CN110819657A

CN110819657A - Preparation method and application of attenuated rhabdovirus

Info

Publication number: CN110819657A
Application number: CN201810913350.5A
Authority: CN
Inventors: 秦晓峰; 吴飞
Original assignee: Suzhou Ultralmmune Co ltd
Current assignee: Ruifengkang Biomedical Technology Zhejiang Co ltd
Priority date: 2018-08-10
Filing date: 2018-08-10
Publication date: 2020-02-21
Anticipated expiration: 2038-08-10
Also published as: CN110819657B

Abstract

The present disclosure relates to a method for preparing attenuated rhabdovirus and its application. In particular, the present disclosure provides a method for preparing an attenuated viral vector by which an attenuated RNA viral recombinant expression vector system can be prepared that chimerically expresses antibodies directed against a specific target, such as an attenuated viral vector system targeted to a tumor microenvironment. The aforementioned vector system can stably express the corresponding antibody against a specific target. The vector disclosed by the invention has wide host cell sources, and the in vivo and in vitro expression efficiency of the exogenous chimeric antibody-like body is greatly improved; meanwhile, the genome of the vector system is simple and stable, the mutation rate is low, and the humanized specific antibody can be quickly and efficiently chimeric expressed. Moreover, the vector system disclosed by the invention is subjected to gene mutation modification, so that the toxicity of the virus is reduced, and the normal cells of a host are not obviously damaged when the antibody is expressed.

Description

Preparation method and application of attenuated rhabdovirus

Technical Field

The present disclosure relates to the fields of oncology, virology and molecular cell biology. In particular, the present disclosure relates to a vector system using non-integrated, replicable negative-sense strand RNA viruses, a method of constructing the same, and uses of the vectors constructed by the above method.

Background

The range of options for cancer patient treatment options has changed tremendously over the past decade. With the knowledge of the growth and development of the related driver mutations (driver mutation) of tumors and the development of the research and development of the specific mutant targeting molecule inhibitors, a new tumor treatment field, namely precise oncology, ensues, and the theoretical basis of tumor immunotherapy is that the immune system has the capacity of recognizing tumor-related antigens and regulating and controlling the body to attack tumor cells (highly specific cytolysis). This biological process is very complex and is still under considerable basic research.

In the last 90 s of the century, several research groups have discovered tumor antigens that can be recognized by T lymphocytes in a major histocompatibility complex-dependent manner. In some cases, antigens are often referred to as viral proteins, mutated self-antigens (some of which are driver oncogenes), derepressed embryonic antigens, over-expressed differentiated or autologous normal proteins. Tumor cells produce and release antigens in a variety of ways, such as intracellular kinases, primary necrosis of tumor cells, and the body's response to radiation, chemotherapy, or targeted therapies. In addition to antigens, in the context of cellular stress, hypoxia, nutrient depletion, and trauma, dead tumor cells can also release a variety of immunogenic molecules that can bind to cell surface or intracellular receptors (e.g., toll-like receptors) to trigger an innate immune response. In addition, specific antigen presenting cells (e.g., dendritic cells) in the tumor microenvironment can phagocytose dead tumor cells and soluble antigens, CD8+ T cells. To achieve better differentiation, T cell activation also sets a secondary signal recognition system, a signaling pathway mediated by co-stimulatory molecules. Once activated in the presence of co-stimulatory molecules, T cells can migrate into the tumor microenvironment following a concentration gradient of local chemokines. After the T cell reaches the vicinity of the tumor cell, the T cell receptor can recognize the cognate antigen on the surface of the tumor cell via MHC class I-polypeptide complexes. T cells can release cytotoxic factors (e.g., granzyme B and perforins) that can regulate direct lysis of antigen-expressing tumor cells while producing a bystander effect on adjacent non-antigen-expressing tumor cells. There are a number of activated effector lymphocytes present in the microenvironment of tumors that generally have a better prognosis and respond better to immunotherapy, and despite the existence of the tumor-immune cycle, established tumors may escape immune detection and elimination by a variety of hosts, tumors, and immune mechanisms.

In addition, studies have reported that tumor microenvironments accumulate a large number of suppressive immune cells, such as regulatory CD4+ positive T cells, tumor-associated macrophages, myeloid suppressive cells, which can suppress the activity of activated effector T cells. The manner in which tumor cells die may determine which immune response is activated. For example, apoptosis of tumor cells may induce T cell tolerance, while necrosis or apoptosis (pyroptosis) of tumor cells, programmed cell death may induce an activated tumor-specific T cell response

Cancer has long been at the head of various causes of death. The world health organization has long predicted that malignancies will become the "first killer" in humans in the 21 st century, and cancer control has become a key point of global health strategy. Although China is a developing country, the disease spectrum has been changed, and China has become the first cancer major country in the world. In recent years, the morbidity and mortality of malignant tumors are more serious, the number of new cases is about 160 ten thousand, the death number is 130 ten thousand, and more than 200 ten thousand of patients with the existing diseases are. Moreover, most cancers are on the rise and are worth high attention.

Although the cure rate for several malignancies has improved significantly, the outcome for patients with advanced solid tumors has remained crudely maintained over the past several decades. Currently, antibodies of tumor immune checkpoints, such as antibodies of PD-1/PDL1 and CTLA4, have been put into clinical use in solid tumors, and the key point of these monoclonal antibodies that effectively antagonize immune checkpoint molecules lies in the efficient production per unit volume, and in addition, the problem of drug resistance faced by immune checkpoint antibodies is urgently to be solved, and the research progress of tumor immunotherapy is currently receiving attention from various countries. A variety of immune-related tumor treatment strategies including T cell node inhibitors, oncolytic viruses, chimeric antigen receptor T cells, and the like have been derived. It is well known that efficient immunotherapy requires several major features: inducing a lasting clinical response; there is no typical drug resistance; inducing autoimmunity-like toxicity. Clinical oncologists need to have a thorough understanding of the current clinical application of tumor-targeted therapy and tumor immunotherapy, only to provide high quality treatment regimens for cancer patients. The rationale for tumor immunotherapy is that the immune system has the ability to recognize tumor-associated antigens, regulate the body's ability to attack tumor cells (highly specific cytolysis).

Some gene editing modified recombinant viruses are used as a new tumor treatment preparation, and the anti-tumor immune response is initiated through two action mechanisms of the killing action of the viruses on tumor cells and the induction of systemic anti-tumor immune response. However, the specific molecular mechanism is not clear, and some of the existing research results show that the mechanism is the combined action of various action factors such as the replication and proliferation of the virus in tumor cells to induce cell death, the interaction with the anti-virus elements of the tumor cells, and the promotion of the intrinsic spontaneous or specific anti-tumor immune response.

Vesicular Stomatitis Virus (VSV) is a negative strand RNA virus that infects most mammalian cells and expresses up to 60% of the total protein of the viral protein in the infected cells. In nature, VSV infects pigs, cattle and horses and causes varicella diseases near the mouth and feet. Although human infection with VSV has been reported, VSV does not cause any serious symptoms in humans. VSV encodes 5 proteins, including a nucleocapsid protein (N), a phosphoprotein (P), a matrix protein (M), a surface glycoprotein (G), and an RNA-dependent RNA polymerase (L). Blocking host cell protein synthesis by VSV matrix protein (M) induces cell death.

However, the existing medicines in the prior art still have the defects of long medication period, drug resistance, high price and the like. Therefore, there is a need to provide new medicaments to overcome the above-mentioned drawbacks.

Disclosure of Invention

Problems to be solved by the invention

Based on the deficiency of the prior art, the present disclosure provides an attenuated RNA virus recombinant expression vector system for chimeric expression of an antibody against a specific target, in particular an attenuated virus vector system (AVTM system) targeting tumor microenvironment. The aforementioned vector system can stably express the corresponding antibody against a specific target.

At the same time, the disclosure also relates to a preparation method and application of the attenuated virus vector system.

Means for solving the problems

The technical scheme related to the disclosure is as follows.

(1) A method for producing an attenuated viral vector, comprising the steps of:

(S1) mixing the nucleotide sequence of the gene encoding the vesicular stomatitis virus matrix protein, as set forth in SEQ ID NO: 1(M gene of VSV), with the first vector, and adding a transposase to perform a transposition reaction;

(S2) mixing the transposition product obtained in the step (S1) with competent bacteria, and transforming;

(S3) extracting the plasmid of the bacterium obtained by the step (S2) to obtain the gene encoding the vesicular stomatitis virus matrix protein after transposition;

(S4) recombining the gene obtained in the step (S3) into a second vector to obtain the attenuated viral vector;

wherein the sequence encoding the second vector comprises the genomic sequence of vesicular stomatitis virus;

wherein the first vector is selected from a vector having a transposition function;

optionally, the first vector comprises a sequence shown as SEQ ID NO. 2;

optionally, the second vector comprises a sequence as set forth in GENEBANK numbering EU 849003.1.

(2) An attenuated virus vector obtained by the production method of (1).

(3) The attenuated viral vector of (2), wherein the sequence encoding the attenuated viral vector comprises the sequence set forth in SEQ ID NO:3, and (b) is the sequence shown in the specification.

(4) The attenuated viral vector of (3), wherein the sequence encoding the attenuated viral vector comprises the sequence set forth in SEQ ID NO:4, or a sequence shown in the figure.

(5) A cloning scaffold vector system, characterized in that the cloning scaffold vector system recombines the sequence shown as SEQ ID NO. 5 into the vector described in (3); wherein, the site of the sequence shown in SEQ ID NO. 5 inserted into the vector coded in (3) is shown in SEQ ID NO:4, position 4632 of the sequence shown in fig. 4.

(6) The cloning scaffold vector system according to (5), wherein the sequence encoding the cloning scaffold vector system comprises the sequence shown in SEQ ID NO. 6.

(7) A method of producing an attenuated monoclonal virus strain comprising the steps of:

(S1) culturing the first cell to be transfected;

(S2) co-transfecting a plasmid comprising the sequence shown as SEQ ID NO:3, and a plasmid (pN) comprising the sequence shown as SEQ ID NO:7, a plasmid (pL) comprising the sequence shown as SEQ ID NO:8, a plasmid mixture of a plasmid (pP) comprising the sequence shown as SEQ ID NO:9, into the cells to be transfected in step (S1);

(S3) extracting the supernatant of the cell mixture obtained after the co-transfection in the step (S2), and transfecting the cell mixture into a cell of a second cell to be transfected;

(S4) culturing the second cell to be transfected after being transfected in the step (S3), and screening to obtain an attenuated monoclonal virus strain.

(8) The method according to (7), wherein the weight ratio of the plasmid comprising the sequence shown by SEQ ID NO. 3, the plasmid (pN) comprising the sequence shown by SEQ ID NO. 7, the plasmid (pL) comprising the sequence shown by SEQ ID NO. 8 and the plasmid (pP) comprising the sequence shown by SEQ ID NO. 9 is 10:4:1: 5.

(9) The method according to any one of (7) to (8), wherein the plasmid comprising the sequence shown by SEQ ID NO. 3 is a plasmid comprising the sequence shown by SEQ ID NO. 4; optionally, the second cell to be transfected is selected from Vero cells; the first cell to be transfected is selected from BSR-T7 cells;

(10) the method according to (9), wherein the plasmid comprising the sequence shown as SEQ ID NO. 4 in step (S2) is selected from plasmids comprising the sequence shown as SEQ ID NO. 6.

(11) The method according to (10), wherein the coding sequence of the plasmid comprising the sequence shown as SEQ ID NO. 6 in the step (S2) further comprises the sequence shown as SEQ ID NO. 10 and the sequence shown as SEQ ID NO. 11.

(12) The method according to (10), wherein the coding sequence of the plasmid comprising the sequence shown as SEQ ID NO. 6 in step (S2) further comprises the sequence shown as SEQ ID NO. 12.

(13) The method according to (12), wherein the 5' end comprising the sequence shown as SEQ ID NO 12 further comprises a signal peptide sequence; the sequence of the signal peptide is selected from the sequences shown as SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15 or SEQ ID NO. 16; preferably, the signal peptide sequence is selected from the group consisting of the sequences shown in SEQ ID NO. 15.

(14) An attenuated monoclonal virus strain produced by the method for producing an attenuated monoclonal virus strain according to any one of (7) to (13).

(15) A monoclonal antibody secreted by the attenuated monoclonal virus strain of (14).

(16) A monoclonal antibody comprising a fragment encoded by the sequence shown as SEQ ID NO. 4, the sequence shown as SEQ ID NO. 10 and the coding sequence shown as SEQ ID NO. 11.

(17) The monoclonal antibody according to (16), wherein the sequence comprising SEQ ID NO. 4 is selected from the group consisting of the sequences comprising SEQ ID NO. 6.

(18) The monoclonal antibody according to (17), wherein the coding sequence further comprises a sequence shown as SEQ ID NO 13, SEQ ID NO 14, SEQ ID NO 15 or SEQ ID NO 16; preferably, the coding sequence further comprises the sequence shown in SEQ ID NO. 15.

(19) A pharmaceutical composition comprising the monoclonal antibody according to any one of (15) to (18).

(20) Use of the monoclonal antibody according to any one of (15) to (18) or the pharmaceutical composition of (19) for the preparation of a medicament for killing an abnormally proliferative cell, inducing a promotion of an anti-tumor immune response, or eliminating microenvironment immunosuppression of tumor tissue.

(21) The use of (20), wherein the hyperproliferative cell is contained in a patient.

(22) The use of (21), wherein the hyperproliferative cell is selected from the group consisting of a tumor cell and a tumor tissue-associated cell; preferably, the tumor cell is a cancer cell; more preferably, the cancer cell is a metastatic cancer cell.

(23) A method for slow and sustained killing of an hyperproliferative cell comprising the step of contacting said hyperproliferative cell with the monoclonal antibody of any one of (15) to (18) or the pharmaceutical composition of (19).

(24) The method of (23), wherein the hyperproliferative cell is contained in a patient.

(25) The method of (23), wherein the hyperproliferative cell is selected from the group consisting of a tumor cell and a tumor tissue-associated cell; preferably, the tumor cell is a cancer cell; more preferably, the cancer cell is a metastatic cancer cell.

(26) The method of (23), wherein the monoclonal antibody of any one of (15) to (18) or the pharmaceutical composition of (19) is administered into a patient.

(27) The method of (23), wherein the monoclonal antibody of any one of (15) to (18) or the pharmaceutical composition of (19) is administered by a mode of administration comprising one or more of intraperitoneal, intravenous, intraarterial, intramuscular, intradermal, intratumoral, subcutaneous, or intranasal administration; preferably, the administration route of the administration mode comprises one or more of endoscopy, intervention, minimally invasive surgery and traditional surgery.

(28) The method of (23), further comprising the step of ー administering a second anti-tumor therapy.

(29) The method of (28), wherein the second anti-tumor therapy is selected from one or more of chemotherapy, radiation therapy, immunotherapy, surgical therapy.

(30) A polynucleotide comprising the sequence shown in SEQ ID NO. 6.

ADVANTAGEOUS EFFECTS OF INVENTION

The host cells of the AVTM vector systems of the present disclosure are widely available. Because of the existence of the surface glycoprotein (G) of the virus system, the virus system can enter host cells without specific receptor mediation, can infect almost all cells of mammals, and can simultaneously complete virus replication and realize high-efficiency expression of exogenous chimeric genes, thereby greatly improving the in vitro and in vivo expression efficiency of the exogenous chimeric antibody.

The genome of a rhabdovirus corresponding to the AVTM attenuated vector system is single negative strand RNA, and the expression of a foreign gene of the system is very stable, the attenuated viral vector system does not generate genome integration in cells, the genome of the viral vector system is simple and stable, and the mutation rate is low.

The system can quickly and efficiently carry out chimeric expression on the human specific antibody, complete specific replication in the tumor cells and express the specific antibody of an exocrine antagonistic tumor cell. Meanwhile, when the tumor antigen is released to activate the specific immune response of immune cells to tumor, a large number of specific antibodies without immunosuppression are gathered in a local tumor microenvironment in a short time, so that the regional immunosuppression barrier is effectively broken, the specific killing activity of T cells is activated, the removal of the killing T cells to the tumor cells is promoted, and the systemic specific anti-tumor immune memory reaction of an organism is promoted.

The gene of the AVTM of the disclosure is subjected to gene mutation modification, so that the toxicity of the virus is reduced, and when the AVTM expresses the antibody at 37 ℃, the normal cells of a host cannot be obviously damaged, so that the infected cells can continuously express the secretory antibody for a period of time. In contrast, for traditional transfected myeloma cells, the cell lines used to express specific antibodies need to replicate to an order of magnitude higher before they can be used for large-scale production of antibodies.

In one embodiment, the present disclosure inserts a nucleotide sequence encoding an antibody of an immune checkpoint molecule into a modified viral expression vector by means of gene editing, and recombines in a specific eukaryotic cell, thereby obtaining an attenuated viral system stably expressing the chimeric antibody.

In one technical scheme, the AVTM-scFV vector system capable of efficiently expressing the single-chain antibody in tumor body tissues is obtained by screening through optimizing a secretion signal peptide sequence of the antibody, and meanwhile, the system is utilized to further evaluate the curative effect of the recombinant system in a solid tumor model, so that a new technical scheme and a new choice are provided for developing a therapeutic product of the solid tumor.

Drawings

FIG. 1A is a schematic diagram showing the specific process of screening a library of attenuated virus strains established by random base insertion of exogenous bases in a rhabdovirus vector system and screening an attenuated strain of a four-gene mutant strain RV-Mut 4.

FIG. 1B is a schematic diagram of a modified pRV-2MCS vector rhabdovirus core backbone, and the modified system can integrate two different exogenous genes (PDL1 antibody heavy chain and PDL1 antibody light chain genes) at the same time.

FIG. 2 is a schematic diagram showing the expression of 2 genes simultaneously from outside source in RV-2MCS vector system. Wherein, shown in part a of fig. 2 are schematic diagrams of a heavy chain and a light chain expressing PDL1 antibody, respectively; shown in part B of fig. 2 is a schematic representation of an RV-2MCS vector system simultaneously expressing both the heavy and light chains of PDL1 antibody; FIG. 2, section C, is a schematic representation of the RV-2MCS vector system simultaneously integrating the fluorescent expression of Green Fluorescent Protein (GFP) and Red Fluorescent Protein (RFP) in Vero cells.

FIG. 3 is a schematic diagram showing codon preference optimization by a mock analysis of a vector system of a single-chain antibody AVTM chimeric PDL 1. Wherein, part A in FIG. 3 shows the average GC content (58%) in the designed and optimized foreign gene sequence; part B of fig. 3 shows the codon preference in mammalian cells with a corresponding complex CAI of 0.95, and part C of fig. 3 shows the optimal distribution pattern of the various codons in mammalian cells and the relative distribution frequency of amino acid synonymous codons in the gene sequence.

FIG. 4 shows a comparison of the superiority of the RV-G21E-M51A-L111F-V221F (RV-Mut4) four mutant vector system. Wherein, part A in FIG. 4 and part B in FIG. 4 are schematic diagrams showing the characteristic of long-term sustained expression of foreign proteins in vitro cells of the vector RV-Mut 4; FIG. 4, section C, is a graph showing the time-course curves of the amount of expressed exogenous GFP protein replicated in Vero cells by RV-Mut4 and other mutants, as detected by FACS; section D of FIG. 4 shows a schematic representation of a comparative experiment in which MTT measures the toxicity of RV-Mut4 and three additional mutants against tumor cells.

FIG. 5 is a schematic diagram showing the ability of PDL1 single-chain antibody to bind to two tumor cell surface molecules detected by FACS, wherein the exogenous single-chain antibody secreted by an engineered cell line Vero (RV-Mut4-scFV-PDL1 high-expression PDL1 single-chain antibody) is used, and the antibody in the supernatant is incubated with two kinds of cells LLC and MC38 stably expressing human PDL1 in vitro.

FIG. 6 is a schematic representation of the identification of the level of exocrine in eukaryotic cells of the PDL1 single-chain antibody mediated by three different signal peptide linkages in vitro at the cell line level, by IB (Western blot) experiments.

FIG. 7A is a schematic representation of the secretion of four single-chain antibodies PDL1 into the supernatant mediated by the AVTM vector system in engineered cell Vero.

FIG. 7B is a schematic diagram showing detection of antibody presence in serum and local tumor tissue (near tumor tissue subcutaneous injection and intratumoral injection) by single-chain antibody linked with signal 3 signal peptide in LLC animal model by two different inoculation methods.

FIG. 8 is a schematic diagram showing the evaluation of therapeutic effects of AVTM-mediated single-chain antibodies in lung cancer. As shown in part a of fig. 8, there are three treatment groups, which are an AVTM system mediated expression single chain antibody group (RV-scFV-PDL1 attenuated strain), an RV-WT experimental control group, and a PBS blank control group, respectively, and an overall statistical graph of the treatment effect on solid tumors in an LLC-mediated non-small cell lung cancer model mouse animal model; wherein, in order to further not determine the difference between individuals of different treatment groups, the individuals of each group are separately counted; section B of figure 8 shows the individual statistics for the PBS treated group; FIG. 8, section C, is a schematic statistical representation of individuals from the RV-GFP-WT treated group; section D of FIG. 8 shows a statistical chart of individuals in the RV-scFV-PDL1 treatment group. Inoculating the non-small cell lung cancer tissue of model mouse in tumor 10 times every other day⁷The attenuation of PFU by 30. mu.l was performed three times in a total immunization, and the change in tumor volume of the model mice in each experimental group was measured every other day, and the portions B-D in FIG. 8 represent the simultaneous display of the change in tumor volume of the individual individuals in the three groups with time.

FIG. 9 is a graph of the individual therapeutic effect of PBS, RV-GFP and RV-scFV-PDL1, on portions A-C, respectively, on a lung cancer model; part D of fig. 9 is a statistical graph of the treatment effects of the above three groups of drugs on day 10; section E of figure 9 is a statistical plot of the therapeutic effects of the three groups of drugs on day 20.

FIG. 10 shows the evaluation of the effect of RV-scFV-PDL1 attenuated strain on lung cancer metastasis animal models, the metastasis of the model mouse lung tissue metastasis model (LLC-JSP) treated by the experimental group and the control group under low power microscope (part A in FIG. 10) and the survival rate of the model mouse (part B in FIG. 10).

FIG. 11 shows the first set up of a colon cancer model mouse model expressing human-derived CD274Type (human-derived PDL1), RV-scFV-PDL1 and corresponding control group virus (RV-WT) were intratumorally administered 30. mu.l 10⁷Dose of PFU, once every other day, for a total of 3 doses, a graphical representation of the change in tumor volume was recorded.

Detailed Description

Definition of

In the claims and/or the description of the present disclosure, the words "a" or "an" or "the" may mean "one", but may also mean "one or more", "at least one", and "one or more than one".

As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps. Also, the terms "comprising," "having," "including," or "containing" are intended to be inclusive and mean that there may be additional, unrecited elements or method steps.

Throughout this specification, the term "about" means: a value includes the standard deviation of error for the device or method used to determine the value.

Although the disclosure supports the definition of the term "or" as merely an alternative as well as "and/or," the term "or" in the claims means "and/or" unless expressly indicated to be merely an alternative or a mutual exclusion between alternatives.

The terms "inhibit," "reduce," or "prevent," or any variation of these terms, as used in the claims and/or the specification, include any measurable reduction or complete inhibition to achieve a desired result (e.g., tumor treatment). Desirable results include, but are not limited to, alleviation, reduction, slowing, or eradication of cancer or a proliferative disorder or cancer-related symptoms, as well as improved quality of life or prolongation of life.

The vaccination methods of the present disclosure can be used to treat tumors in mammals, and optionally, the vaccination methods of the present disclosure can be used to treat cancer in mammals. The term "cancer" as used in this disclosure includes any cancer, including, but not limited to, melanoma, sarcoma, lymphoma, cancer (e.g., brain, breast, liver, stomach, lung, and colon), and leukemia.

The term "mammal" refers to humans as well as non-human mammals.

The methods of the present disclosure comprise administering to a mammal an oncolytic vector that expresses a tumor antigen to which the mammal has a pre-existing immunity. The term "pre-existing immunity" as used in this disclosure is meant to include immunity induced by vaccination with an antigen as well as immunity naturally occurring in mammals.

The term "RV virus" as used in this disclosure refers to an attenuated VSV oncolytic rhabdovirus. The term "RV-Mut" refers to an oncolytic rhabdovirus that has a mutation compared to a wild-type VSV oncolytic rhabdovirus. The term "RV-Mut 4" refers to an oncolytic rhabdovirus having a mutation at 4 positions compared to wild-type VSV oncolytic rhabdovirus.

The term "VSV" refers to vesicular stomatitis virus, which is one of the oncolytic rhabdoviruses. It encodes 5 proteins, including the nucleocapsid protein (N), phosphoprotein (P), matrix protein (M), surface glycoprotein (G) and RNA-dependent RNA polymerase (L).

The term "PDL 1" refers to the cellular death ligand 1.PDL1 protein is a ligand of PD1, is related to the inhibition of the immune system, and can conduct inhibitory signals. Once bound, PD1 and PDL1 transmit a negative regulatory signal to T cells, inducing T cells to enter a quiescent state, reducing the proliferation of lymph node CD8+ T cells, rendering them unable to recognize cancer cells, and causing T cells to proliferate less or to undergo apoptosis.

The term "vaccine" in the present disclosure is an immune preparation for preventing diseases, which is prepared from pathogenic microorganisms (such as bacteria, etc.) and metabolites thereof by artificial attenuation, inactivation, or using transgenosis, etc.

The term "radiotherapeutic agent" in the present disclosure includes the use of drugs that cause DNA damage. Radiotherapy has been widely used in cancer and disease treatment and includes those commonly referred to as gamma rays, X-rays and/or the targeted delivery of radioisotopes to tumor cells.

The term "chemotherapeutic agent" in the present disclosure is a chemical compound useful for the treatment of cancer. Classes of chemotherapeutic agents include, but are not limited to: alkylating agents, antimetabolites, kinase inhibitors, spindle poison plant alkaloids, cytotoxic/antitumor antibiotics, topoisomerase inhibitors, photosensitizers, anti-estrogen and selective estrogen receptor modulators, anti-progestins, estrogen receptor downregulators, estrogen receptor antagonists, luteinizing hormone-releasing hormone agonists, anti-androgens, aromatase inhibitors, EGFR inhibitors, VEGF inhibitors, antisense oligonucleotides that inhibit the expression of genes involved in abnormal cell proliferation or tumor growth. Chemotherapeutic agents useful in the treatment methods of the present disclosure include cytostatic and/or cytotoxic agents.

The term "immunotherapeutic agent" in the present disclosure includes "immunomodulators" and agents that promote or mediate antigen presentation that promotes a cell-mediated immune response. Among these, "immune modulators" include immune checkpoint modulators, such as immune checkpoint protein receptors and their ligands that mediate the inhibition of T cell-mediated cytotoxicity and are typically expressed by tumors or on anergic T cells in the tumor microenvironment and allow the tumor to evade immune attack. Inhibitors of the activity of immunosuppressive checkpoint protein receptors and their ligands can overcome the immunosuppressive tumor environment to allow cytotoxic T cell attack of the tumor. Examples of immune checkpoint proteins include, but are not limited to, PD-1, PD-L1, PDL2, CTLA4, LAG3, TIM3, TIGIT, and CD 103. Modulation (including inhibition) of the activity of such proteins may be accomplished by immune checkpoint modulators, which may include, for example, antibodies, aptamers, small molecules that target checkpoint proteins, and soluble forms of checkpoint receptor proteins, among others. PD-1 targeted inhibitors include the approved pharmaceutical agents pembrolizumab and nivolumab, while plepima (ipilimumab) is an approved CTLA-4 inhibitor. Antibodies specific for PD-L1, PD-L2, LAG3, TIM3, TIGIT, and CD103 are known and/or commercially available and can also be produced by those skilled in the art.

"methods in general Biology in the art" in the present disclosure can be referred to corresponding methods described in publications such as "Current Protocols in Molecular Biology, Wiley publication", "Molecular Cloning, A Laboratory Manual, Cold spring harbor Laboratory publication", and the like.

The specific meanings of the nucleotide/amino acid sequences referred to in the present disclosure are as follows.

SEQ ID NO:1 shows the nucleotide sequence of the M gene in the Core backbone of VSV (i.e., the M gene in pRV-Core vector).

SEQ ID NO. 2 shows the nucleotide sequence of the vector Entrancepson with transposition function.

SEQ ID NO 3 shows the nucleotide sequence of the M gene in the attenuated viral vector prepared by the method of the present disclosure.

SEQ ID NO. 4 shows the nucleotide sequence of the pRV-core Mut4 vector.

SEQ ID NO 5 shows a nucleotide sequence of 2 MCS.

SEQ ID NO 6 shows the nucleotide sequence of the pRV-2MCS vector.

SEQ ID NO 7 shows the nucleotide sequence of a plasmid containing the N gene in the core skeleton of VSV.

SEQ ID NO 8 shows the nucleotide sequence of a plasmid containing the L gene in the core skeleton of VSV.

SEQ ID NO 9 shows the nucleotide sequence of a plasmid containing the P gene in the core backbone of VSV.

10 shows the nucleotide sequence of the heavy chain portion of the PDL1 antibody.

Shown in SEQ ID NO 11 is the nucleotide sequence of the light chain portion of the PDL1 antibody.

12 shows the nucleotide sequence of the single-chain PDL1 single-chain antibody.

13 shows the amino acid sequence of signal peptide Sig1 secreting PDL1 single chain antibody.

SEQ ID NO. 14 shows the amino acid sequence of signal peptide Sig2 secreting PDL1 single chain antibody.

SEQ ID NO. 15 shows the amino acid sequence of signal peptide Sig3 secreting PDL1 single chain antibody.

16 shows the amino acid sequence of signal peptide Sig4 secreting PDL1 single chain antibody.

Examples

Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

The sources of reagents and consumables employed in this disclosure are as follows:

PBS (Hyclone SH30256.01), DMEM high-sugar medium (Gibco C11995500), RPMI1640(Gibco C22400500CP), diabody (Gibco 15140-,

i Reduced Serum Medium (Gibco 31985. sup. 070), Lipofectamine LTX (Invitrogen 15338100), 96-well cell culture plate (Corning 3599), 6-well cell culture plate (Corning3516), 0.22um filter (Millipore SLGP033rb), DMSO (Macklin D806645), thiazole blue (SigmaM 2128).

Unless otherwise indicated, reagents referred to in the examples of the present disclosure are commercially available.

The virus packaging method related to the disclosure comprises the following steps:

1. BSR-T7 cells were plated in 6-well plates to achieve a cell mass of 3X 10⁵One/well, after plating for 14-16h, poxvirus expressing T7 polymerase was added and transfection was performed 6h after viral infection.

2. The plasmid was diluted to 5. mu.g in 200. mu.l of opti-MEM medium, and 7.5. mu.l of the transfection Reagent PLUS Reagent from Life was added thereto, in a mass ratio of pRV-core: pP: pN: pL: 10:5:4: 1. Lipofectamine LTX 10. mu.l was diluted with 200. mu.l of the medium. Wherein pN represents a baculovirus nucleoprotein gene, pL represents a baculovirus polymerase protein gene, pP represents a baculovirus phosphoprotein gene, and the parent vector corresponding to the three plasmids of pP, pL and pN is pCAGGS (purchased from ATCC).

3. LTX mixture 200. mu.l was mixed with DNA mixture 200. mu.l and incubated at room temperature for 15 min.

4. The culture medium in the 6-well plate is changed to Opti-MEM medium, the mixed solution in the step 3 is dropwise added into the 6-well plate for culturing cells, and the 6-well plate is gently shaken to be uniformly distributed in the 6-well plate.

5. After 6-8h of transfection, the transfection reagent was aspirated and 3ml of fresh complete medium was added.

6. Cell supernatants were harvested after 72h and filtered using a 0.22 μm filter.

Example 1: establishment of attenuated virus vector screening library

In this embodiment, the Mu phage transposition technique, which is a kit manufactured by Thermo, has been widely used for the study of various virus genome functions and virus-host interactions. The principle of establishing a random mutation library by using the Mu phage transposition kit is as follows: mu phage transposon-mediated (transposon-mediated mutagenisis) random insertion high density mutagenesis technology is a method for randomly inserting a short 15bp (5'-NNNNNTGCGGCCGCA-3', 5N stands for 5 repeated base sequences on target sequence DNA) nucleic acid sequence into DNA, thereby generating a high-capacity gene insertion mutant library. Combining the mutant with virus directional genetic manipulation technology to obtain a corresponding virus mutant library, and then combining PCR amplification, capillary electrophoresis, fluorescence labeling DNA sequencing technology, fragment length polymorphism Analysis (AFLP) and other technologies to accurately identify the mutation number and the plasmid DNA involved in insertion site transformation as M1-M mut, namely, integrating the mutation sequence library of the M gene into an M1-kan vector to form an M mutant gene library (the implementation steps refer to Thermo Scientific mutation Generation System Kit standard instruction). The target M gene vector plasmid can be randomly inserted into fragments at the base position of the M gene under the combined action of the transposon and the transposase, finally the M gene generates magnitude-order random mutation, the mutant gene M is amplified by using 5'-TGCGGCCGCA-3' specific primers, a mutation library is established, and the M gene library is further cloned into a pRV-core framework plasmid by enzyme digestion.

The experimental method for establishing the virus library system comprises the following steps:

1. the reaction was carried out in a centrifuge tube. Where the transposase should be added last, the system for the in vitro transposition reaction is shown in table 1:

TABLE 1 in vitro transposition reaction System

Reagent	Volume of
		Target DNA (M Gene in core skeleton of rhabdovirus)	1-14μl
Reaction buffer for 5 Xtransposase	4μl
		M1-Kan transposon (Entranceponson) 100ng	1μl
MuA transposase	1μl
		H₂O	The total volume is 20 mu l

A positive control reaction was performed using pBlank 370ng (1. mu.l) as a positive control DNA provided in the Kit Thermo Scientific mutagenesis System Kit (available from Thermo Co., Ltd., cat # F701).

2. Mix gently.

3. Transposition was performed by incubation at 30 ℃ for 1 hour.

4. Transposase was inactivated by incubation at 75 ℃ for 10 minutes.

5. Preparing a competent bacterium, wherein said bacterium is derived from DH5 α.

The reaction mixture obtained in step 4 was diluted 10-fold in deionized water, with a maximum of 10ul per use. Alternatively, the DNA in the reaction mixture is precipitated and then suspended in deionized water for electroporation. For chemical transformations, 5-10. mu.L were used per transformation.

6. 10. mu.g/mL chloramphenicol or 10. mu.g/mL kanamycin was added to the agar plate, and antibiotics of the target DNA clone were additionally added.

7. Plasmids were extracted from colonies on the plates using standard alkaline lysis methods or any commercial DNA preparation kit.

8. Plasmid DNA was digested with restriction enzymes. The single cloning cleavage site (NotI) of the shuttle fragment (provided by the Thermo Scientific mutagenesis System Kit) was determined, the plasmid was cleaved with two restriction enzymes, and a portion of the vector backbone was excised to distinguish the fragments by agarose gel electrophoresis.

9. The presence of the shuttle vector was detected by standard agarose gel electrophoresis separation and the shuttle vector pTrans plasmid described above was recovered by gel recovery.

10. Cloning the extracted DNA fragment into a novel cloning vector M1-CAM^R(kit provision).

11. Transformation was performed on bacterial agar plates to which was added 10. mu.g/mL chloramphenicol or 10. mu.g/mL kanamycin, and additionally an antibiotic to select cloning vectors

12. Colonies are picked from the plate, expanded and plasmid DNA is extracted using standard alkaline lysis methods or any commercial DNA preparation kit.

13. The plasmid was digested with Not I and the shuttle vector was removed. The resulting fragments can optionally be separated by standard agarose electrophoresis. Extracting the fragment with the target DNA size on the cloning vector.

14. Ligation was performed with Not I cleavage product. If the cleavage products are not separated by agarose electrophoresis, the concentration of the DNA mixture is adjusted to 1-5ng/ml in order to promote self-ligation of the cleavage products.

15. Transformation was performed with E.coli DH5 α competent cells.

16. Only the antibiotic for screening the cloning vector was added to the plate. The NotI enzyme was cleaved off the shuttle vector and no chloramphenicol or kanamycin was added.

17. Selecting colonies from the plate, culturing bacteria, extracting plasmid DNA, further obtaining an M mut gene fragment from an M1-M mut plasmid through enzyme digestion, and completing the establishment of an M mutation library according to the steps.

The attenuated strain virus rescue system comprises the following steps: further, after the establishment of the mutant pool, the M1-M mut gene mutant fragment was cloned into the backbone vector pRV-core. Wherein pRV-core is a core framework vector for packaging virus, the whole gene of the virus framework is synthesized, pRV-4Mut is shown in a manuscript by sequence reference, the virus gene corresponding to the core framework of the pRV-core is synthesized according to the gene of the MuddSummer strain type of VSV, and the GenBank is numbered as EU 849003.1. pRV-core plasmid and pRV-4Mut only have nonsynonymous mutation at 4 amino acid sites of M gene, pRV-core is an original skeleton vector), wild M gene in a target vector is removed by double enzyme digestion to form a core skeleton vector library of a new M gene mutation library, and the mutation plasmid library is named as pRV-core Mut. Further, various recombinant RV-Mut attenuated strains were obtained by virus rescue in BSR-T7 cell line with the aid of helper plasmids.

Wherein, the specific steps of the virus rescue are as follows: BSR-T7 cells (purchased from ATCC) were transfected with 5. mu.g of the backbone plasmid pRV-core Mut by cell transfection technique using a calcium phosphate transfection kit. The plasmid was diluted to 5. mu.g in 200. mu.l of opti-MEM medium, and 7.5. mu.l of the transfection Reagent PLUS Reagent from Life was added thereto, in a plasmid ratio of pRV-core: pP: pN: pL: 10:5:4: 1. Lipofectamine LTX 10. mu.l was diluted with 200. mu.l of the medium. Wherein pN represents a baculovirus nucleoprotein gene, pL represents a baculovirus polymerase protein gene, and pP represents a baculovirus phosphoprotein gene. Among these, the three plasmids, pP, pL and pN, correspond to the parent vector pCAGGS (purchased from ATCC). PBS washes the cell twice after 6 hours, further cultivates in DMEM of 10% fetal calf serum for 3 days, transfers the cell supernatant obtained to Vero cell and cultivates in 37 ℃ for 3 days, and the condition that the virus rescued is confirmed to green fluorescence in the fluorescence microscope observation cell, further passes the sudden change rhabdovirus bank rescued through Vero cell passage, picks out the monoclonal virus strain in the plaque screening system that establishes.

When this transposition system is reacted, the in vitro transposon is not affected by foreign DNA, accompanied by minute impurities, and the optimum amount of the target DNA per reaction depends on the size of the plasmid, and the amount of the target DNA (ng) can be calculated by the following formula as the reaction plasmid size (kb) × 40 ng.

The DNA may be inserted into the cloning vector together with the shuttle vector by DNA cloning techniques. Thus, the DNA is cleaved from the cloning vector with restriction enzymes and the shuttle vector does not have this cleavage site. In addition, since the size of the cloning vector and the inserted DNA are significantly different in size, the desired fragment can be separated by agarose gel electrophoresis.

Transformation efficiency is also a very important consideration for maximum insertional cloning (e.g., electroporation of cells for the pUC19 plasmid)>10⁸CFU/. mu.g). Therefore, electroporation is the best transformation method we chose. Meanwhile, considering that the shuttle vector contains a 50bp inverted terminal repeat sequence, in order to avoid the potential homologous recombination between the repeat sequences, RecA produced by e.coli was used as a homologous recombinase.

After the pRV-core Mut plasmid is obtained, the specific steps of virus rescue are as follows: mixing 5X10⁶The BSR-T7 cells were plated evenly on 10cm cell culture dishes and cultured overnight with 10% fetal bovine serum DMEM until the cell density reached 80%, and the cells were washed 2 times with serum-free DEME one hour before transfection. Cells were transfected with 5. mu.g of the backbone plasmid pRV-core Mut, 5. mu.g of pN (rhabdovirus nucleoprotein gene), 2.5. mu.g of pL (rhabdovirus polymerase protein gene), 2.5. mu.g of pP (rhabdovirus phosphoprotein gene), and pCAGGS (from ATCC) as the parent vector for the three plasmids pP, pL, pN. After 2-3 hours the cells were washed twice with PBS at 10%Culturing in DMEM of fetal calf serum for 3 days, transferring the obtained cell supernatant into Vero cells, culturing at 37 ℃ for 3 days, observing green fluorescence in the cells by a fluorescence microscope to determine the virus rescue situation, further passaging the rescued mutant rhabdovirus library through the Vero cells, picking monoclonal virus in the established plaque screening system, further continuously infecting new Vero cells with the picked monoclonal virus strain, and picking out the monoclonal virus strain with weakened cell lysis capacity.

The specific operation steps of cloning the backbone plasmid system are as follows: through gene synthesis technology, gene fragment 2MCS (SEQ ID NO:5) is cloned to a vector pRV-core Mut4, a corresponding core skeleton pRV-core (pRV-core Mut4 is a mutation which generates 4 sites on an M gene corresponding to a pRV-core plasmid, specifically, an amino acid G at the 21 st site of an M protein is mutated into an amino acid E, an amino acid M at the 51 st site of the M protein is mutated into an amino acid A, a leucine L at the 111 st site of the M protein is mutated into phenylalanine F, a valine V at the 221 st site of the M protein is mutated into phenylalanine F), and a cloned new skeleton is named as pRV-2 MCS. The upstream of the cloning site is XhoI, the downstream site is NotI (see FIG. 1B), and the 2MCS gene is located between the vector gene G and the gene L.

The experimental results are as follows: FIG. 1A shows a random mutation library of M gene of a rhabdovirus generated by random insertion of foreign bases according to the preparation method established for the above virus library, and further a screening library of a low virulent virus strain was established using a rhabdovirus vector system as shown in FIG. 1A (see steps 1 to 17 of case 1). Wherein the attenuated strain with reduced replication ability obtained by the method comprises: RV-M51R (single mutant), RV-M51R-V221F (double mutant), RV-G21E-M51R-L111F (triple mutant), RV-G21E-M51A-L111F (triple mutant) and four-gene mutant RV-Mut4 (RV-G21E-M51A-L111F-V221F). The pathogenic gene of RV-Mut4 is four amino acid mutant strains of the M gene of VSV (the corresponding virus core skeleton plasmid is pRV-core Mut4), namely the 21 st amino acid G of the M protein is mutated into the amino acid E, the 51 st amino acid M is mutated into the amino acid A, the 111 th leucine L is mutated into the phenylalanine F, and the 221 th valine amino acid V is mutated into the phenylalanine F.

FIG. 1B shows a schematic diagram of the core backbone vector pRV-core Mut4 based on the virus RV-Mut 4. Further, 2MCS genes shown in FIG. 1B (spacer sequences of 2 foreign genes are cloned at the same time, and the spacer sequences have enzyme cutting sites with individual characteristics) are recombined into the specific positions of the core skeleton plasmid of pRV-core Mut4 (namely virus G gene and L gene spacer sequences) by gene synthesis and molecular cloning technology, and the new skeleton plasmid system is named as pRV-2 MCS.

The specific steps of cloning pRV-2MCS core skeleton plasmid are as follows: 1. by gene synthesis technology, gene fragment 2MCS was cloned to plasmid pRV-core Mut4 (viral G gene and L gene spacer sequence) by restriction, and the new core backbone plasmid after recombination was pRV-2MCS (FIG. 1B).

Example 2: simultaneous expression of specific antibodies using an attenuated viral vector system pRV-2MCS

The experimental method comprises the following steps: based on the plasmid system pRV-2MCS prepared in example 1, the heavy chain and light chain antibody sequences of the PDL1 antibody are independently cloned into the framework plasmid pRV-2MCS to form new cloning vectors pRV-PDL1-H and pRV-PDL1-L, recombinant viruses are rescued, and the corresponding active PDL1 complete antibody is expressed and secreted in different PDL1 heavy chain/PDL 1 light chain ratios in the engineered cell Vero.

The specific operation steps of the method are as follows: complete antibody sequence of PDL 1A PDL1 antibody heavy chain gene PDL1-H (Hongxi bio-gene synthesis) was cloned into a backbone plasmid pRV-2MCS (NheI and NotI specific cleavage site cloning) according to the PDL1 antibody of Roche to form a new core backbone plasmid pRV-PDL1-H, and the synthesized PDL1 light chain antibody sequence was cloned into a plasmid pRV-2MCS by double cleavage (XhoI and AscI specific cleavage site) to form a new core backbone plasmid pRV-PDL1-L, forming two backbone plasmids, by the virus rescue system and the method thereof as described in example 1, recombinant viruses RV-PDL1-H (chimeric expression PDL1 heavy chain antibody) and RV-PDL1-L (chimeric expression PDL1 antibody light chain) were obtained, and further by immunoblot detection, the optimal virus infection ratio of PDL1 heavy chain/PDL 1 light chain was determined.

As a result of experiments shown in section A of FIG. 2, Western blot analysis revealed that PDL1 with a heavy chain/PDL 1 light chain ratio of 6:1 (i.e., RV-PDL1-H corresponds to a virus multiplicity of infection 6 times that of RV-PDL 1-L), the most amount of PDL1 intact antibody was secreted into the supernatant. Similarly, referring to the cloning steps of pRV-PDL1-H and pRV-PDL1-L, the heavy chain and light chain antibody genes of the PDL1 antibody are cloned into the pRV-2MCS plasmid as a framework plasmid, and a new cloning vector pRV-PDL1- (H + L) is formed, the specific cloning positions of the PDL1 heavy chain and light chain antibody are shown in FIG. 1B, the PDL1 heavy chain is cloned to a specific position through XhoI and AscI, and the PDL1 light chain is cloned to the framework vector through NheI and NotI. As shown in part B of FIG. 2, recombinant virus RV-PDL1- (H + L) corresponding to the cloning vector pRV-PDL1- (H + L) replicates and expresses foreign proteins (heavy chain and light chain of PDL1 antibody) in Vero cells, and further immunoblotting experiments detect that a large amount of PDL1 complete monoclonal antibody exists in the secreted supernatant, so that the pRV-2MCS plasmid system is proved to integrate the heavy chain and the light chain of the immune checkpoint antibody simultaneously, and the complete monoclonal antibody with activity can be efficiently expressed in the engineered cells Vero.

Example 3: stability of attenuated viral vector System pRV-2MCS

GFP and RFP gene sequences are cloned to an attenuated virus vector system pRV-2MCS simultaneously to form a new cloning vector pRV-2 MCS-GFP-RFP. After the recombinant virus is rescued and incubated in the engineered cell Vero for 12h, as shown in part C of FIG. 2, it can be observed in a fluorescence microscope that green and red fluorescence is seen simultaneously in most cells in a fixed visual field. The results of the above experiments directly demonstrate that pRV-2MCS-GFP-RFP expresses GFP and RFP fluorescent proteins simultaneously in cells.

Furthermore, after the recombinant pRV-2MCS-GFP-RFP is passaged five times, the corresponding foreign gene expression detection has no difference with the expression efficiency of the first generation infection, and the stability and the high efficiency of the pRV-2MCS rhabdovirus system are further proved.

Example 4: exogenous PDL1 single chain antibody sequence selection integrated into an attenuated viral vector system pRV-2MCS

The amino acid sequence of PDL1 in an exogenous PDL1 single-chain antibody AVTM recombinant vector (RV-scFV-PDL1) was optimized according to the PDL1 antibody known in the art.

The experimental results are as follows: as shown in part A of FIG. 3, the average GC content in the sequence of the single-chain antibody of the foreign gene PDL1 after optimization was designed to be 58%. As shown in part B of fig. 3, the codon diagram is modified by the codon bias plural number to the most reasonable range (CAI ═ 0.95), and part C of fig. 3 shows the optimal distribution pattern of various codons in mammalian cells and the relative distribution frequency of amino acid synonymous codons in the gene sequence.

Example 5: characteristics of RV-Mut4 rhabdovirus attenuated strain obtained by screening of attenuated strain screening system

According to the screening method in example 1 and the attenuated strain screening system shown in FIG. 1A, the attenuated strains of the rhabdovirus with different point mutations are screened, which comprise: RV-M51R (single mutant), RV-M51R-V221F (double mutant), RV-G21E-M51R-L111F (triple mutant), RV-G21E-M51A-L111F (triple mutant), RV-G21E-M51A-L111F-V221F (quadruple mutant, namely RV-Mut 4).

The specific method steps adopted in the embodiment are as follows:

MTT test method:

1. 100 mul of LLC suspension is added into each well of 96-well culture plate to make the cell amount reach 1X 10⁴Cultured at 37 ℃ for 16h in 5% CO2 per well.

2. Separately dilute the virus to 10⁴PFU、10³PFU、10²PFU、10¹PFU, 4 wells per dilution gradient, 100. mu.l per well, 37 ℃, 5% CO₂Culturing for 40 h.

3. The supernatant from the 96-well plate was discarded, fresh medium was added, MTT solution was added, and 20. mu.L/well was added. 37 ℃ and 5% CO₂And culturing for 4 h.

4. The 96-well plate was centrifuged at 2500 rpm/min and at room temperature for 5 min.

5. The supernatant was gently aspirated using a 1mL disposable sterile syringe.

6. DMSO was added to each well at 100. mu.l/well and left at 37 ℃ for 10 minutes.

7. The OD of each well was measured at a wavelength of 570nm or 490nm using a multifunctional microplate reader with shaking for 2 minutes.

Counting the total number of GFP positive cells detected by flow assay:

1. vero (LLC/Hela/MEF) cell suspension (100. mu.l/well) was added to each well of 48-well plate to make the cell amount 2X 10⁴Per well, 37 ℃, 5% CO₂Culturing for 16 h.

2. 100PFU of a particular mutant virus was added to each well, 21 wells for each virus, and 12 wells for the blank.

3. At each time point (24h, 36h, 48h, 60h, 72h, 84h, 96h), cells were harvested, 3 wells of cells were harvested for each virus, 1 well of cells were harvested for the blank control group, cells were resuspended in 400ul PBS, 100ul cell suspension was taken and analyzed by Life stretch N X T-Next flow cytometer for total GFP positive cells.

As shown in part A of FIG. 4 and part B of FIG. 4, 100. mu.l of MEF/Vero/MC38 cell suspension was first added to each well of a 48-well plate to make the cell amount 2X 10⁴One well, each containing 100PFU of the particular mutant virus, 21 wells of each virus, and 12 wells of the blank. At each time point (24h, 36h, 48h, 60h, 72h, 84h, 96h), cells were harvested, 3 wells of cells were harvested for each virus, 1 well of cells were harvested for the blank control group, cells were resuspended in 400. mu.l PBS, 100ul of cell suspension was taken and analyzed by Life stretch assay NxT-Next flow cytometer to count the total number of GFP positive cells.

The experimental results are as follows: as shown in section A-C of FIG. 4, the mutants obtained by screening (i.e., RV-M51R (single mutant), RV-M51R-V221F (double mutant), RV-G21E-M51R-L111F (triple mutant), RV-G21E-M51A-L111F (triple mutant)) were found to have the ability to continuously express a foreign protein in cells, and when comparison of examined expression of the foreign gene was made, RV-Mut4 reached a peak three days later, and then the expression level gradually dropped back. Further, it was found by comparative experiments (see section C in FIG. 4) that the expression of the foreign gene in RV-Mut4 peaked at 48h compared with the control mutant, and the expression level was much higher than that in the control. The expression level of the exogenous protein (GFP) integrated by the RV-Mut4 attenuated strain is obviously increased, and meanwhile, the specific killing capacity of the virus on tumor cells is not weakened, and as shown in a part D in figure 4, the cracking killing capacity on the tumor cells is not obviously different from that of a control group.

In conclusion, RV-Mut4 is the most prominent among the above strains. The 4 amino acid mutations of the strain do not make the virus toxicity to be strong, and simultaneously, the specificity of killing tumors is continuously kept. At the same time, the property of specific killing of tumors remains intact, although the time point for lysis of tumor cells is found at the cellular level in vitro, delayed. Furthermore, RV-Mut4 has no toxicity to normal cells and completely meets the biological safety requirement.

Example 6: expression of RV-scFV-PDL1 vector in Vero cells

The experimental steps are as follows: using pRV-2MCS system as shown in FIG. 2, the scFV-PDL1 gene was cloned on the backbone plasmid pRV-2MCS by specific endonuclease XhoI and NheI double digestion system based on empty backbone plasmid pRV-2MCS using the method as shown in example 1, the foreign gene position of scFV-PDL1 was between the G protein and L protein of the virus core backbone, and the new backbone plasmid was named pRV-scFV-PDL1 (detailed procedure refers to the process of cloning the foreign gene into core backbone plasmid of example 1). And further rescuing the recombinant virus RV-scFV-PDL1 in BSR-T7 cells, collecting the supernatant expressed by the recombinant virus in Vero cells, incubating the supernatant with cell surface high expression CD274 (human source) cells MC-38-hPDL1 and LLC-hPDL1 for one hour at room temperature respectively (PDL1 single-chain antibody secreted and expressed in the supernatant can be combined with cell surface high expression CD274 receptor molecules), and detecting the specific number and proportion of PDL1 positive cells by a flow cytometer.

The experimental results are as follows: as shown in fig. 5, the positive proportion of PDL1 exceeds 50%, which indicates that RV-scFV-PDL1 can express a single-chain antibody against CD274 molecules with activity through a cell medium, and further proves that the single-chain antibody expressed by RV-scFV-PDL1 has the ability of binding human-derived and murine CD274, has human-mouse cross-reaction, and is beneficial to rapid validation of the efficacy of preclinical animal models.

Example 7: effect of Signal peptide on RV-scFV-PDL1

Through the establishment of non-truncated negative strand RNA vector system AVTM chimeric exogenous immunoglobulin heavy and light chain variable region, design specific heavy and light chain variable region connecting sequence of 15 amino acids, namely international general (G4S)₃As a flexible polypeptide joint, 4 different signal peptides for secreting antibodies are simultaneously designed, and the influence of each signal peptide on the efficiency of single-chain antibody secretion in vitro is compared at the in vitro cell level (plasmid in 293T cell transient transfection expression system).

The specific experimental procedures of the foregoing experiment were as follows:

the method comprises the steps of 1, adding signal peptide sequences of Sig1, Sig2, Sig3 and Sig4 (the sequences are shown in Table 2) to the N end of a PDL1 single-chain antibody respectively, totaling four base sequences, cloning the four gene sequences to a pcDNA3.1 framework (purchased from ATCC company) by using a molecular cloning technology, and finally forming four eukaryotic expression vectors, namely: pcDNA3.1-sig1-scFV-PDL1, pcDNA3.1-sig2-scFV-PDL1, pcDNA3.1-sig3-scFV-PDL1, pcDNA3.1-sig4-scFV-PDL 1.

2. After the four vectors are transfected into 293T cells for 48 hours, respectively collecting secreted supernatant, namely the cells, utilizing a loading buffer solution to crack and prepare a sample, and utilizing an immunoblotting technology to detect the expression quantity of PDL1 single-chain antibody in the supernatant (the pcDNA3.1 vector is provided with a His tag, and the detection of target protein expression is carried out through the His tag antibody).

TABLE 2 amino acid sequence of Signal peptide of secretory antibody

Sig1 Signal peptide	MLLTLIILLPVVSK
		Sig2 Signal peptide	MWLQSLLLLGTVACSIS
Sig3 Signal peptide	MYRMQLLSCIALSLALVTNS
		Sig4 Signal peptide	METDTLLLWVLLLWVPGSTG

The experimental result is shown in fig. 6, in 293T cells, eukaryotic expression vectors connected with three different signal peptides are transfected, cells and supernatant culture solutions are respectively collected, a His tag is fused at the 3' end of scFV-PDL1 after codon optimization is synthesized, and the secretion expression levels of the three different signal peptides connected respectively in the cells are detected by western blotting experiments, so that compared with the other 2 signal peptides, the scFV-PDL1 antibody corresponding to the sig3 signal peptide has the highest secretion efficiency and presents an exponential growth situation.

The four antibody secretion signal peptides related in table 2 were integrated into a pRV-coreMut4 plasmid system by molecular cloning technology, the rescue process of recombinant viruses was completed according to the following virus rescue technology, the four recombinant viruses were infected with Vero E6 cell line, the MOI complex infection was 0.01, the cell supernatant was collected after 24h, and the expression of single-chain antibodies in the supernatant was examined.

The specific steps of the virus rescue technology are as follows: mixing 5X10⁶The BSR-T7 cells were plated evenly on a 10cm dish and cultured overnight with 10% fetal bovine serum DMEM until the cell density reached 80%, and the cells were washed 2 times with serum-free DEME one hour before transfection. Cells were transfected with 5. mu.g of the backbone plasmid pRV-core Mut4 (or a recombinant core backbone plasmid), 5. mu.g of pN (a plasmid expressing a baculovirus nucleoprotein), 2.5. mu.g of pL (a plasmid expressing a baculovirus polymerase protein), and 2.5. mu.g of pP (a plasmid expressing a baculovirus phosphoprotein) using the calcium phosphate transfection kit. After 2-3 hours, the cells were washed twice with PBS, cultured in DMEM with 10% fetal bovine serum for 3 days, and the obtained cell supernatant was transferred to Vero cells and cultured at 37 ℃ for 3 days. The expression of the virus rescued by BSR-T7p cells was examined by immunofluorescence assay using FITC-labeled antibodies specific for the G protein of the rhabdovirus.

The results of virus rescue are shown in figure 7A. FIG. 7A shows that the expression levels of sig3 and sig4 in the supernatant were high, but were barely detectable in sig1 and sig 2.

Furthermore, RV-scFV-PDL1(sig3) attenuated strains using sig3 as a signal peptide are respectively inoculated for 2 days in a mode of subcutaneous injection close to a tumor part and intratumoral injection, model mouse serum and local tumor tissues are respectively collected, tissue samples are ground, and the antibody expression conditions of different parts of the tumor-bearing model mouse and the existence conditions of virus-related proteins are respectively detected by an immunoblotting method.

As shown in fig. 7B, compared with the unvaccinated virus group (marker C), after the RV-scFV-PDL1(sig3) attenuated strain was administered by subcutaneous injection near the tumor site, the mouse tumor tissue (marker 2) detected the presence of the envelope protein of the virus, and the foreign gene single-chain antibody also detected expression, while the mouse serum did not detect the expression of the virus-related gene (marker 1), and further the mouse was administered intratumorally with local administration, and the presence of the significant virus-related protein was detected in both serum (marker 3) and tumor tissue (marker 4), especially in the case of intratumoral administration, the foreign expression level in the tumor tissue was significantly increased, and the experimental results directly demonstrate that RV-scFV 1(sig3) has the ability to express the foreign single-chain antibody in the tumor tissue with high efficiency.

Example 8: RV-scFV-PDL1 immunotherapy pharmacodynamic performance test evaluation under metastatic non-small cell lung cancer model Price of

First, a model of metastatic non-small cell lung cancer was developed, as shown in section A of FIG. 8, by subcutaneously inoculating 1.0 x10 ^6(200uL) LLC-JSP cells (purchased from ATCC in USA) per C57 BL/6. Tumor size was measured every 1 day and calculated as follows: m1²*M²/2 (M1: short diameter, M2: long diameter). When the tumor volume growth of each group of model mice is close to 200mm³Thereafter, 10 was administered at day12, day14 and day16, respectively⁶PFU (20ul) was treated by intratumoral injection of virus and changes in tumor volume were recorded by continuous observation.

The experimental results are as follows: as shown in section A of FIG. 8, there are three treatment groups, one for eachAn AVTM system mediated expression single-chain antibody group (RV-scFV-PDL1 attenuated strain), an RV-WT experimental control group and a PBS blank control group, and an overall statistical chart of the treatment effect on solid tumors in an LLC mediated non-small cell lung cancer model mouse animal model, wherein in order to further not determine the difference among individuals of different treatment groups, individuals of each group are subjected to statistics independently; panel B in figure 8 is an individual statistical plot for the PBS treated group; section C in FIG. 8 is a statistical representation of individuals in the RV-GFP-WT treated group; section D of FIG. 8 represents the individual statistics of RV-scFV-PDL1 treated groups, and intratumoral (model mouse non-small cell lung cancer tissue) vaccination of model mice was performed 10 times every other day⁷The attenuation of PFU was 30. mu.l, co-immunized three times, and the change in tumor volume of model mice in each experimental group was examined every other day, and the evaluation of the efficacy performance test of RV-scFV-PDL1 immunotherapy is shown in section D in FIG. 8. The growth trend of tumors can be effectively inhibited by continuous 3 times of intratumoral injection treatment, the life cycle of model mice is greatly delayed, and by independently analyzing the treatment effect of each model mouse receiving the RV-scFV-PDL1 system, about 40% of the model mouse tumors are reduced until disappear (namely completely relieved), the growth rate of nearly 30% of the model mouse tumors is effectively inhibited and partially relieved, the total effective rate is close to 70%, and compared with a control treatment group RV-GFP-WT, the treatment effect is remarkably improved, and the excellence is obvious.

Section a in fig. 9-section C in fig. 9 further shows the change of tumor volume of each individual after 20 days of treatment in the model mice of different treatment groups, and further analyzes the change of tumor volume of the treated mice of different groups at the 10 th day (section D in fig. 9) and the 20 th day (section E in fig. 9), and at the 10 th day of treatment, it can be found that the experimental control group of RV-GFP has a certain inhibitory effect on non-small cell lung cancer at the early treatment stage, and when the time shifts to 20 days, the tumor volume is continuously reduced to only 2 (n ═ 19), while the therapeutic group of RV-scFV-1 shows a continuously reduced status from the 10 th day of treatment to the 20 th day of treatment, the effective control rate is close to 80%, demonstrating that PDL of the group administered in RV-scFV-1 tumor, three times of administration activates immune cells localized to the tumor, inducing and generating a continuous anti-tumor immune response, gathering specific immune cells at the local part of the tumor, finally eliminating the tumor cells, and shrinking the tumor tissue until the tumor tissue disappears. Further analysis of experimental results shows that when RV-scFV-PDL1 drug is administrated intratumorally for three times, all model mice have no drug resistance, and model mice which generate treatment effect in the initial stage have no later-stage recurrence.

Further, by taking out the lung tissues of the model mice of the experimental group and the control group, observing and recording the transfer of the cancer cell metastasis (LLC-JSP) subcutaneously in the lung tissues of the model mice by the fluorescence microscope, the number of the lung metastases of the model mice of the RV-scFV-PDL1 immunotherapy group was the minimum as seen from the section A in FIG. 10. The survival rate of the experimental group was further found to be highest by the record of the effective survival time after the tumor-bearing model mice received the treatment, and approximately 65% of the model mice maintained normal life status within approximately 2 months (as shown in part B of fig. 10).

Example 9: RV-scFV-PDL1 immunotherapy pharmacodynamic performance test evaluation under colon cancer model

Firstly, a tumor cell line (MC38-hPDL1) expressing human PDL1 is established, the cell line is inoculated to C57BL/6, a humanized model mouse colon cancer model is established, and the curative effect of a chimeric expression human mouse universal single-chain antibody RV-scFV-PDL1 is further verified.

The colon cancer model is established based on chimeric expression of human PDL1 after knockout of murine PDL1 molecule of colon cancer cell line (MC-38). The steps and methods for establishing the model are as follows:

step one, knocking out mouse-derived PDL1(mPDL1) by a CRISPR-Cas9 method: according to the CRISPR-Cas9 technology, firstly, a short-chain guide RNA (sgRNA) is designed, and the sequence is designed as follows: 5'-GCTTGCGTTAGTGGTGTACT-3' are provided. The synthesized DNA double strand was inserted into the sgRNA expression vector (FG-BB-U6-sgRNA) via BbsI. MC-38 cells were then co-transfected with Cas9 expression plasmid (FG-hEF/HTLV-Cas9-PGK-Puro-WPRE) and screened for 48 hours at 60 hours with puromycin (Puro) (see Scientific Reports, Vol.7, Article No. (Article number):42687, Anfei Huang et al, 2/16 d.2017).

Subsequently, amplification culture was performed to obtain a library of knockout cells, DNA was extracted and PCR was performed by the following primers: a forward primer: 5'-TGGTTCCTTTTAAACAAGACTGGG-3', reverse primer: 5'-CGCACCACCGTAGCTGATTA-3', PCR products were recovered and TA cloned, followed by sample sequencing.

Step two, overexpression of human PDL1 in MC-38 cells of mPDL1KO by a lentivirus system: the gene of human PDL1 was first cloned and inserted into FG-hEF/HTLV-human CD274-PGK-Puro-WPRE adenovirus expression vector, followed by transfection of HEK293T cells for viral packaging. The resulting virus infected MC-38mPDL1KO cells for 48h and was screened by puromycin for 48 h.

The knockout efficiency of mPDL1 is detected by a sequencing method, interferon-gamma (IFN-gamma) can remarkably stimulate PDL1 expression, the expression conditions of PDL1 of cells before and after stimulation of normal cells and knockout cells IFN-gamma are respectively detected by flow, and the results further indicate that mPDL1 in MC-38 cells is successfully knocked out.

Similarly, the molecular expression level of hPDL1 overexpressed by lentivirus in MC-38 cells of mPDL1KO is detected by a flow analysis method, and the flow result shows that hPDL1 can be normally expressed in the cell line.

In conclusion, the humanized PDL1 tumor cell line MC-38-hPDL1 was established by validation of the steps. Further, effective life cycle records of tumor-bearing model mice after receiving treatment show that the survival rate of the model mice of the RV-scFV-PDL1 drug treatment group is highest, nearly 70% of the model mice maintain normal life state within nearly 2 months (as shown in figure 11), in the curative effect evaluation of the model mice model of colon cancer, as shown in figure 11, after intratumoral inoculation once every other day and three times of treatment, the treated group obviously inhibits the growth of tumors compared with a control group (PBS), prolongs the life cycle of the model mice, analyzes that nearly 70% of individual tumor volume is continuously reduced or the tumors maintain a certain volume from a single individual of the treated group, compared with the control group, the RV-scFV-PDL1 treatment group obviously controls the growth of the tumor volume, has obvious effect and excellent treatment effect, and simultaneously has feasibility for clinically curing the cancers by using a TM AVV vector system to mediate immune checkpoint antibodies, the AVTM vector system has reliable targeting property on the treatment effect of potential malignant tumors, has good drug resistance, can be repeatedly administered for many times, and has remarkable treatment effect.

The above examples of the present disclosure are merely examples provided for clearly illustrating the present disclosure and are not intended to limit the embodiments of the present disclosure. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present disclosure should be included in the protection scope of the claims of the present disclosure.

Sequence listing

<110> Ottoming medicine science and technology Co., Ltd, Suzhou

<120> preparation method and application of attenuated rhabdovirus

<130>6514-180407I

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>690

<212>DNA

<213> Vesicular stomatitis virus (Vesicular stomatis virus)

<400>1

atgagttcct taaagaagat tctcggtctg aaggggaaag gtaagaaatc taagaaatta 60

gggatcgcac caccccctta tgaagaggac actagcatgg agtatgctcc gagcgctcca 120

attgacaaat cctattttgg agttgacgag atggacacct atgatccgaa tcaattaaga 180

tatgagaaat tcttctttac agtgaaaatg acggttagat ctaatcgtcc gttcagaaca 240

tactcagatg tggcagccgc tgtatcccat tgggatcaca tgtacatcgg aatggcaggg 300

aaacgtccct tctacaaaat cttggctttt ttgggttctt ctaatctaaa ggccactcca 360

gcggtattgg cagatcaagg tcaaccagag tatcacgctc actgcgaagg cagggcttat 420

ttgccacata ggatggggaa gacccctccc atgctcaatg taccagagca cttcagaaga 480

ccattcaata taggtcttta caagggaacg attgagctca caatgaccat ctacgatgat 540

gagtcactgg aagcagctcc tatgatctgg gatcatttca attcttccaa attttctgat 600

ttcagagaga aggccttaat gtttggcctg attgtcgaga aaaaggcatc tggagcgtgg 660

gtcctggact ctatcggcca cttcaaatga 690

<210>2

<211>1139

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gatctgcggc cgcgcacgaa aaacgcgaaa gcgtttcacg ataaatgcga aaacggatcg 60

atcctagtaa gccacgttgt gtctcaaaat ctctgatgtt acattgcaca agataaaaat 120

atatcatcat gaacaataaa actgtctgct tacataaaca gtaatacaag gggtgttatg 180

agccatattc aacgggaaac gtcttgctcg aggccgcgat taaattccaa catggatgct 240

gatttatatg ggtataaatg ggctcgcgat aatgtcgggc aatcaggtgc gacaatctat 300

cgattgtatg ggaagcccga tgcgccagag ttgtttctga aacatggcaa aggtagcgtt 360

gccaatgatg ttacagatga gatggtcaga ctaaactggc tgacggaatt tatgcctctt 420

ccgaccatca agcattttat ccgtactcct gatgatgcat ggttactcac cactgcgatc 480

cccgggaaaa cagcattcca ggtattagaa gaatatcctg attcaggtga aaatattgtt 540

gatgcgctgg cagtgttcct gcgccggttg cattcgattc ctgtttgtaa ttgtcctttt 600

aacagcgatc gcgtatttcg tctcgctcag gcgcaatcac gaatgaataa cggtttggtt 660

gatgcgagtg attttgatga cgagcgtaat ggctggcctg ttgaacaagt ctggaaagaa 720

atgcataagc ttttgccatt ctcaccggat tcagtcgtca ctcatggtga tttctcactt 780

gataacctta tttttgacga ggggaaatta ataggttgta ttgatgttgg acgagtcgga 840

atcgcagacc gataccagga tcttgccatc ctatggaact gcctcggtga gttttctcct 900

tcattacaga aacggctttt tcaaaaatat ggtattgata atcctgatat gaataaattg 960

cagtttcatt tgatgctcga tgagtttttc taatcagaat tggttaattg gttgtaacac 1020

tggcagagca ttacgctgac ttgacgggac ggcggctttg ttgaataaat cgaactggat 1080

catccgtttt cgcatttatc gtgaaacgct ttcgcgtttt tcgtgcgcgg ccgcagatc 1139

<210>3

<211>690

<212>DNA

<213> Vesicular stomatitis virus (Vesicular stomatis virus)

<400>3

atgagttcct taaagaagat tctcggtctg aaggggaaag gtaagaaatc taagaaatta 60

gagatcgcac caccccctta tgaagaggac actagcatgg agtatgctcc gagcgctcca 120

attgacaaat cctattttgg agttgacgag gcggacacct atgatccgaa tcaattaaga 180

tatgagaaat tcttctttac agtgaaaatg acggttagat ctaatcgtcc gttcagaaca 240

tactcagatg tggcagccgc tgtatcccat tgggatcaca tgtacatcgg aatggcaggg 300

aaacgtccct tctacaaaat cttggctttc gcaggttctt ctaatctaaa ggccactcca 360

gcggtattgg cagatcaagg tcaaccagag tatcacgctc actgcgaagg cagggcttat 420

ttgccacata ggatggggaa gacccctccc atgctcaatg taccagagca cttcagaaga 480

ccattcaata taggtcttta caagggaacg attgagctca caatgaccat ctacgatgat 540

gagtcactgg aagcagctcc tatgatctgg gatcatttca attcttccaa attttctgat 600

ttcagagaga aggccttaat gtttggcctg attgtcgaga aaaaggcatc tggagcgtgg 660

ttcctggact ctatcggcca cttcaaatga 690

<210>4

<211>13513

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 60

tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 120

atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 180

aagtatatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat 240

ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac 300

tacgatacgg gagggcttac catctggccc cagtgctgca atgataccgc gagacccacg 360

ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag 420

tggtcctgca actttatccg cctccatcca gtctattaat tgttgccggg aagctagagt 480

aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt 540

gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt 600

tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt 660

cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc atacttctct 720

tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt 780

ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatac 840

cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa 900

actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa 960

ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca 1020

aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct 1080

ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga 1140

atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc 1200

taaattgtaa gcgttaatat tttgttaaaa ttcgcgttaa atttttgtta aatcagctca 1260

ttttttaacc aataggccga aatcggcaaa atcccttata aatcaaaaga atagaccgag 1320

atagggttga gtgttgttcc agtttggaac aagagtccac tattaaagaa cgtggactcc 1380

aacgtcaaag ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc 1440

taatcaagtt ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc 1500

ccccgattta gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaagaaa 1560

gcgaaaggag cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaaccacc 1620

acacccgccg cgcttaatgc gccgctacag ggcgcgtccc attcgccatt caggctgcgc 1680

aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct ggcgaaaggg 1740

ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc acgacgttgt 1800

aaaacgacgg ccagtgaatt gtaatacgac tcactatagg acgaagacaa acaaaccatt 1860

attatcatta aaaggctcag gagaaacttt aacagtaatc aaaatgtctg ttacagtcaa 1920

gagaatcatt gacaacacag tcgtagttcc aaaacttcct gcaaatgagg atccagtgga 1980

atacccggca gattacttca gaaaatcaaa ggagattcct ctttacatca atactacaaa 2040

aagtttgtca gatctaagag gatatgtcta ccaaggcctc aaatccggaa atgtatcaat 2100

catacatgtc aacagctact tgtatggagc attaaaggac atccggggta agttggataa 2160

agattggtca agtttcggaa taaacatcgg gaaagcaggg gatacaatcg gaatatttga 2220

ccttgtatcc ttgaaagccc tggacggcgt acttccagat ggagtatcgg atgcttccag 2280

aaccagcgca gatgacaaat ggttgccttt gtatctactt ggcttataca gagtgggcag 2340

aacacaaatg cctgaataca gaaaaaagct catggatggg ctgacaaatc aatgcaaaat 2400

gatcaatgaa cagtttgaac ctcttgtgcc agaaggtcgt gacatttttg atgtgtgggg 2460

aaatgacagt aattacacaa aaattgtcgc tgcagtggac atgttcttcc acatgttcaa 2520

aaaacatgaa tgtgcctcgt tcagatacgg aactattgtt tccagattca aagattgtgc 2580

tgcattggca acatttggac acctctgcaa aataaccgga atgtctacag aagatgtaac 2640

gacctggatc ttgaaccgag aagttgcaga tgaaatggtc caaatgatgc ttccaggcca 2700

agaaattgac aaggccgatt catacatgcc ttatttgatc gactttggat tgtcttctaa 2760

gtctccatat tcttccgtca aaaaccctgc cttccacttc tgggggcaat tgacagctct 2820

tctgctcaga tccaccagag caaggaatgc ccgacagcct gatgacattg agtatacatc 2880

tcttactaca gcaggtttgt tgtacgctta tgcagtagga tcctctgccg acttggcaca 2940

acagttttgt gttggagata acaaatacac tccagatgat agtaccggag gattgacgac 3000

taatgcaccg ccacaaggca gagatgtggt cgaatggctc ggatggtttg aagatcaaaa 3060

cagaaaaccg actcctgata tgatgcagta tgcgaaaaga gcagtcatgt cactgcaagg 3120

cctaagagag aagacaattg gcaagtatgc taagtcagaa tttgacaaat gaccctataa 3180

ttctcagatc acctattata tattatgcta catatgaaaa aaactaacag atatcatgga 3240

taatctcaca aaagttcgtg agtatctcaa gtcctattct cgtctggatc aggcggtagg 3300

agagatagat gagatcgaag cacaacgagc tgaaaagtcc aattatgagt tgttccaaga 3360

ggatggagtg gaagagcata ctaagccctc ttattttcag gcagcagatg attctgacac 3420

agaatctgaa ccagaaattg aagacaatca aggcttgtat gcaccagatc cagaagctga 3480

gcaagttgaa ggctttatac aggggccttt agatgactat gcagatgagg aagtggatgt 3540

tgtatttact tcggactgga aacagcctga gcttgaatct gacgagcatg gaaagacctt 3600

acggttgaca tcgccagagg gtttaagtgg agagcagaaa tcccagtggc tttcgacgat 3660

taaagcagtc gtgcaaagtg ccaaatactg gaatctggca gagtgcacat ttgaagcatc 3720

gggagaaggg gtcattatga aggagcgcca gataactccg gatgtatata aggtcactcc 3780

agtgatgaac acacatccgt cccaatcaga agcagtatca gatgtttggt ctctctcaaa 3840

gacatccatg actttccaac ccaagaaagc aagtcttcag cctctcacca tatccttgga 3900

tgaattgttc tcatctagag gagagttcat ctctgtcgga ggtgacggac gaatgtctca 3960

taaagaggcc atcctgctcg gcctgagata caaaaagttg tacaatcagg cgagagtcaa 4020

atattctctg tagactatga aaaaaagtaa cagatatcac gatctaagtg ttatcccaat 4080

ccattcatca tgagttcctt aaagaagatt ctcggtctga aggggaaagg taagaaatct 4140

aagaaattag agatcgcacc acccccttat gaagaggaca ctagcatgga gtatgctccg 4200

agcgctccaa ttgacaaatc ctattttgga gttgacgagg cggacaccta tgatccgaat 4260

caattaagat atgagaaatt cttctttaca gtgaaaatga cggttagatc taatcgtccg 4320

ttcagaacat actcagatgt ggcagccgct gtatcccatt gggatcacat gtacatcgga 4380

atggcaggga aacgtccctt ctacaaaatc ttggcttttg caggttcttc taatctaaag 4440

gccactccag cggtattggc agatcaaggt caaccagagt atcacgctca ctgcgaaggc 4500

agggcttatt tgccacatag gatggggaag acccctccca tgctcaatgt accagagcac 4560

ttcagaagac cattcaatat aggtctttac aagggaacga ttgagctcac aatgaccatc 4620

tacgatgatg agtcactgga agcagctcct atgatctggg atcatttcaa ttcttccaaa 4680

ttttctgatt tcagagagaa ggccttaatg tttggcctga ttgtcgagaa aaaggcatct 4740

ggagcgtggt tcctggactc tatcggccac ttcaaatgag ctagtctaac ttctagcttc 4800

tgaacaatcc ccggtttact cagtctcccc taattccagc ctctcgaaca actaatatcc 4860

tgtcttttct atccctatga aaaaaactaa cagagatcga tctgtttacg cgtcactatg 4920

aagtgccttt tgtacttagc ctttttattc attggggtga attgcaagtt caccatagtt 4980

tttccacaca accaaaaagg aaactggaaa aatgttcctt ctaattacca ttattgcccg 5040

tcaagctcag atttaaattg gcataatgac ttaataggca cagccttaca agtcaaaatg 5100

cccaagagtc acaaggctat tcaagcagac ggttggatgt gtcatgcttc caaatgggtc 5160

actacttgtg atttccgctg gtatggaccg aagtatataa cacattccat ccgatccttc 5220

actccatctg tagaacaatg caaggaaagc attgaacaaa cgaaacaagg aacttggctg 5280

aatccaggct tccctcctca aagttgtgga tatgcaactg tgacggatgc cgaagcagtg 5340

attgtccagg tgactcctca ccatgtgctg gttgatgaat acacaggaga atgggttgat 5400

tcacagttca tcaacggaaa atgcagcaat tacatatgcc ccactgtcca taactctaca 5460

acctggcatt ctgactataa ggtcaaaggg ctatgtgatt ctaacctcat ttccatggac 5520

atcaccttct tctcagagga cggagagcta tcatccctgg gaaaggaggg cacagggttc 5580

agaagtaact actttgctta tgaaactgga ggcaaggcct gcaaaatgca atactgcaag 5640

cattggggag tcagactccc atcaggtgtc tggttcgaga tggctgataa ggatctcttt 5700

gctgcagcca gattccctga atgcccagaa gggtcaagta tctctgctcc atctcagacc 5760

tcagtggatg taagtctaat tcaggacgtt gagaggatct tggattattc cctctgccaa 5820

gaaacctgga gcaaaatcag agcgggtctt ccaatctctc cagtggatct cagctatctt 5880

gctcctaaaa acccaggaac cggtcctgct ttcaccataa tcaatggtac cctaaaatac 5940

tttgagacca gatacatcag agtcgatatt gctgctccaa tcctctcaag aatggtcgga 6000

atgatcagtg gaactaccac agaaagggaa ctgtgggatg actgggcacc atatgaagac 6060

gtggaaattg gacccaatgg agttctgagg accagttcag gatataagtt tcctttatac 6120

atgattggac atggtatgtt ggactccgat cttcatctta gctcaaaggc tcaggtgttc 6180

gaacatcctc acattcaaga cgctgcttcg caacttcctg atgatgagag tttatttttt 6240

ggtgatactg ggctatccaa aaatccaatc gagcttgtag aaggttggtt cagtagttgg 6300

aaaagctcta ttgcctcttt tttctttatc atagggttaa tcattggact attcttggtt 6360

ctccgagttg gtatccatct ttgcattaaa ttaaagcaca ccaagaaaag acagatttat 6420

acagacatag agatgaaccg acttggaaag taactcaaat cctgctaggt atgaaaaaaa 6480

ctaacagata tcacgctcga gatggtgagc aagggcgagg agctgttcac cggggtggtg 6540

cccatcctgg tcgagctgga cggcgacgta aacggccaca agttcagcgt gtccggcgag 6600

ggcgagggcg atgccaccta cggcaagctg accctgaagt tcatctgcac caccggcaag 6660

ctgcccgtgc cctggcccac cctcgtgacc accctgacct acggcgtgca gtgcttcagc 6720

cgctaccccg accacatgaa gcagcacgac ttcttcaagt ccgccatgcc cgaaggctac 6780

gtccaggagc gcaccatctt cttcaaggac gacggcaact acaagacccg cgccgaggtg 6840

aagttcgagg gcgacaccct ggtgaaccgc atcgagctga agggcatcga cttcaaggag 6900

gacggcaaca tcctggggca caagctggag tacaactaca acagccacaa cgtctatatc 6960

atggccgaca agcagaagaa cggcatcaag gtgaacttca agatccgcca caacatcgag 7020

gacggcagcg tgcagctcgc cgaccactac cagcagaaca cccccatcgg cgacggcccc 7080

gtgctgctgc ccgacaacca ctacctgagc acccagtccg ccctgagcaa agaccccaac 7140

gagaagcgcg atcacatggt cctgctggag ttcgtgaccg ccgccgggat cactctcggc 7200

atggacgagc tgtacaagta agctagccag attcttcatg tttggaccaa atcaacttgt 7260

gataccatgc tcaaagaggc ctcaattata tttgagtttt taatttttat gaaaaaaact 7320

aacagcaatc atggaagtcc acgattttga gaccgacgag ttcaatgatt tcaatgaaga 7380

tgactatgcc acaagagaat tcctgaatcc cgatgagcgc atgacgtact tgaatcatgc 7440

tgattacaac ctgaattctc ctctaattag tgatgatatt gacaatttaa tcaggaaatt 7500

caattctctt ccaattccct cgatgtggga tagtaagaac tgggatggag ttcttgagat 7560

gttaacgtca tgtcaagcca atcccatccc aacatctcag atgcataaat ggatgggaag 7620

ttggttaatg tctgataatc atgatgccag tcaagggtat agttttttac atgaagtgga 7680

caaagaggca gaaataacat ttgacgtggt ggagaccttc atccgcggct ggggcaacaa 7740

accaattgaa tacatcaaaa aggaaagatg gactgactca ttcaaaattc tcgcttattt 7800

gtgtcaaaag tttttggact tacacaagtt gacattaatc ttaaatgctg tctctgaggt 7860

ggaattgctc aacttggcga ggactttcaa aggcaaagtc agaagaagtt ctcatggaac 7920

gaacatatgc aggattaggg ttcccagctt gggtcctact tttatttcag aaggatgggc 7980

ttacttcaag aaacttgata ttctaatgga ccgaaacttt ctgttaatgg tcaaagatgt 8040

gattataggg aggatgcaaa cggtgctatc catggtatgt agaatagaca acctgttctc 8100

agagcaagac atcttctccc ttctaaatat ctacagaatt ggagataaaa ttgtggagag 8160

gcagggaaat ttttcttatg acttgattaa aatggtggaa ccgatatgca acttgaagct 8220

gatgaaatta gcaagagaat caaggccttt agtcccacaa ttccctcatt ttgaaaatca 8280

tatcaagact tctgttgatg aaggggcaaa aattgaccga ggtataagat tcctccatga 8340

tcagataatg agtgtgaaaa cagtggatct cacactggtg atttatggat cgttcagaca 8400

ttggggtcat ccttttatag attattacac tggactagaa aaattacatt cccaagtaac 8460

catgaagaaa gatattgatg tgtcatatgc aaaagcactt gcaagtgatt tagctcggat 8520

tgttctattt caacagttca atgatcataa aaagtggttc gtgaatggag acttgctccc 8580

tcatgatcat ccctttaaaa gtcatgttaa agaaaataca tggcccacag ctgctcaagt 8640

tcaagatttt ggagataaat ggcatgaact tccgctgatt aaatgttttg aaatacccga 8700

cttactagac ccatcgataa tatactctga caaaagtcat tcaatgaata ggtcagaggt 8760

gttgaaacat gtccgaatga atccgaacac tcctatccct agtaaaaagg tgttgcagac 8820

tatgttggac acaaaggcta ccaattggaa agaatttctt aaagagattg atgagaaggg 8880

cttagatgat gatgatctaa ttattggtct taaaggaaag gagagggaac tgaagttggc 8940

aggtagattt ttctccctaa tgtcttggaa attgcgagaa tactttgtaa ttaccgaata 9000

tttgataaag actcatttcg tccctatgtt taaaggcctg acaatggcgg acgatctaac 9060

tgcagtcatt aaaaagatgt tagattcctc atccggccaa ggattgaagt catatgaggc 9120

aatttgcata gccaatcaca ttgattacga aaaatggaat aaccaccaaa ggaagttatc 9180

aaacggccca gtgttccgag ttatgggcca gttcttaggt tatccatcct taatcgagag 9240

aactcatgaa ttttttgaga aaagtcttat atactacaat ggaagaccag acttgatgcg 9300

tgttcacaac aacacactga tcaattcaac ctcccaacga gtttgttggc aaggacaaga 9360

gggtggactg gaaggtctac ggcaaaaagg atggagtatc ctcaatctac tggttattca 9420

aagagaggct aaaatcagaa acactgctgt caaagtcttg gcacaaggtg ataatcaagt 9480

tatttgcaca cagtataaaa cgaagaaatc gagaaacgtt gtagaattac agggtgctct 9540

caatcaaatg gtttctaata atgagaaaat tatgactgca atcaaaatag ggacagggaa 9600

gttaggactt ttgataaatg acgatgagac tatgcaatct gcagattact tgaattatgg 9660

aaaaataccg attttccgtg gagtgattag agggttagag accaagagat ggtcacgagt 9720

gacttgtgtc accaatgacc aaatacccac ttgtgctaat ataatgagct cagtttccac 9780

aaatgctctc accgtagctc attttgctga gaacccaatc aatgccatga tacagtacaa 9840

ttattttggg acatttgcta gactcttgtt gatgatgcat gatcctgctc ttcgtcaatc 9900

attgtatgaa gttcaagata agataccggg cttgcacagt tctactttca aatacgccat 9960

gttgtatttg gacccttcca ttggaggagt gtcgggcatg tctttgtcca ggtttttgat 10020

tagagccttc ccagatcccg taacagaaag tctctcattc tggagattca tccatgtaca 10080

tgctcgaagt gagcatctga aggagatgag tgcagtattt ggaaaccccg agatagccaa 10140

gtttcgaata actcacatag acaagctagt agaagatcca acctctctga acatcgctat 10200

gggaatgagt ccagcgaact tgttaaagac tgaggttaaa aaatgcttaa tcgaatcaag 10260

acaaaccatc aggaaccagg tgattaagga tgcaaccata tatttgtatc atgaagagga 10320

tcggctcaga agtttcttat ggtcaataaa tcctctgttc cctagatttt taagtgaatt 10380

caaatcaggc acttttttgg gagtcgcaga cgggctcatc agtctatttc aaaattctcg 10440

tactattcgg aactccttta agaaaaagta tcatagggaa ttggatgatt tgattgtgag 10500

gagtgaggta tcctctttga cacatttagg gaaacttcat ttgagaaggg gatcatgtaa 10560

aatgtggaca tgttcagcta ctcatgctga cacattaaga tacaaatcct ggggccgtac 10620

agttattggg acaactgtac cccatccatt agaaatgttg ggtccacaac atcgaaaaga 10680

gactccttgt gcaccatgta acacatcagg gttcaattat gtttctgtgc attgtccaga 10740

cgggatccat gacgtcttta gttcacgggg accattgcct gcttatctag ggtctaaaac 10800

atctgaatct acatctattt tgcagccttg ggaaagggaa agcaaagtcc cactgattaa 10860

aagagctaca cgtcttagag atgctatctc ttggtttgtt gaacccgact ctaaactagc 10920

aatgactata ctttctaaca tccactcttt aacaggcgaa gaatggacca aaaggcagca 10980

tgggttcaaa agaacagggt ctgcccttca taggttttcg acatctcgga tgagccatgg 11040

tgggttcgca tctcagagca ctgcagcatt gaccaggttg atggcaacta cagacaccat 11100

gagggatctg ggagatcaga atttcgactt tttattccaa gcaacgttgc tctatgctca 11160

aattaccacc actgttgcaa gagacggatg gatcaccagt tgtacagatc attatcatat 11220

tgcctgtaag tcctgtttga gacccataga agagatcacc ctggactcaa gtatggacta 11280

cacgccccca gatgtatccc atgtgctgaa gacatggagg aatggggaag gttcgtgggg 11340

acaagagata aaacagatct atcctttaga agggaattgg aagaatttag cacctgctga 11400

gcaatcctat caagtcggcg gatgtatagg ttttctatat ggagacttgg cgtatagaaa 11460

atctactcat gccgaggaca gttctctatt tcctctatct atacaaggtc gtattagagg 11520

tcgaggtttc ttaaaagggt tgctagacgg attaatgaga gcaagttgct gccaagtaat 11580

acaccggaga agtctggctc atttgaagag gccggccaac gcagtgtacg gaggtttgat 11640

ttacttgatt gataaattga gtgtatcacc tccattcctt tctcttacta gatcaggacc 11700

tattagagac gaattagaaa cgattcccca caagatccca acctcctatc cgacaagcaa 11760

ccgtgatatg ggggtgattg tcagaaatta cttcaaatac caatgccgtc taattgaaaa 11820

gggaaaatac agatcacatt attcacaatt atggttattc tcagatgtct tatccataga 11880

cttcattgga ccattctcta tttccaccac cctcttgcaa atcctataca agccattttt 11940

atctgggaaa gataagaatg agttgagaga gctggcaaat ctttcttcat tgctaagatc 12000

aggagagggg tgggaagaca tacatgtgaa attcttcacc aaggacatat tattgtgtcc 12060

agaggaaatc agacatgctt gcaagttcgg gattgctaag gataataata aagacatgag 12120

ctatccccct tggggaaggg aatccagagg gacaattaca acaatccctg tttattatac 12180

gaccacccct tacccaaaga tgctagagat gcctccaaga atccaaaatc ccctgctgtc 12240

cggaatcagg ttgggccaat taccaactgg cgctcattat aaaattcgga gtatattaca 12300

tggaatggga atccattaca gggacttctt gagttgtgga gacggctccg gagggatgac 12360

tgctgcatta ctacgagaaa atgtgcatag cagaggaata ttcaatagtc tgttagaatt 12420

atcagggtca gtcatgcgag gcgcctctcc tgagcccccc agtgccctag aaactttagg 12480

aggagataaa tcgagatgtg taaatggtga aacatgttgg gaatatccat ctgacttatg 12540

tgacccaagg acttgggact atttcctccg actcaaagca ggcttggggc ttcaaattga 12600

tttaattgta atggatatgg aagtgcggga ttcttctact agcctgaaaa ttgagacgaa 12660

tgttagaaat tatgtgcacc ggattttgga tgagcaagga gttttaatct acaagactta 12720

tggaacatat atttgtgaga gcgaaaagaa tgcagtaaca atccttggtc ccatgttcaa 12780

gacggtcgac ttagttcaaa cagaatttag tagttctcaa acgtctgaagtatatatggt 12840

atgtaaaggt ttgaagaaat taatcgatga acccaatccc gattggtctt ccatcaatga 12900

atcctggaaa aacctgtacg cattccagtc atcagaacag gaatttgcca gagcaaagaa 12960

ggttagtaca tactttacct tgacaggtat tccctcccaa ttcattcctg atccttttgt 13020

aaacattgag actatgctac aaatattcgg agtacccacg ggtgtgtctc atgcggctgc 13080

cttaaaatca tctgatagac ctgcagattt attgaccatt agcctttttt atatggcgat 13140

tatatcgtat tataacatca atcatatcag agtaggaccg atacctccga accccccatc 13200

agatggaatt gcacaaaatg tggggatcgc tataactggt ataagctttt ggctgagttt 13260

gatggagaaa gacattccac tatatcaaca gtgtttagca gttatccagc aatcattccc 13320

gattaggtgg gaggctgttt cagtaaaagg aggatacaag cagaagtgga gtactagagg 13380

tgatgggctc ccaaaagata cccgaatttc agactccttg gccccaatcg ggaactggat 13440

cagatctctg gaattggtcc gaaaccaagt tcgtctaaat ccattcaatg agatcttgtt 13500

caatcagcta tgt 13513

<210>5

<211>74

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ctcgagcgcc accggcgcgc ctctagctat agcatgaaaa aaactaaaca gatatcatgg 60

ctaagcgcgg ccgc 74

<210>6

<211>14359

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

taatacgact cactatagga cgaagacaaa caaaccatta ttatcattaa aaggctcagg 60

agaaacttta acagtaatca aaatgtctgt tacagtcaag agaatcattg acaacacagt 120

cgtagttcca aaacttcctg caaatgagga tccagtggaa tacccggcag attacttcag 180

aaaatcaaag gagattcctc tttacatcaa tactacaaaa agtttgtcag atctaagagg 240

atatgtctac caaggcctca aatccggaaa tgtatcaatc atacatgtca acagctactt 300

gtatggagca ttaaaggaca tccggggtaa gttggataaa gattggtcaa gtttcggaat 360

aaacatcggg aaagcagggg atacaatcgg aatatttgac cttgtatcct tgaaagccct 420

ggacggcgta cttccagatg gagtatcgga tgcttccaga accagcgcag atgacaaatg 480

gttgcctttg tatctacttg gcttatacag agtgggcaga acacaaatgc ctgaatacag 540

aaaaaagctc atggatgggc tgacaaatca atgcaaaatg atcaatgaac agtttgaacc 600

tcttgtgcca gaaggtcgtg acatttttga tgtgtgggga aatgacagta attacacaaa 660

aattgtcgct gcagtggaca tgttcttcca catgttcaaa aaacatgaat gtgcctcgtt 720

cagatacgga actattgttt ccagattcaa agattgtgct gcattggcaa catttggaca 780

cctctgcaaa ataaccggaa tgtctacaga agatgtaacg acctggatct tgaaccgaga 840

agttgcagat gaaatggtcc aaatgatgct tccaggccaa gaaattgaca aggccgattc 900

atacatgcct tatttgatcg actttggatt gtcttctaag tctccatatt cttccgtcaa 960

aaaccctgcc ttccacttct gggggcaatt gacagctctt ctgctcagat ccaccagagc 1020

aaggaatgcc cgacagcctg atgacattga gtatacatct cttactacag caggtttgtt 1080

gtacgcttat gcagtaggat cctctgccga cttggcacaa cagttttgtg ttggagataa 1140

caaatacact ccagatgata gtaccggagg attgacgact aatgcaccgc cacaaggcag 1200

agatgtggtc gaatggctcg gatggtttga agatcaaaac agaaaaccga ctcctgatat 1260

gatgcagtat gcgaaaagag cagtcatgtc actgcaaggc ctaagagaga agacaattgg 1320

caagtatgct aagtcagaat ttgacaaatg accctataat tctcagatca cctattatat 1380

attatgctac atatgaaaaa aactaacaga tatcatggat aatctcacaa aagttcgtga 1440

gtatctcaag tcctattctc gtctggatca ggcggtagga gagatagatg agatcgaagc 1500

acaacgagct gaaaagtcca attatgagtt gttccaagag gatggagtgg aagagcatac 1560

taagccctct tattttcagg cagcagatga ttctgacaca gaatctgaac cagaaattga 1620

agacaatcaa ggcttgtatg caccagatcc agaagctgag caagttgaag gctttataca 1680

ggggccttta gatgactatg cagatgagga agtggatgtt gtatttactt cggactggaa 1740

acagcctgag cttgaatctg acgagcatgg aaagacctta cggttgacat cgccagaggg 1800

tttaagtgga gagcagaaat cccagtggct ttcgacgatt aaagcagtcg tgcaaagtgc 1860

caaatactgg aatctggcag agtgcacatt tgaagcatcg ggagaagggg tcattatgaa 1920

ggagcgccag ataactccgg atgtatataa ggtcactcca gtgatgaaca cacatccgtc 1980

ccaatcagaa gcagtatcag atgtttggtc tctctcaaag acatccatga ctttccaacc 2040

caagaaagca agtcttcagc ctctcaccat atccttggat gaattgttct catctagagg 2100

agagttcatc tctgtcggaggtgacggacg aatgtctcat aaagaggcca tcctgctcgg 2160

cctgagatac aaaaagttgt acaatcaggc gagagtcaaa tattctctgt agactatgaa 2220

aaaaagtaac agatatcacg atctaagtgt tatcccaatc cattcatcat gagttcctta 2280

aagaagattc tcggtctgaa ggggaaaggt aagaaatcta agaaattagg gatcgcacca 2340

cccccttatg aagaggacac tagcatggag tatgctccga gcgctccaat tgacaaatcc 2400

tattttggag ttgacgagat ggacacctat gatccgaatc aattaagata tgagaaattc 2460

ttctttacag tgaaaatgac ggttagatct aatcgtccgt tcagaacata ctcagatgtg 2520

gcagccgctg tatcccattg ggatcacatg tacatcggaa tggcagggaa acgtcccttc 2580

tacaaaatct tggctttttt gggttcttct aatctaaagg ccactccagc ggtattggca 2640

gatcaaggtc aaccagagta tcacgctcac tgcgaaggca gggcttattt gccacatagg 2700

atggggaaga cccctcccat gctcaatgta ccagagcact tcagaagacc attcaatata 2760

ggtctttaca agggaacgat tgagctcaca atgaccatct acgatgatga gtcactggaa 2820

gcagctccta tgatctggga tcatttcaat tcttccaaat tttctgattt cagagagaag 2880

gccttaatgt ttggcctgat tgtcgagaaa aaggcatctg gagcgtgggt cctggactct 2940

atcggccact tcaaatgagc tagtctaact tctagcttct gaacaatccc cggtttactc 3000

agtctcccct aattccagcc tctcgaacaa ctaatatcct gtcttttcta tccctatgaa 3060

aaaaactaac agagatcgat ctgtttacgc gtcactatga agtgcctttt gtacttagcc 3120

tttttattca ttggggtgaa ttgcaagttc accatagttt ttccacacaa ccaaaaagga 3180

aactggaaaa atgttccttc taattaccat tattgcccgt caagctcaga tttaaattgg 3240

cataatgact taataggcac agccttacaa gtcaaaatgc ccaagagtca caaggctatt 3300

caagcagacg gttggatgtg tcatgcttcc aaatgggtca ctacttgtga tttccgctgg 3360

tatggaccga agtatataac acattccatc cgatccttca ctccatctgt agaacaatgc 3420

aaggaaagca ttgaacaaac gaaacaagga acttggctga atccaggctt ccctcctcaa 3480

agttgtggat atgcaactgt gacggatgcc gaagcagtga ttgtccaggt gactcctcac 3540

catgtgctgg ttgatgaata cacaggagaa tgggttgatt cacagttcat caacggaaaa 3600

tgcagcaatt acatatgccc cactgtccat aactctacaa cctggcattc tgactataag 3660

gtcaaagggc tatgtgattc taacctcatt tccatggaca tcaccttctt ctcagaggac 3720

ggagagctat catccctggg aaaggagggc acagggttca gaagtaacta ctttgcttat 3780

gaaactggag gcaaggcctg caaaatgcaa tactgcaagc attggggagt cagactccca 3840

tcaggtgtct ggttcgagat ggctgataag gatctctttg ctgcagccag attccctgaa 3900

tgcccagaag ggtcaagtat ctctgctcca tctcagacct cagtggatgt aagtctaatt 3960

caggacgttg agaggatctt ggattattcc ctctgccaag aaacctggag caaaatcaga 4020

gcgggtcttc caatctctcc agtggatctc agctatcttg ctcctaaaaa cccaggaacc 4080

ggtcctgctt tcaccataat caatggtacc ctaaaatact ttgagaccag atacatcaga 4140

gtcgatattg ctgctccaat cctctcaaga atggtcggaa tgatcagtgg aactaccaca 4200

gaaagggaac tgtgggatga ctgggcacca tatgaagacg tggaaattgg acccaatgga 4260

gttctgagga ccagttcagg atataagttt cctttataca tgattggaca tggtatgttg 4320

gactccgatc ttcatcttag ctcaaaggct caggtgttcg aacatcctca cattcaagac 4380

gctgcttcgc aacttcctga tgatgagagt ttattttttg gtgatactgg gctatccaaa 4440

aatccaatcg agcttgtaga aggttggttc agtagttgga aaagctctat tgcctctttt 4500

ttctttatca tagggttaat cattggacta ttcttggttc tccgagttgg tatccatctt 4560

tgcattaaat taaagcacac caagaaaaga cagatttata cagacataga gatgaaccga 4620

cttggaaagt aactcaaatc ctgctaggta tgaaaaaaac taacagatat cacgctcgag 4680

cgccaccggc gcgcctctag ctatagcatg aaaaaaacta aacagatatc atggctaagc 4740

gcggccgcca gattcttcat gtttggacca aatcaacttg tgataccatg ctcaaagagg 4800

cctcaattat atttgagttt ttaattttta tgaaaaaaac taacagcaat catggaagtc 4860

cacgattttg agaccgacga gttcaatgat ttcaatgaag atgactatgc cacaagagaa 4920

ttcctgaatc ccgatgagcg catgacgtac ttgaatcatg ctgattacaa cctgaattct 4980

cctctaatta gtgatgatat tgacaattta atcaggaaat tcaattctct tccaattccc 5040

tcgatgtggg atagtaagaa ctgggatgga gttcttgaga tgttaacgtc atgtcaagcc 5100

aatcccatcc caacatctca gatgcataaa tggatgggaa gttggttaat gtctgataat 5160

catgatgcca gtcaagggta tagtttttta catgaagtgg acaaagaggc agaaataaca 5220

tttgacgtgg tggagacctt catccgcggc tggggcaaca aaccaattga atacatcaaa 5280

aaggaaagat ggactgactc attcaaaatt ctcgcttatt tgtgtcaaaa gtttttggac 5340

ttacacaagt tgacattaat cttaaatgct gtctctgagg tggaattgct caacttggcg 5400

aggactttca aaggcaaagt cagaagaagt tctcatggaa cgaacatatg caggattagg 5460

gttcccagct tgggtcctac ttttatttca gaaggatggg cttacttcaa gaaacttgat 5520

attctaatgg accgaaactt tctgttaatg gtcaaagatg tgattatagg gaggatgcaa 5580

acggtgctat ccatggtatg tagaatagac aacctgttct cagagcaaga catcttctcc 5640

cttctaaata tctacagaat tggagataaa attgtggaga ggcagggaaa tttttcttat 5700

gacttgatta aaatggtgga accgatatgc aacttgaagc tgatgaaatt agcaagagaa 5760

tcaaggcctt tagtcccaca attccctcat tttgaaaatc atatcaagac ttctgttgat 5820

gaaggggcaa aaattgaccg aggtataaga ttcctccatg atcagataat gagtgtgaaa 5880

acagtggatc tcacactggt gatttatgga tcgttcagac attggggtca tccttttata 5940

gattattaca ctggactaga aaaattacat tcccaagtaa ccatgaagaa agatattgat 6000

gtgtcatatg caaaagcact tgcaagtgat ttagctcgga ttgttctatt tcaacagttc 6060

aatgatcata aaaagtggtt cgtgaatgga gacttgctcc ctcatgatca tccctttaaa 6120

agtcatgtta aagaaaatac atggcccaca gctgctcaag ttcaagattt tggagataaa 6180

tggcatgaac ttccgctgat taaatgtttt gaaatacccg acttactaga cccatcgata 6240

atatactctg acaaaagtca ttcaatgaat aggtcagagg tgttgaaaca tgtccgaatg 6300

aatccgaaca ctcctatccc tagtaaaaag gtgttgcaga ctatgttgga cacaaaggct 6360

accaattgga aagaatttct taaagagatt gatgagaagg gcttagatga tgatgatcta 6420

attattggtc ttaaaggaaa ggagagggaa ctgaagttgg caggtagatt tttctcccta 6480

atgtcttgga aattgcgaga atactttgta attaccgaat atttgataaa gactcatttc 6540

gtccctatgt ttaaaggcct gacaatggcg gacgatctaa ctgcagtcat taaaaagatg 6600

ttagattcct catccggcca aggattgaag tcatatgagg caatttgcat agccaatcac 6660

attgattacg aaaaatggaa taaccaccaa aggaagttat caaacggccc agtgttccga 6720

gttatgggcc agttcttagg ttatccatcc ttaatcgaga gaactcatga attttttgag 6780

aaaagtctta tatactacaa tggaagacca gacttgatgc gtgttcacaa caacacactg 6840

atcaattcaa cctcccaacg agtttgttgg caaggacaag agggtggact ggaaggtcta 6900

cggcaaaaag gatggagtat cctcaatcta ctggttattc aaagagaggc taaaatcaga 6960

aacactgctg tcaaagtctt ggcacaaggt gataatcaag ttatttgcac acagtataaa 7020

acgaagaaat cgagaaacgt tgtagaatta cagggtgctc tcaatcaaat ggtttctaat 7080

aatgagaaaa ttatgactgc aatcaaaata gggacaggga agttaggact tttgataaat 7140

gacgatgaga ctatgcaatc tgcagattac ttgaattatg gaaaaatacc gattttccgt 7200

ggagtgatta gagggttaga gaccaagaga tggtcacgag tgacttgtgt caccaatgac 7260

caaataccca cttgtgctaa tataatgagc tcagtttcca caaatgctct caccgtagct 7320

cattttgctg agaacccaat caatgccatg atacagtaca attattttgg gacatttgct 7380

agactcttgt tgatgatgca tgatcctgct cttcgtcaat cattgtatga agttcaagat 7440

aagataccgg gcttgcacag ttctactttc aaatacgcca tgttgtattt ggacccttcc 7500

attggaggag tgtcgggcat gtctttgtcc aggtttttga ttagagcctt cccagatccc 7560

gtaacagaaa gtctctcatt ctggagattc atccatgtac atgctcgaag tgagcatctg 7620

aaggagatga gtgcagtatt tggaaacccc gagatagcca agtttcgaat aactcacata 7680

gacaagctag tagaagatcc aacctctctg aacatcgcta tgggaatgag tccagcgaac 7740

ttgttaaaga ctgaggttaa aaaatgctta atcgaatcaa gacaaaccat caggaaccag 7800

gtgattaagg atgcaaccat atatttgtat catgaagagg atcggctcag aagtttctta 7860

tggtcaataa atcctctgtt ccctagattt ttaagtgaat tcaaatcagg cacttttttg 7920

ggagtcgcag acgggctcat cagtctattt caaaattctc gtactattcg gaactccttt 7980

aagaaaaagt atcataggga attggatgat ttgattgtga ggagtgaggt atcctctttg 8040

acacatttag ggaaacttca tttgagaagg ggatcatgta aaatgtggac atgttcagct 8100

actcatgctg acacattaag atacaaatcc tggggccgta cagttattgg gacaactgta 8160

ccccatccat tagaaatgtt gggtccacaa catcgaaaag agactccttg tgcaccatgt 8220

aacacatcag ggttcaatta tgtttctgtg cattgtccag acgggatcca tgacgtcttt 8280

agttcacggg gaccattgcc tgcttatcta gggtctaaaa catctgaatc tacatctatt 8340

ttgcagcctt gggaaaggga aagcaaagtc ccactgatta aaagagctac acgtcttaga 8400

gatgctatct cttggtttgt tgaacccgac tctaaactag caatgactat actttctaac 8460

atccactctt taacaggcga agaatggacc aaaaggcagc atgggttcaa aagaacaggg 8520

tctgcccttc ataggttttc gacatctcgg atgagccatg gtgggttcgc atctcagagc 8580

actgcagcat tgaccaggtt gatggcaact acagacacca tgagggatct gggagatcag 8640

aatttcgact ttttattcca agcaacgttg ctctatgctc aaattaccac cactgttgca 8700

agagacggat ggatcaccag ttgtacagat cattatcata ttgcctgtaa gtcctgtttg 8760

agacccatag aagagatcac cctggactca agtatggact acacgccccc agatgtatcc 8820

catgtgctga agacatggag gaatggggaa ggttcgtggg gacaagagat aaaacagatc 8880

tatcctttag aagggaattg gaagaattta gcacctgctg agcaatccta tcaagtcggc 8940

ggatgtatag gttttctata tggagacttg gcgtatagaa aatctactca tgccgaggac 9000

agttctctat ttcctctatc tatacaaggt cgtattagag gtcgaggttt cttaaaaggg 9060

ttgctagacg gattaatgag agcaagttgc tgccaagtaa tacaccggag aagtctggct 9120

catttgaaga ggccggccaa cgcagtgtac ggaggtttga tttacttgat tgataaattg 9180

agtgtatcac ctccattcct ttctcttact agatcaggac ctattagaga cgaattagaa 9240

acgattcccc acaagatccc aacctcctat ccgacaagca accgtgatat gggggtgatt 9300

gtcagaaatt acttcaaata ccaatgccgt ctaattgaaa agggaaaata cagatcacat 9360

tattcacaat tatggttatt ctcagatgtc ttatccatag acttcattgg accattctct 9420

atttccacca ccctcttgca aatcctatac aagccatttt tatctgggaa agataagaat 9480

gagttgagag agctggcaaa tctttcttca ttgctaagat caggagaggg gtgggaagac 9540

atacatgtga aattcttcac caaggacata ttattgtgtc cagaggaaat cagacatgct 9600

tgcaagttcg ggattgctaa ggataataat aaagacatga gctatccccc ttggggaagg 9660

gaatccagag ggacaattac aacaatccct gtttattata cgaccacccc ttacccaaag 9720

atgctagaga tgcctccaag aatccaaaat cccctgctgt ccggaatcag gttgggccaa 9780

ttaccaactg gcgctcatta taaaattcgg agtatattac atggaatggg aatccattac 9840

agggacttct tgagttgtgg agacggctcc ggagggatga ctgctgcatt actacgagaa 9900

aatgtgcata gcagaggaat attcaatagt ctgttagaat tatcagggtc agtcatgcga 9960

ggcgcctctc ctgagccccc cagtgcccta gaaactttag gaggagataa atcgagatgt 10020

gtaaatggtg aaacatgttg ggaatatcca tctgacttat gtgacccaag gacttgggac 10080

tatttcctcc gactcaaagc aggcttgggg cttcaaattg atttaattgt aatggatatg 10140

gaagtgcggg attcttctac tagcctgaaa attgagacga atgttagaaa ttatgtgcac 10200

cggattttgg atgagcaagg agttttaatc tacaagactt atggaacata tatttgtgag 10260

agcgaaaaga atgcagtaac aatccttggt cccatgttca agacggtcga cttagttcaa 10320

acagaattta gtagttctca aacgtctgaa gtatatatgg tatgtaaagg tttgaagaaa 10380

ttaatcgatg aacccaatcc cgattggtct tccatcaatg aatcctggaa aaacctgtac 10440

gcattccagt catcagaaca ggaatttgcc agagcaaaga aggttagtac atactttacc 10500

ttgacaggta ttccctccca attcattcct gatccttttg taaacattga gactatgcta 10560

caaatattcg gagtacccac gggtgtgtct catgcggctg ccttaaaatc atctgataga 10620

cctgcagatt tattgaccat tagccttttt tatatggcga ttatatcgta ttataacatc 10680

aatcatatca gagtaggacc gatacctccg aaccccccat cagatggaat tgcacaaaat 10740

gtggggatcg ctataactgg tataagcttt tggctgagtt tgatggagaa agacattcca 10800

ctatatcaac agtgtttagc agttatccag caatcattcc cgattaggtg ggaggctgtt 10860

tcagtaaaag gaggatacaa gcagaagtgg agtactagag gtgatgggct cccaaaagat 10920

acccgaattt cagactcctt ggccccaatc gggaactgga tcagatctct ggaattggtc 10980

cgaaaccaag ttcgtctaaa tccattcaat gagatcttgt tcaatcagct atgtcgtaca 11040

gtggataatc atttgaaatg gtcaaatttg cgaagaaaca caggaatgat tgaatggatc 11100

aatagacgaa tttcaaaaga agaccggtct atactgatgt tgaagagtga cctacacgag 11160

gaaaactctt ggagagatta aaaaatcatg aggagactcc aaactttaag tatgaaaaaa 11220

actttgatcc ttaagaccct cttgtggttt ttatttttta tctggttttg tggtcttcgt 11280

gggtcggcat ggcatctcca cctcctcgcg gtccgacctg ggcatccgaa ggaggacgtc 11340

gtccactcgg atggctaagg gaggggcccc cgcggggctg ctaacaaagc ccgaaaggaa 11400

gctgagttgg ctgctgccac cgctgagcaa taactagcat aaccccttgg ggcctctaaa 11460

cgggtcttga ggggtttttt gctgaaagga ggaactatat ccggatcgag acctcgatac 11520

tagtgcggtg gagctccagc ttttgttccc tttagtgagg gttaatttcg agcttggcgt 11580

aatcatggtc atagctgttt cctgtgtgaa attgttatcc gctcacaatt ccacacaaca 11640

tacgagccgg aagcataaag tgtaaagcct ggggtgccta atgagtgagc taactcacat 11700

taattgcgtt gcgctcactg cccgctttcc agtcgggaaa cctgtcgtgc cagctgcatt 11760

aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat tgggcgctct tccgcttcct 11820

cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg agcggtatca gctcactcaa 11880

aggcggtaat acggttatcc acagaatcag gggataacgc aggaaagaac atgtgagcaa 11940

aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc 12000

tccgcccccc tgacgagcat cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga 12060

caggactata aagataccag gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc 12120

cgaccctgcc gcttaccgga tacctgtccg cctttctccc ttcgggaagc gtggcgcttt 12180

ctcatagctc acgctgtagg tatctcagtt cggtgtaggt cgttcgctcc aagctgggct 12240

gtgtgcacga accccccgtt cagcccgacc gctgcgcctt atccggtaac tatcgtcttg 12300

agtccaaccc ggtaagacac gacttatcgc cactggcagc agccactggt aacaggatta 12360

gcagagcgag gtatgtaggc ggtgctacag agttcttgaa gtggtggcct aactacggct 12420

acactagaag aacagtattt ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa 12480

gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt 12540

gcaagcagca gattacgcgc agaaaaaaag gatctcaaga agatcctttg atcttttcta 12600

cggggtctga cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgagattat 12660

caaaaaggat cttcacctag atccttttaa attaaaaatg aagttttaaa tcaatctaaa 12720

gtatatatga gtaaacttgg tctgacagtt accaatgctt aatcagtgag gcacctatct 12780

cagcgatctg tctatttcgt tcatccatag ttgcctgact ccccgtcgtg tagataacta 12840

cgatacggga gggcttacca tctggcccca gtgctgcaat gataccgcga gacccacgct 12900

caccggctcc agatttatca gcaataaacc agccagccgg aagggccgag cgcagaagtg 12960

gtcctgcaac tttatccgcc tccatccagt ctattaattg ttgccgggaa gctagagtaa 13020

gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt 13080

cacgctcgtc gtttggtatg gcttcattca gctccggttc ccaacgatca aggcgagtta 13140

catgatcccc catgttgtgc aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca 13200

gaagtaagtt ggccgcagtg ttatcactca tggttatggc agcactgcat acttctctta 13260

ctgtcatgcc atccgtaaga tgcttttctg tgactggtga gtactcaacc aagtcattct 13320

gagaatagtg tatgcggcga ccgagttgct cttgcccggc gtcaatacgg gataataccg 13380

cgccacatag cagaacttta aaagtgctca tcattggaaa acgttcttcg gggcgaaaac 13440

tctcaaggat cttaccgctg ttgagatcca gttcgatgta acccactcgt gcacccaact 13500

gatcttcagc atcttttact ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa 13560

atgccgcaaa aaagggaata agggcgacac ggaaatgttg aatactcata ctcttccttt 13620

ttcaatatta ttgaagcatt tatcagggtt attgtctcat gagcggatac atatttgaat 13680

gtatttagaa aaataaacaa ataggggttc cgcgcacatt tccccgaaaa gtgccaccta 13740

aattgtaagc gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa tcagctcatt 13800

ttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat agaccgagat 13860

agggttgagt gttgttccag tttggaacaa gagtccacta ttaaagaacg tggactccaa 13920

cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac catcacccta 13980

atcaagtttt ttggggtcga ggtgccgtaa agcactaaat cggaacccta aagggagccc 14040

ccgatttaga gcttgacggg gaaagccggc gaacgtggcg agaaaggaag ggaagaaagc 14100

gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg taaccaccac 14160

acccgccgcg cttaatgcgc cgctacaggg cgcgtcccat tcgccattca ggctgcgcaa 14220

ctgttgggaa gggcgatcgg tgcgggcctc ttcgctatta cgccagctgg cgaaaggggg 14280

atgtgctgca aggcgattaa gttgggtaac gccagggttt tcccagtcac gacgttgtaa 14340

aacgacggcc agtgaattg 14359

<210>7

<211>6058

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60

gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120

ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180

ggactttcca ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac 240

atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300

cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360

tattagtcat cgctattacc atgggtcgag gtgagcccca cgttctgctt cactctcccc 420

atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 480

gcgatggggg cggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg 540

gggcggggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600

tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660

gggagtcgct gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc 720

ccggctctga ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc 780

gggctgtaat tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag 840

ccttaaaggg ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg 900

tgtgtgtgtg cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg 960

cgggcgcggc gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc 1020

ggtgccccgc ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg 1080

tgggggggtg agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc 1140

cctccccgag ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc 1200

gcggggctcg ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg 1260

ccgcctcggg ccggggaggg ctcgggggag gggcgcggcg gccccggagc gccggcggct 1320

gtcgaggcgc ggcgagccgc agccattgcc ttttatggta atcgtgcgag agggcgcagg 1380

gacttccttt gtcccaaatc tggcggagcc gaaatctggg aggcgccgcc gcaccccctc 1440

tagcgggcgc gggcgaagcg gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt 1500

cgtgcgtcgc cgcgccgccg tccccttctc catctccagc ctcggggctg ccgcaggggg 1560

acggctgcct tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg 1620

gctctagagc ctctgctaac catgttcatg ccttcttctt tttcctacag ctcctgggca 1680

acgtgctggt tgttgtgctg tctcatcatt ttggcaaaga attcatgtct gttacagtca 1740

agagaatcat tgacaacaca gtcgtagttc caaaacttcc tgcaaatgag gatccagtgg 1800

aatacccggc agattacttc agaaaatcaa aggagattcc tctttacatc aatactacaa 1860

aaagtttgtc agatctaaga ggatatgtct accaaggcct caaatccgga aatgtatcaa 1920

tcatacatgt caacagctac ttgtatggag cattaaagga catccggggt aagttggata 1980

aagattggtc aagtttcgga ataaacatcg ggaaagcagg ggatacaatc ggaatatttg 2040

accttgtatc cttgaaagcc ctggacggcg tacttccaga tggagtatcg gatgcttcca 2100

gaaccagcgc agatgacaaa tggttgcctt tgtatctact tggcttatac agagtgggca 2160

gaacacaaat gcctgaatac agaaaaaagc tcatggatgg gctgacaaat caatgcaaaa 2220

tgatcaatga acagtttgaa cctcttgtgc cagaaggtcg tgacattttt gatgtgtggg 2280

gaaatgacag taattacaca aaaattgtcg ctgcagtgga catgttcttc cacatgttca 2340

aaaaacatga atgtgcctcg ttcagatacg gaactattgt ttccagattc aaagattgtg 2400

ctgcattggc aacatttgga cacctctgca aaataaccgg aatgtctaca gaagatgtaa 2460

cgacctggat cttgaaccga gaagttgcag atgaaatggt ccaaatgatg cttccaggcc 2520

aagaaattga caaggccgat tcatacatgc cttatttgat cgactttgga ttgtcttcta 2580

agtctccata ttcttccgtc aaaaaccctg ccttccactt ctgggggcaa ttgacagctc 2640

ttctgctcag atccaccaga gcaaggaatg cccgacagcc tgatgacatt gagtatacat 2700

ctcttactac agcaggtttg ttgtacgctt atgcagtagg atcctctgcc gacttggcac 2760

aacagttttg tgttggagat aacaaataca ctccagatga tagtaccgga ggattgacga 2820

ctaatgcacc gccacaaggc agagatgtgg tcgaatggct cggatggttt gaagatcaaa 2880

acagaaaacc gactcctgat atgatgcagt atgcgaaaag agcagtcatg tcactgcaag 2940

gcctaagaga gaagacaatt ggcaagtatg ctaagtcaga atttgacaaa tgactcgagg 3000

aattcactcc tcaggtgcag gctgcctatc agaaggtggt ggctggtgtg gccaatgccc 3060

tggctcacaa ataccactga gatctttttc cctctgccaa aaattatggg gacatcatga 3120

agccccttga gcatctgact tctggctaat aaaggaaatt tattttcatt gcaatagtgt 3180

gttggaattt tttgtgtctc tcactcggaa ggacatatgg gagggcaaat catttaaaac 3240

atcagaatga gtatttggtt tagagtttgg caacatatgc catatgctgg ctgccatgaa 3300

caaaggtggc tataaagagg tcatcagtat atgaaacagc cccctgctgt ccattcctta 3360

ttccatagaa aagccttgac ttgaggttag atttttttta tattttgttt tgtgttattt 3420

ttttctttaa catccctaaa attttcctta catgttttac tagccagatt tttcctcctc 3480

tcctgactac tcccagtcat agctgtccct cttctcttat gaagatccct cgacctgcag 3540

cccaagcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac 3600

aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt 3660

gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc 3720

gtgccagcgg atccgcatct caattagtca gcaaccatag tcccgcccct aactccgccc 3780

atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt 3840

tttatttatgcagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga 3900

ggcttttttg gaggcctagg cttttgcaaa aagctaactt gtttattgca gcttataatg 3960

gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt 4020

ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggatc cgctgcatta 4080

atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc 4140

gctcactgac tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 4200

ggcggtaata cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 4260

aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct 4320

ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 4380

aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc 4440

gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc 4500

tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg 4560

tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga 4620

gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag 4680

cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 4740

cactagaagg acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag 4800

agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg 4860

caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 4920

ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 4980

aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag 5040

tatatatgag taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc 5100

agcgatctgt ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 5160

gatacgggag ggcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc 5220

accggctcca gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg 5280

tcctgcaact ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag 5340

tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc 5400

acgctcgtcg tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 5460

atgatccccc atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag 5520

aagtaagttg gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 5580

tgtcatgcca tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 5640

agaatagtgt atgcggcgac cgagttgctc ttgcccggcg tcaatacggg ataataccgc 5700

gccacatagc agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 5760

ctcaaggatc ttacgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga 5820

tcttcagcat cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat 5880

gccgcaaaaa agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt 5940

caatattatt gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt 6000

atttagaaaa ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctg 6058

<210>8

<211>11119

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60

gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120

ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180

ggactttcca ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac 240

atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300

cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360

tattagtcat cgctattacc atgggtcgag gtgagcccca cgttctgctt cactctcccc 420

atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 480

gcgatggggg cggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg 540

gggcggggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600

tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660

gggagtcgct gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc 720

ccggctctga ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc 780

gggctgtaat tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag 840

ccttaaaggg ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg 900

tgtgtgtgtg cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg 960

cgggcgcggc gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc 1020

ggtgccccgc ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg 1080

tgggggggtg agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc 1140

cctccccgag ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc 1200

gcggggctcg ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg 1260

ccgcctcggg ccggggaggg ctcgggggag gggcgcggcg gccccggagc gccggcggct 1320

gtcgaggcgc ggcgagccgc agccattgcc ttttatggta atcgtgcgag agggcgcagg 1380

gacttccttt gtcccaaatc tggcggagcc gaaatctggg aggcgccgcc gcaccccctc 1440

tagcgggcgc gggcgaagcg gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt 1500

cgtgcgtcgc cgcgccgccg tccccttctc catctccagc ctcggggctg ccgcaggggg 1560

acggctgcct tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg 1620

gctctagagc ctctgctaac catgttcatg ccttcttctt tttcctacag ctcctgggca 1680

acgtgctggt tgttgtgctg tctcatcatt ttggcaaaga attcatggaa gtccacgatt 1740

ttgagaccga cgagttcaat gatttcaatg aagatgacta tgccacaaga gaattcctga 1800

atcccgatga gcgcatgacg tacttgaatc atgctgatta caacctgaat tctcctctaa 1860

ttagtgatga tattgacaat ttaatcagga aattcaattc tcttccaatt ccctcgatgt 1920

gggatagtaa gaactgggat ggagttcttg agatgttaac gtcatgtcaa gccaatccca 1980

tcccaacatc tcagatgcat aaatggatgg gaagttggtt aatgtctgat aatcatgatg 2040

ccagtcaagg gtatagtttt ttacatgaag tggacaaaga ggcagaaata acatttgacg 2100

tggtggagac cttcatccgc ggctggggca acaaaccaat tgaatacatc aaaaaggaaa 2160

gatggactga ctcattcaaa attctcgctt atttgtgtca aaagtttttg gacttacaca 2220

agttgacatt aatcttaaat gctgtctctg aggtggaatt gctcaacttg gcgaggactt 2280

tcaaaggcaa agtcagaaga agttctcatg gaacgaacat atgcaggatt agggttccca 2340

gcttgggtcc tacttttatt tcagaaggat gggcttactt caagaaactt gatattctaa 2400

tggaccgaaa ctttctgtta atggtcaaag atgtgattat agggaggatg caaacggtgc 2460

tatccatggt atgtagaata gacaacctgt tctcagagca agacatcttc tcccttctaa 2520

atatctacag aattggagat aaaattgtgg agaggcaggg aaatttttct tatgacttga 2580

ttaaaatggt ggaaccgata tgcaacttga agctgatgaa attagcaaga gaatcaaggc 2640

ctttagtccc acaattccct cattttgaaa atcatatcaa gacttctgtt gatgaagggg 2700

caaaaattga ccgaggtata agattcctcc atgatcagat aatgagtgtg aaaacagtgg 2760

atctcacact ggtgatttat ggatcgttca gacattgggg tcatcctttt atagattatt 2820

acactggact agaaaaatta cattcccaag taaccatgaa gaaagatatt gatgtgtcat 2880

atgcaaaagc acttgcaagt gatttagctc ggattgttct atttcaacag ttcaatgatc 2940

ataaaaagtg gttcgtgaat ggagacttgc tccctcatga tcatcccttt aaaagtcatg 3000

ttaaagaaaa tacatggccc acagctgctc aagttcaaga ttttggagat aaatggcatg 3060

aacttccgct gattaaatgt tttgaaatac ccgacttact agacccatcg ataatatact 3120

ctgacaaaag tcattcaatg aataggtcag aggtgttgaa acatgtccga atgaatccga 3180

acactcctat ccctagtaaa aaggtgttgc agactatgtt ggacacaaag gctaccaatt 3240

ggaaagaatt tcttaaagag attgatgaga agggcttaga tgatgatgat ctaattattg 3300

gtcttaaagg aaaggagagg gaactgaagt tggcaggtag atttttctcc ctaatgtctt 3360

ggaaattgcg agaatacttt gtaattaccg aatatttgat aaagactcat ttcgtcccta 3420

tgtttaaagg cctgacaatg gcggacgatc taactgcagt cattaaaaag atgttagatt 3480

cctcatccgg ccaaggattg aagtcatatg aggcaatttg catagccaat cacattgatt 3540

acgaaaaatg gaataaccac caaaggaagt tatcaaacgg cccagtgttc cgagttatgg 3600

gccagttctt aggttatcca tccttaatcg agagaactca tgaatttttt gagaaaagtc 3660

ttatatacta caatggaaga ccagacttga tgcgtgttca caacaacaca ctgatcaatt 3720

caacctccca acgagtttgt tggcaaggac aagagggtgg actggaaggt ctacggcaaa 3780

aaggatggag tatcctcaat ctactggtta ttcaaagaga ggctaaaatc agaaacactg 3840

ctgtcaaagt cttggcacaa ggtgataatc aagttatttg cacacagtat aaaacgaaga 3900

aatcgagaaa cgttgtagaa ttacagggtg ctctcaatca aatggtttct aataatgaga 3960

aaattatgac tgcaatcaaa atagggacag ggaagttagg acttttgata aatgacgatg 4020

agactatgca atctgcagat tacttgaatt atggaaaaat accgattttc cgtggagtga 4080

ttagagggtt agagaccaag agatggtcac gagtgacttg tgtcaccaat gaccaaatac 4140

ccacttgtgc taatataatgagctcagttt ccacaaatgc tctcaccgta gctcattttg 4200

ctgagaaccc aatcaatgcc atgatacagt acaattattt tgggacattt gctagactct 4260

tgttgatgat gcatgatcct gctcttcgtc aatcattgta tgaagttcaa gataagatac 4320

cgggcttgca cagttctact ttcaaatacg ccatgttgta tttggaccct tccattggag 4380

gagtgtcggg catgtctttg tccaggtttt tgattagagc cttcccagat cccgtaacag 4440

aaagtctctc attctggaga ttcatccatg tacatgctcg aagtgagcat ctgaaggaga 4500

tgagtgcagt atttggaaac cccgagatag ccaagtttcg aataactcac atagacaagc 4560

tagtagaaga tccaacctct ctgaacatcg ctatgggaat gagtccagcg aacttgttaa 4620

agactgaggt taaaaaatgc ttaatcgaat caagacaaac catcaggaac caggtgatta 4680

aggatgcaac catatatttg tatcatgaag aggatcggct cagaagtttc ttatggtcaa 4740

taaatcctct gttccctaga tttttaagtg aattcaaatc aggcactttt ttgggagtcg 4800

cagacgggct catcagtcta tttcaaaatt ctcgtactat tcggaactcc tttaagaaaa 4860

agtatcatag ggaattggat gatttgattg tgaggagtga ggtatcctct ttgacacatt 4920

tagggaaact tcatttgaga aggggatcat gtaaaatgtg gacatgttca gctactcatg 4980

ctgacacatt aagatacaaa tcctggggcc gtacagttat tgggacaact gtaccccatc 5040

cattagaaat gttgggtcca caacatcgaa aagagactcc ttgtgcacca tgtaacacat 5100

cagggttcaa ttatgtttct gtgcattgtc cagacgggat ccatgacgtc tttagttcac 5160

ggggaccatt gcctgcttat ctagggtcta aaacatctga atctacatct attttgcagc 5220

cttgggaaag ggaaagcaaa gtcccactga ttaaaagagc tacacgtctt agagatgcta 5280

tctcttggtt tgttgaaccc gactctaaac tagcaatgac tatactttct aacatccact 5340

ctttaacagg cgaagaatgg accaaaaggc agcatgggtt caaaagaaca gggtctgccc 5400

ttcataggtt ttcgacatct cggatgagcc atggtgggtt cgcatctcag agcactgcag 5460

cattgaccag gttgatggca actacagaca ccatgaggga tctgggagat cagaatttcg 5520

actttttatt ccaagcaacg ttgctctatg ctcaaattac caccactgtt gcaagagacg 5580

gatggatcac cagttgtaca gatcattatc atattgcctg taagtcctgt ttgagaccca 5640

tagaagagat caccctggac tcaagtatgg actacacgcc cccagatgta tcccatgtgc 5700

tgaagacatg gaggaatggg gaaggttcgt ggggacaaga gataaaacag atctatcctt 5760

tagaagggaa ttggaagaat ttagcacctg ctgagcaatc ctatcaagtc ggcggatgta 5820

taggttttct atatggagac ttggcgtata gaaaatctac tcatgccgag gacagttctc 5880

tatttcctct atctatacaa ggtcgtatta gaggtcgagg tttcttaaaa gggttgctag 5940

acggattaat gagagcaagt tgctgccaag taatacaccg gagaagtctg gctcatttga 6000

agaggccggc caacgcagtg tacggaggtt tgatttactt gattgataaa ttgagtgtat 6060

cacctccatt cctttctctt actagatcag gacctattag agacgaatta gaaacgattc 6120

cccacaagat cccaacctcc tatccgacaa gcaaccgtga tatgggggtg attgtcagaa 6180

attacttcaa ataccaatgc cgtctaattg aaaagggaaa atacagatca cattattcac 6240

aattatggtt attctcagat gtcttatcca tagacttcat tggaccattc tctatttcca 6300

ccaccctctt gcaaatccta tacaagccat ttttatctgg gaaagataag aatgagttga 6360

gagagctggc aaatctttct tcattgctaa gatcaggaga ggggtgggaa gacatacatg 6420

tgaaattctt caccaaggac atattattgt gtccagagga aatcagacat gcttgcaagt 6480

tcgggattgc taaggataat aataaagaca tgagctatcc cccttgggga agggaatcca 6540

gagggacaat tacaacaatc cctgtttatt atacgaccac cccttaccca aagatgctag 6600

agatgcctcc aagaatccaa aatcccctgc tgtccggaat caggttgggc caattaccaa 6660

ctggcgctca ttataaaatt cggagtatat tacatggaat gggaatccat tacagggact 6720

tcttgagttg tggagacggc tccggaggga tgactgctgc attactacga gaaaatgtgc 6780

atagcagagg aatattcaat agtctgttag aattatcagg gtcagtcatg cgaggcgcct 6840

ctcctgagcc ccccagtgcc ctagaaactt taggaggaga taaatcgaga tgtgtaaatg 6900

gtgaaacatg ttgggaatat ccatctgact tatgtgaccc aaggacttgg gactatttcc 6960

tccgactcaa agcaggcttg gggcttcaaa ttgatttaat tgtaatggat atggaagtgc 7020

gggattcttc tactagcctg aaaattgaga cgaatgttag aaattatgtg caccggattt 7080

tggatgagca aggagtttta atctacaaga cttatggaac atatatttgt gagagcgaaa 7140

agaatgcagt aacaatcctt ggtcccatgt tcaagacggt cgacttagtt caaacagaat 7200

ttagtagttc tcaaacgtct gaagtatata tggtatgtaa aggtttgaag aaattaatcg 7260

atgaacccaa tcccgattgg tcttccatca atgaatcctg gaaaaacctg tacgcattcc 7320

agtcatcaga acaggaattt gccagagcaa agaaggttag tacatacttt accttgacag 7380

gtattccctc ccaattcatt cctgatcctt ttgtaaacat tgagactatg ctacaaatat 7440

tcggagtacc cacgggtgtg tctcatgcgg ctgccttaaa atcatctgat agacctgcag 7500

atttattgac cattagcctt ttttatatgg cgattatatc gtattataac atcaatcata 7560

tcagagtagg accgatacct ccgaaccccc catcagatgg aattgcacaa aatgtgggga 7620

tcgctataac tggtataagc ttttggctga gtttgatgga gaaagacatt ccactatatc 7680

aacagtgttt agcagttatc cagcaatcat tcccgattag gtgggaggct gtttcagtaa 7740

aaggaggata caagcagaag tggagtacta gaggtgatgg gctcccaaaa gatacccgaa 7800

tttcagactc cttggcccca atcgggaact ggatcagatc tctggaattg gtccgaaacc 7860

aagttcgtct aaatccattc aatgagatct tgttcaatca gctatgtcgt acagtggata 7920

atcatttgaa atggtcaaat ttgcgaagaa acacaggaat gattgaatgg atcaatagac 7980

gaatttcaaa agaagaccgg tctatactga tgttgaagag tgacctacac gaggaaaact 8040

cttggagaga ttaactcgag gaattcactc ctcaggtgca ggctgcctat cagaaggtgg 8100

tggctggtgt ggccaatgcc ctggctcaca aataccactg agatcttttt ccctctgcca 8160

aaaattatgg ggacatcatg aagccccttg agcatctgac ttctggctaa taaaggaaat 8220

ttattttcat tgcaatagtg tgttggaatt ttttgtgtct ctcactcgga aggacatatg 8280

ggagggcaaa tcatttaaaa catcagaatg agtatttggt ttagagtttg gcaacatatg 8340

ccatatgctg gctgccatga acaaaggtgg ctataaagag gtcatcagta tatgaaacag 8400

ccccctgctg tccattcctt attccataga aaagccttga cttgaggtta gatttttttt 8460

atattttgtt ttgtgttatt tttttcttta acatccctaa aattttcctt acatgtttta 8520

ctagccagat ttttcctcct ctcctgacta ctcccagtca tagctgtccc tcttctctta 8580

tgaagatccc tcgacctgca gcccaagctt ggcgtaatca tggtcatagc tgtttcctgt 8640

gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa 8700

agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc 8760

tttccagtcg ggaaacctgt cgtgccagcg gatccgcatc tcaattagtc agcaaccata 8820

gtcccgcccc taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg 8880

ccccatggct gactaatttt ttttatttat gcagaggccg aggccgcctc ggcctctgag 8940

ctattccaga agtagtgagg aggctttttt ggaggcctag gcttttgcaa aaagctaact 9000

tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata 9060

aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc 9120

atgtctggat ccgctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 9180

tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 9240

agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 9300

aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt 9360

gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 9420

tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 9480

cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 9540

ttcgggaagc gtggcgcttt ctcaatgctc acgctgtagg tatctcagtt cggtgtaggt 9600

cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 9660

atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 9720

agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 9780

gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa 9840

gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 9900

tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga 9960

agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg 10020

gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg 10080

aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt 10140

aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact 10200

ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat 10260

gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg 10320

aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg 10380

ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat 10440

tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc 10500

ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt 10560

cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc 10620

agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga 10680

gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc 10740

gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa 10800

acgttcttcg gggcgaaaac tctcaaggat cttacgctgt tgagatccag ttcgatgtaa 10860

cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga 10920

gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga 10980

atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg 11040

agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt 11100

ccccgaaaag tgccacctg 11119

<210>9

<211>5587

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gtcgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 60

gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 120

ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 180

ggactttcca ttgacgtcaa tgggtggact atttacggta aactgcccac ttggcagtac 240

atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 300

cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 360

tattagtcat cgctattacc atgggtcgag gtgagcccca cgttctgctt cactctcccc 420

atctcccccc cctccccacc cccaattttg tatttattta ttttttaatt attttgtgca 480

gcgatggggg cggggggggg gggggcgcgc gccaggcggg gcggggcggg gcgaggggcg 540

gggcggggcg aggcggagag gtgcggcggc agccaatcag agcggcgcgc tccgaaagtt 600

tccttttatg gcgaggcggc ggcggcggcg gccctataaa aagcgaagcg cgcggcgggc 660

gggagtcgct gcgttgcctt cgccccgtgc cccgctccgc gccgcctcgc gccgcccgcc 720

ccggctctga ctgaccgcgt tactcccaca ggtgagcggg cgggacggcc cttctcctcc 780

gggctgtaat tagcgcttgg tttaatgacg gctcgtttct tttctgtggc tgcgtgaaag 840

ccttaaaggg ctccgggagg gccctttgtg cgggggggag cggctcgggg ggtgcgtgcg 900

tgtgtgtgtg cgtggggagc gccgcgtgcg gcccgcgctg cccggcggct gtgagcgctg 960

cgggcgcggc gcggggcttt gtgcgctccg cgtgtgcgcg aggggagcgc ggccgggggc 1020

ggtgccccgc ggtgcggggg ggctgcgagg ggaacaaagg ctgcgtgcgg ggtgtgtgcg 1080

tgggggggtg agcagggggt gtgggcgcgg cggtcgggct gtaacccccc cctgcacccc 1140

cctccccgag ttgctgagca cggcccggct tcgggtgcgg ggctccgtgc ggggcgtggc 1200

gcggggctcg ccgtgccggg cggggggtgg cggcaggtgg gggtgccggg cggggcgggg 1260

ccgcctcggg ccggggaggg ctcgggggag gggcgcggcg gccccggagc gccggcggct 1320

gtcgaggcgc ggcgagccgc agccattgcc ttttatggta atcgtgcgag agggcgcagg 1380

gacttccttt gtcccaaatc tggcggagcc gaaatctggg aggcgccgcc gcaccccctc 1440

tagcgggcgc gggcgaagcg gtgcggcgcc ggcaggaagg aaatgggcgg ggagggcctt 1500

cgtgcgtcgc cgcgccgccg tccccttctc catctccagc ctcggggctg ccgcaggggg 1560

acggctgcct tcggggggga cggggcaggg cggggttcgg cttctggcgt gtgaccggcg 1620

gctctagagc ctctgctaac catgttcatg ccttcttctt tttcctacag ctcctgggca 1680

acgtgctggt tgttgtgctg tctcatcatt ttggcaaaga attcatggat aatctcacaa 1740

aagttcgtga gtatctcaag tcctattctc gtctggatca ggcggtagga gagatagatg 1800

agatcgaagc acaacgagct gaaaagtcca attatgagtt gttccaagag gatggagtgg 1860

aagagcatac taagccctct tattttcagg cagcagatga ttctgacaca gaatctgaac 1920

cagaaattga agacaatcaa ggcttgtatg caccagatcc agaagctgag caagttgaag 1980

gctttataca ggggccttta gatgactatg cagatgagga agtggatgtt gtatttactt 2040

cggactggaa acagcctgag cttgaatctg acgagcatgg aaagacctta cggttgacat 2100

cgccagaggg tttaagtgga gagcagaaat cccagtggct ttcgacgatt aaagcagtcg 2160

tgcaaagtgc caaatactgg aatctggcag agtgcacatt tgaagcatcg ggagaagggg 2220

tcattatgaa ggagcgccag ataactccgg atgtatataa ggtcactcca gtgatgaaca 2280

cacatccgtc ccaatcagaa gcagtatcag atgtttggtc tctctcaaag acatccatga 2340

ctttccaacc caagaaagca agtcttcagc ctctcaccat atccttggat gaattgttct 2400

catctagagg agagttcatc tctgtcggag gtgacggacg aatgtctcat aaagaggcca 2460

tcctgctcgg cctgagatac aaaaagttgt acaatcaggc gagagtcaaa tattctctgt 2520

agctcgagga attcactcct caggtgcagg ctgcctatca gaaggtggtg gctggtgtgg 2580

ccaatgccct ggctcacaaa taccactgag atctttttcc ctctgccaaa aattatgggg 2640

acatcatgaa gccccttgag catctgactt ctggctaata aaggaaattt attttcattg 2700

caatagtgtg ttggaatttt ttgtgtctct cactcggaag gacatatggg agggcaaatc 2760

atttaaaaca tcagaatgag tatttggttt agagtttggc aacatatgcc atatgctggc 2820

tgccatgaac aaaggtggct ataaagaggt catcagtata tgaaacagcc ccctgctgtc 2880

cattccttat tccatagaaa agccttgact tgaggttaga ttttttttat attttgtttt 2940

gtgttatttt tttctttaac atccctaaaa ttttccttac atgttttact agccagattt 3000

ttcctcctct cctgactact cccagtcata gctgtccctc ttctcttatg aagatccctc 3060

gacctgcagc ccaagcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta 3120

tccgctcaca attccacaca acatacgagc cggaagcata aagtgtaaag cctggggtgc 3180

ctaatgagtg agctaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg 3240

aaacctgtcg tgccagcgga tccgcatctc aattagtcag caaccatagt cccgccccta 3300

actccgccca tcccgcccct aactccgccc agttccgccc attctccgcc ccatggctga 3360

ctaatttttt ttatttatgc agaggccgag gccgcctcgg cctctgagct attccagaag 3420

tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa agctaacttg tttattgcag 3480

cttataatgg ttacaaataa agcaatagca tcacaaattt cacaaataaa gcattttttt 3540

cactgcattc tagttgtggt ttgtccaaac tcatcaatgt atcttatcat gtctggatcc 3600

gctgcattaa tgaatcggcc aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc 3660

cgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc 3720

tcactcaaag gcggtaatac ggttatccac agaatcaggg gataacgcag gaaagaacat 3780

gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt 3840

ccataggctc cgcccccctg acgagcatca caaaaatcga cgctcaagtc agaggtggcg 3900

aaacccgaca ggactataaa gataccaggc gtttccccct ggaagctccc tcgtgcgctc 3960

tcctgttccg accctgccgc ttaccggata cctgtccgcc tttctccctt cgggaagcgt 4020

ggcgctttct caatgctcac gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa 4080

gctgggctgt gtgcacgaac cccccgttca gcccgaccgc tgcgccttat ccggtaacta 4140

tcgtcttgag tccaacccgg taagacacga cttatcgcca ctggcagcag ccactggtaa 4200

caggattagc agagcgaggt atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa 4260

ctacggctac actagaagga cagtatttgg tatctgcgct ctgctgaagc cagttacctt 4320

cggaaaaaga gttggtagct cttgatccgg caaacaaacc accgctggta gcggtggttt 4380

ttttgtttgc aagcagcaga ttacgcgcag aaaaaaagga tctcaagaag atcctttgat 4440

cttttctacg gggtctgacg ctcagtggaa cgaaaactca cgttaaggga ttttggtcat 4500

gagattatca aaaaggatct tcacctagat ccttttaaat taaaaatgaa gttttaaatc 4560

aatctaaagt atatatgagt aaacttggtc tgacagttac caatgcttaa tcagtgaggc 4620

acctatctca gcgatctgtc tatttcgttc atccatagtt gcctgactcc ccgtcgtgta 4680

gataactacg atacgggagg gcttaccatc tggccccagt gctgcaatga taccgcgaga 4740

cccacgctca ccggctccag atttatcagc aataaaccag ccagccggaa gggccgagcg 4800

cagaagtggtcctgcaactt tatccgcctc catccagtct attaattgtt gccgggaagc 4860

tagagtaagt agttcgccag ttaatagttt gcgcaacgtt gttgccattg ctacaggcat 4920

cgtggtgtca cgctcgtcgt ttggtatggc ttcattcagc tccggttccc aacgatcaag 4980

gcgagttaca tgatccccca tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat 5040

cgttgtcaga agtaagttgg ccgcagtgtt atcactcatg gttatggcag cactgcataa 5100

ttctcttact gtcatgccat ccgtaagatg cttttctgtg actggtgagt actcaaccaa 5160

gtcattctga gaatagtgta tgcggcgacc gagttgctct tgcccggcgt caatacggga 5220

taataccgcg ccacatagca gaactttaaa agtgctcatc attggaaaac gttcttcggg 5280

gcgaaaactc tcaaggatct tacgctgttg agatccagtt cgatgtaacc cactcgtgca 5340

cccaactgat cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga 5400

aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc 5460

ttcctttttc aatattattg aagcatttat cagggttatt gtctcatgag cggatacata 5520

tttgaatgta tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg 5580

ccacctg 5587

<210>10

<211>1407

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60

gaggtgcagc tggtggaatc aggaggagga ctggtgcagc caggaggatc tctgagactg 120

tcttgcgccg ccagcggctt tacattcagc gactcttgga tccattgggt gcgccaggct 180

ccaggaaaag gactggagtg ggtggcttgg atcagccctt acggcggcag cacctactac 240

gccgatagcg tgaagggcag gttcaccatc agcgccgata ccagcaagaa caccgcctac 300

ctgcagatga acagcctgag ggccgaggat accgccgtgt actattgcgc caggaggcat 360

tggccaggcg gatttgacta ttggggccag ggaacactgg tgacagtgtc agccgccagc 420

accaagggac ctagcgtgtt tcctctggcc cctagcagca agtctacaag cggcggcaca 480

gccgctctgg gttgtctggt gaaggactac ttccccgagc cagtgaccgt gtcttggaac 540

agcggagctc tgacaagcgg agtgcacaca tttccagccg tgctgcagag ctcaggactg 600

tacagcctgt ccagcgtggt gacagtgcct tctagcagcc tgggcaccca gacctacatc 660

tgcaacgtga accacaagcc cagcaacacc aaggtggaca agcgggtgga gcccaagtct 720

tgcgacaaga cccacacttg ccccccttgt ccagctccag aactgctggg aggaccatca 780

gtgttcctgt tcccccctaa gcccaaggac accctgatga tcagccggac cccagaagtg 840

acttgcgtgg tggtggacgt gtctcacgag gaccccgagg tcaagttcaa ttggtacgtg 900

gacggagtgg aggtgcacaa cgctaagacc aagcccaggg aggagcagta caacagcacc 960

tacagggtgg tgtccgtgct gacagtgctg caccaggatt ggctgaacgg caaggagtac 1020

aagtgcaagg tgtccaacaa ggccctgcca gctcccatcg agaagaccat cagcaaggcc 1080

aagggccagc ctagagagcc tcaggtgtac acactgcccc ctagcagaga ggagatgacc 1140

aagaaccagg tgtccctgac ttgcctcgtg aagggcttct accccagcga tatcgccgtc 1200

gagtgggaat ctaacggcca gcccgagaac aactacaaga ccaccccccc cgtgctggat 1260

agcgacggca gcttcttcct gtacagcaag ctgaccgtgg acaaaagtcg ctggcagcag 1320

ggcaacgtgt tctcttgcag cgtgatgcac gaggccctgc acaaccacta cacccagaag 1380

agcctgagcc tgagcccagg aaagtag 1407

<210>11

<211>705

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

atggagacag acacactcct gctatgggta ctgctgctct gggttccagg ttccactggt 60

gacatccaga tgacccagag ccctagcagc ctgagcgcca gcgtgggaga tagagtgacc 120

atcacctgca gggcctctca ggacgtgtct acagccgtgg cttggtacca gcagaagcca 180

ggaaaggccc ccaagctgct gatctacagc gcctctttcc tgtacagcgg cgtgccttct 240

agattcagcg gcagcggaag cggcaccgat ttcaccctga ccatcagcag cctgcagcca 300

gaggacttcg ccacctacta ctgccagcag tacctgtacc acccagccac attcggccag 360

ggcaccaagg tggagatcaa gaggaccgtg gccgccccta gcgtgtttat cttccctcct 420

agcgacgagc agctgaaaag cggaacagcc agcgtcgtct gcctgctgaa caacttctac 480

cccagggagg ccaaagtcca gtggaaagtg gacaacgccc tgcagagcgg caattctcag 540

gagagcgtga ccgagcagga tagcaaggac agcacctaca gcctgagcag cacactgacc 600

ctgagcaagg ccgactacga gaagcacaag gtgtacgctt gcgaggtcac acaccaggga 660

ctgagcagcc ccgtgaccaa gagcttcaac cgcggcgagt gttag 705

<210>12

<211>861

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

atgtaccgca tgcagctgct gtcttgcatc gccctgtctc tggctctggt gaccaatagc 60

cggatcaccc tgaaggagag cggacctcct ctggtgaaac ctacccagac cctgaccctg 120

acttgcacct tcagcggctt ctctatgagc gatccagagg ccggagtggc ttggatcaga 180

cagccaccag gcaaggcact cgagtggctg gctatcatct acgccgacgg aagcgccgcc 240

tattctcctt ctctgaacac ccggctgacc atcaccaagg acaccagcaa gaaccaggtg 300

gtgctggtca tgaccagagt gtccccagtg gataccgcca cctacttttg cgcccacaga 360

ccaggcagct tcaggctgaa caacgtgtcc ctggacagca gcgtgtcagc aggatttgcc 420

gtgtggggtc caggaatcac cgtgaccatc tctagcggag gaggaggaag cggaggagga 480

ggatctggag gaggaggaag cggaggagga ggagcatctg ccctgcagct gacacagtct 540

ccttctagcc tgagcgctag cgtgggcgat agaatcacca tcacttgcgt cgccgacaag 600

aaggtcggct actacatggc ttggtaccgg cagaagccag gatctcctcc tcagctgctg 660

gtgtacggaa gcgatcagct gtacgagggc gtgcctagca gattcagcgg cagcggaagc 720

ggaaccgagt tcaccctgac catcagcacc ctgagacccg aggacttcgc cacctactat 780

tgcgcagccc tgcacgccct gccttatgtg tttggaccag gcaccagagt ggacgtcaga 840

catcatcatc atcatcatta a 861

<210>13

<211>14

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>13

Met Leu Leu Thr Leu Ile Ile Leu Leu Pro Val Val Ser Lys

1 5 10

<210>14

<211>17

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>14

Met Trp Leu Gln Ser Leu Leu Leu Leu Gly Thr Val Ala Cys Ser Ile

1 5 10 15

Ser

<210>15

<211>20

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>15

Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser

20

<210>16

<211>20

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>16

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

15 10 15

Gly Ser Thr Gly

20

Claims

1. A method for producing an attenuated viral vector, comprising the steps of:

optionally, the first vector comprises a sequence shown as SEQ ID NO. 2;

2. An attenuated virus vector obtained by the production method according to claim 1.

3. The attenuated viral vector of claim 2, wherein the sequence encoding the attenuated viral vector comprises an amino acid sequence set forth in SEQ ID NO:3, and (b) is the sequence shown in the specification.

4. The attenuated viral vector of claim 3, wherein the sequence encoding the attenuated viral vector comprises the sequence set forth in SEQ ID NO:4, or a sequence shown in the figure.

5. A cloning scaffold vector system, wherein the cloning scaffold vector system recombines the sequence as shown in SEQ ID No. 5 into the vector of claim 3; wherein, the insertion site of the sequence shown in SEQ ID NO. 5 into the vector as shown in claim 3 is shown in SEQ ID NO:4, position 4632 of the sequence shown in fig. 4.

6. The cloning scaffold vector system according to claim 5, wherein the sequence encoding the cloning scaffold vector system comprises the sequence shown in SEQ ID NO 6.

7. A method of producing an attenuated monoclonal virus strain comprising the steps of:

(S1) culturing the first cell to be transfected;

8. The method according to claim 7, wherein the weight ratio of the plasmid comprising the sequence shown as SEQ ID NO. 3, the plasmid (pN) comprising the sequence shown as SEQ ID NO. 7, the plasmid (pL) comprising the sequence shown as SEQ ID NO. 8 and the plasmid (pP) comprising the sequence shown as SEQ ID NO. 9 is 10:4:1: 5.

9. The method according to any one of claims 7 to 8, wherein the plasmid comprising the sequence shown as SEQ ID NO. 3 is a plasmid comprising the sequence shown as SEQ ID NO. 4; optionally, the second cell to be transfected is selected from Vero cells; the first cells to be transfected are selected from BSR-T7 cells.

10. The method according to claim 9, wherein the plasmid comprising the sequence shown as SEQ ID NO. 4 in step (S2) is selected from the group consisting of plasmids comprising the sequence shown as SEQ ID NO. 6.

11. The method according to claim 10, wherein the coding sequence of the plasmid comprising the sequence shown as SEQ ID NO. 6 in step (S2) further comprises the sequence shown as SEQ ID NO. 10 and the sequence shown as SEQ ID NO. 11.

12. The method according to claim 10, wherein the coding sequence of the plasmid comprising the sequence shown as SEQ ID NO. 6 in step (S2) further comprises the sequence shown as SEQ ID NO. 12.

13. The method of claim 12, wherein the 5' end comprising the sequence set forth in SEQ ID NO 12 further comprises a signal peptide sequence; the sequence of the signal peptide is selected from the sequences shown as SEQ ID NO. 13, SEQ ID NO. 14, SEQ ID NO. 15 or SEQ ID NO. 16; preferably, the signal peptide sequence is selected from the group consisting of the sequences shown in SEQ ID NO. 15.

14. An attenuated monoclonal virus strain produced by the method of producing an attenuated monoclonal virus strain according to any one of claims 7 to 13.

15. A monoclonal antibody secreted by the attenuated monoclonal virus strain of claim 14.

16. A monoclonal antibody comprising a fragment encoded by the sequence shown as SEQ ID NO. 4, the sequence shown as SEQ ID NO. 10 and the coding sequence shown as SEQ ID NO. 11.

17. The monoclonal antibody according to claim 16, wherein the sequence comprising SEQ ID NO. 4 is selected from the group consisting of the sequences comprising SEQ ID NO. 6.

18. The monoclonal antibody of claim 17, wherein the coding sequence further comprises a sequence as set forth in SEQ ID No. 13, SEQ ID No. 14, SEQ ID No. 15 or SEQ ID No. 16; preferably, the coding sequence further comprises the sequence shown in SEQ ID NO. 15.

19. A pharmaceutical composition comprising the monoclonal antibody of any one of claims 15-18.

20. Use of the monoclonal antibody of any one of claims 15-18 or the pharmaceutical composition of claim 19 in the preparation of a medicament for killing hyperproliferative cells, inducing promotion of an anti-tumor immune response, or eliminating microenvironment immunosuppression of tumor tissue.

21. The use of claim 20, wherein the hyperproliferative cell is contained in a patient.

22. The use of claim 21, wherein the hyperproliferative cell is selected from the group consisting of a tumor cell or a tumor tissue-associated cell; preferably, the tumor cell is a cancer cell; more preferably, the cancer cell is a metastatic cancer cell.

23. A method of slow and sustained killing of a hyperproliferative cell comprising the step of contacting said hyperproliferative cell with the monoclonal antibody of any one of claims 15-18 or the pharmaceutical composition of claim 19.

24. The method of claim 23, wherein the hyperproliferative cell is contained in a patient.

25. The method of claim 23, wherein the hyperproliferative cell is selected from the group consisting of a tumor cell or a tumor tissue-associated cell; preferably, the tumor cell is a cancer cell; more preferably, the cancer cell is a metastatic cancer cell.

26. The method of claim 23, wherein the monoclonal antibody of any one of claims 15-18 or the pharmaceutical composition of claim 19 is administered to a patient.

27. The method of claim 23, wherein the monoclonal antibody of any one of claims 15-18 or the pharmaceutical composition of claim 19 is administered by a mode of administration comprising one or more of intraperitoneal, intravenous, intraarterial, intramuscular, intradermal, intratumoral, subcutaneous, or intranasal administration; preferably, the administration route of the administration mode comprises one or more of endoscopy, intervention, minimally invasive surgery and traditional surgery.

28. The method of claim 23, further comprising the step of ー administering a second anti-tumor therapy.

29. The method of claim 28, wherein the second anti-tumor therapy is selected from one or more of chemotherapy, radiation therapy, immunotherapy, surgical therapy.

30. A polynucleotide comprising the sequence shown in SEQ ID NO. 6.