/ml with Opti-MEM serum-free medium, seeding the upper chamber with 200. Mu.l cell suspension/well, 600. Mu.l complete medium containing 10% serum in the lower chamber; 37 ℃ and 5% of CO 2 Performing conventional culture in an incubator; after 24h, the Chamber plate was removed, rinsed 2 times with PBS, the upper Chamber was stained with 0.1% crystal violet at room temperature for 2 min, rinsed 2-3 times with PBS, the cells on the upper layer of the filter membrane were gently wiped off with a cotton swab, and photographed under an inverted microscope after air-drying.
(5) Detecting apoptosis by flow cytometry: apoptosis experiments were performed 24 hours after transient transfection of piRNA-26131 mimics and inhibitors into thyroid cancer cells: the old medium was poured off and rinsed 1 time with PBS; adding a proper amount of trypsin without EDTA, digesting at 37 ℃ until the cells recover and become round, and immediately adding a complete culture medium to stop digestion to form a single cell suspension; sucking into a 15ml centrifuge tube, and centrifuging for 5min at 1000 r/m; washing with 1 XPBS 2 times 10 times 5 Each cell was examined on a machine with 50. Mu.l of 1 Xbuffer and 2.5. Mu.l of Annexin-V protected from light at 4 ℃ for 30min, then 250. Mu.l of 1 Xbuffer and 2.5. Mu.l of PI at room temperature for 5 min.
(6) Statistical analysis: experimental data were statistically analyzed using SPSS13.0 software.
As can be seen from FIG. 4, piRNA-26131 is significantly low expressed in TPC1 cells transfected with piRNA-26131 inhibitor, significantly high expressed in BCPAP cells transfected with piRNA-26131 mimic, and very low expressed in normal thyroid cells (FIG. 4A); mimetics and inhibitors significantly reversed piRNA-26131 expression in TPC1 and BCPAP cells (fig. 4B and 4C).
As shown in FIG. 5, the expression of piRNA-26131 has significant effect on the proliferation of both TPC1 and BCPAP cells in thyroid cancer cells. CCK8 experiment found that the proliferation capacity of TPC1 cells after transient transfection of piRNA-26131 mimics is higher than that of a control group (FIG. 5A), and that the proliferation capacity of BCPAP cells after transient transfection of piRNA-26131 inhibitor is lower than that of the control group (FIG. 5B).
As can be seen from FIG. 6, after TPC1 cells were transiently transfected with piRNA-26131 mimetics, the Invasion migration ability of cells was significantly higher than that of the control group, and after BCPAP cells were transiently transfected with piRNA-26131 inhibitor, the Invasion migration ability of cells was significantly lower than that of the control group. Thus, piRNA-26131 promotes metastasis of thyroid cancer cells in vitro.
As shown in FIG. 7, TPC1 cells transiently transfected with piRNA-26131 mimetics inhibited the apoptotic ability of the cells; BCPAP cells are transiently transfected with the piRNA-26131 inhibitor to promote the apoptotic capacity of the cells. Thus, piRNA-26131 inhibits apoptosis of thyroid cancer cells.
In conclusion, the piRNA-26131 can be used as a blood screening molecular marker for early screening and tumor recurrence index of thyroid cancer patients, and has important significance and application prospect.
The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. It will be appreciated by those skilled in the art that any equivalent modifications and substitutions are within the scope of the present invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.
Claims (2)
1. The application of the reagent for detecting the expression level of the piRNA-26131 in preparing the kit for diagnosing thyroid cancer or judging whether the thyroid cancer recurs is characterized in that the kit comprises the reagent for detecting the expression level of the piRNA-26131 in thyroid cancer tissues.
2. The use of claim 1, wherein the kit comprises reagents for detecting the expression level of piRNA-26131 in the blood of a subject.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911054695.0A CN110819712B (en) | 2019-10-31 | 2019-10-31 | Application of piRNA-26131 in preparation of thyroid cancer diagnosis and prognosis marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911054695.0A CN110819712B (en) | 2019-10-31 | 2019-10-31 | Application of piRNA-26131 in preparation of thyroid cancer diagnosis and prognosis marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110819712A CN110819712A (en) | 2020-02-21 |
| CN110819712B true CN110819712B (en) | 2023-03-31 |
Family
ID=69552150
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911054695.0A Active CN110819712B (en) | 2019-10-31 | 2019-10-31 | Application of piRNA-26131 in preparation of thyroid cancer diagnosis and prognosis marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110819712B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106994117A (en) * | 2016-01-25 | 2017-08-01 | 上海市肿瘤研究所 | A kind of medicament nano compound temperature-sensitive gel for treating biliary tract neoplasms |
| CN110157808A (en) * | 2019-06-04 | 2019-08-23 | 河北医科大学第二医院 | A kind of application of non-coding RNA relevant to larynx squamous carcinoma occurrence and development |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP6864990B2 (en) * | 2015-04-16 | 2021-04-28 | 日東電工株式会社 | A cell death inducer for cells having a BRAF gene mutation, a growth inhibitor of the cells, and a pharmaceutical composition for treating a disease caused by abnormal growth of the cells. |
-
2019
- 2019-10-31 CN CN201911054695.0A patent/CN110819712B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106994117A (en) * | 2016-01-25 | 2017-08-01 | 上海市肿瘤研究所 | A kind of medicament nano compound temperature-sensitive gel for treating biliary tract neoplasms |
| CN110157808A (en) * | 2019-06-04 | 2019-08-23 | 河北医科大学第二医院 | A kind of application of non-coding RNA relevant to larynx squamous carcinoma occurrence and development |
Non-Patent Citations (3)
| Title |
|---|
| "PIWI-interacting RNAs piR-13643 and piR-21238 are promising diagnostic biomarkers of papillary thyroid carcinoma";Zhengyan Chang等;《AGING》;第12卷(第10期);第9292-9310页 * |
| "Small Non-coding RNA Abundance in Adrenocortical Carcinoma: A Footprint of a Rare Cancer";Srinivas V. Koduru等;《Journal of Genomics》;第5卷;第99-118页 * |
| "基于分子生物学的甲状腺癌诊疗进展";沈雷等;《外科研究与新技术》;第4卷(第3期);第196-200页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110819712A (en) | 2020-02-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107447033B (en) | Colorectal cancer diagnosis biomarker and application thereof | |
| CN102776185B (en) | Liver cancer diagnostic marker composed of blood plasma microRNA (micro ribonucleic acid) and new method for diagnosing liver cancer | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| WO2011121610A1 (en) | Micrornas (mirna) as biomarkers for detecting different grades of gliomas and pathways of glioma progression | |
| JP5753905B2 (en) | A diagnostic kit for hepatocellular carcinoma comprising a diagnostic marker for hepatocellular carcinoma comprising a combination of plasma microRNAs | |
| CN108034725B (en) | Application of LINC02185 in diagnosis and treatment of breast cancer | |
| WO2018219264A1 (en) | Use of long-chain non-coding rna as prostatic cancer molecule marker | |
| CN111394458A (en) | Application of PTBP1 as marker for diagnosing and treating osteosarcoma chemotherapy resistance | |
| CN109402262B (en) | PCR detection kit for auxiliary diagnosis of neuroblastoma and method for detecting miR-199a-3p expression level | |
| CN107312855B (en) | Gene related to laryngeal squamous cell carcinoma and application thereof | |
| CN111979315A (en) | Application of annular TP63 as lung squamous carcinoma diagnosis or treatment target | |
| CN110819712B (en) | Application of piRNA-26131 in preparation of thyroid cancer diagnosis and prognosis marker | |
| CN108165631B (en) | Osteosarcoma biomarker SYT12 and application thereof | |
| CN112029864B (en) | Breast cancer miRNA detection kit and application thereof | |
| CN109251983B (en) | FRS2 gene copy number amplification and application thereof, and specific primer pair for detecting copy number amplification | |
| CN108841961B (en) | Application of the LINC01702 in the diagnostic kit of preparation hepatocellular carcinoma | |
| CN107385081B (en) | Gene related to kidney cancer and application thereof | |
| CN102686745B (en) | Method for analyzing cervical lymph node metastasis, and tumor marker for head and neck cancer | |
| CN110592218B (en) | Biomarker for diagnosing and treating breast cancer | |
| CN116694761B (en) | PiRNA marker for diagnosing breast cancer chemotherapy heart injury, kit and application thereof | |
| CN116240283B (en) | Application of OMA1 in reversing acute lymphoblastic leukemia drug resistance | |
| CN115820845B (en) | Polyadenylation functional site marker related to colorectal cancer diagnosis and application thereof | |
| CN114752676B (en) | Application of reagent for detecting hsa_circ_0099132 in preparation of auxiliary diagnosis kit for colorectal cancer of human | |
| CN108165624A (en) | Application of the biomarker in osteosarcoma diagnosis and treatment | |
| CN113373229B (en) | Gastric cancer related biomarker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |