CN110819654B - Method for improving resistant starch content of wheat through genome editing and technical system thereof - Google Patents

Abstract

The invention discloses a method for improving the resistant starch content of wheat by genome editing and a technical system thereof. The invention provides a method for improving resistant starch content and/or amylose content and/or total pentosan content in wheat seeds by a gene editing technology, which comprises the following steps: reducing the abundance of SBEIIa protein in wheat. The "reduction of the abundance of the SBEIIa protein in wheat" can be specifically realized by gene editing of the SBEIIa gene. The invention utilizes CRISPR/Cas9 technology to edit wheat SBEIIa gene at fixed point, knocks out the wheat SBEIIa gene by causing frameshift mutation, and obtains a new generation of wheat new germplasm with obviously improved amylose, resistant starch and total pentosan (healthy fiber) content. The invention has great application and popularization value for wheat breeding.

Description

Method for improving resistant starch content of wheat through genome editing and technical system thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a method for improving the content of resistant starch in wheat by genome editing and a technical system thereof.

Background

Diabetes, obesity and colon cancer are chronic non-infectious diseases that seriously harm human health. Diabetes Mellitus (DM) is a disease caused by partial or complete insulin loss, or decreased cellular insulin receptors, or decreased receptor sensitivity, and is a chronic, systemic metabolic disease caused by the combined action of genetic and environmental factors. Diabetes and its complications have become a worldwide public health problem seriously harming human health, and have attracted high attention from countries in the world. According to 2004 reports of the national institute of statistics, the number of people suffering from diabetes in China is over 2000 ten thousand. According to the prediction of the world health organization, the number of diabetic patients in China is doubled by 2030, and the number of diabetic patients reaches 4230 ten thousand. Diabetes has been classified as a3 rd chronic non-infectious disease threatening human health following cardiovascular disease, a tumor. Abnormal metabolism of blood sugar caused by diabetes often causes metabolic disorder of blood fat, and hyperlipidemia occurs. These two factors can cause the increase of blood viscosity and slow blood flow, and are easy to form thrombus and arteriosclerosis, thus causing vascular diseases and causing a plurality of serious chronic complications. Epidemiological evidence strongly suggests a correlation between blood glucose levels, atherogenesis, occurrence of cardiovascular events, and increased morbidity and mortality.

Resistant starch (also known as resistant starch and indigestible starch) is mainly present in high amylose, low amylopectin kernels or tubers, and its content is directly and positively correlated with the high amylose content. Research shows that the resistant starch cannot be digested and absorbed in the small intestine and provide glucose, and can directly enter the large intestine of a human body and be fermented by physiological bacteria to generate a plurality of short-chain fatty acids (butyric acid and the like) and gases. In addition, the resistant starch has the functions of stimulating the growth of beneficial flora, reducing human body caloric intake, controlling body weight and the like. In the research of mice and human beings, the resistant starch can prevent colorectal cancer and improve the content of short-chain fatty acid in the large intestine. High amylose starch (resistant starch) helps prevent the development of irreversible insulin resistance and reduces the concentration of plasma total lipid, cholesterol and triglycerides. Mantis et al have shown that resistant starch can promote lipid oxidation after meal, and reduce fat accumulation after long-term consumption, and help to control body weight. The high-resistance starch food is ingested by a human body, has less insulin response, can delay the rise of blood sugar after meal, and effectively controls the state of diabetes. The relevance of the blood sugar and blood fat level of the type II diabetic rat and the resistant starch is researched by the tylophora fimbriata and the like, and the resistant starch can reduce the blood sugar and blood fat level and urea nitrogen of the type II diabetic rat, so that the resistant starch is prompted to have the effect of relieving the symptoms of diabetes and possibly protecting the kidney function. The metabolism of resistant starch and the regulation effect on blood sugar researched by king bamboo and the like prove that the resistant starch has the metabolic characteristic of slow absorption, has certain effects on regulating the blood sugar steady state, reducing postprandial insulin secretion and enhancing insulin sensitivity, preliminarily discusses the influence of the resistant starch on glucose transport in a postprandial body, synthesizes other research results, predicts that the resistant starch is possibly beneficial to preventing chronic diseases and reducing postprandial tissue load. In 1992, the world Food and Agriculture Organization (FAO) defined resistant starch as: starch and its degradation products, which are not absorbed in the small intestine of healthy people. In addition, the resistant starch has processing characteristics such as low water holding capacity, and can be used for improving the processing technology of food, increasing the crispness and the expansibility of the food and improving the texture of the final product. Therefore, the functional dietary fiber can be used as a functional component of dietary fiber of food, and can be added into food in a proper amount to prepare flavor food and functional food with different characteristics. At present, resistant starch is applied to flour foods, such as bread, steamed stuffed bun, macaroni, biscuits and the like, as a food raw ingredient or a dietary fiber enhancer abroad. Among them, the use of resistant starch in bread is worth mentioning. The bread added with the resistant starch not only strengthens the dietary fiber components, but also is better than the nutrition-strengthened bread added with other traditional dietary fibers in the aspects of the sensory quality such as pore structure, uniformity, volume, color and the like. The addition of the resistant starch into macaroni and noodles can increase the boiling resistance, facilitate the maintenance of a tough structure and avoid the adhesion phenomenon after boiling. Therefore, the cultivation of the high-resistance starch wheat has important significance for human health and rich dietary diversity.

Common wheat (Triticum aestivum l., AABBDD,2n ═ 6x ═ 42) is an important food crop, and wheat is taken as a staple food in over 40% of the population worldwide. It is the main source of protein intake for human, and is rich in vitamin B, vitamin E, fiber, magnesium, phosphorus, etc. Starch is the main component of wheat grains and accounts for more than 80% of the weight of wheat endosperm. Starch is a granule having crystalline and amorphous regions formed by the arrangement and stacking of amylose (amylose) and amylopectin (amylopectin), wherein amylose accounts for 15% -25% of endosperm starch, and amylopectin accounts for 75% -85%. Wheat starch can be classified into type A, type B and type C starches according to the form and size. Wherein, the A-type starch is generally round and has a particle diameter of 10-35 μm, the B-type starch is generally spherical or polygonal and has a particle diameter of 3-10 μm, and the C-type starch particle is generally smaller than 3 μm. The starch synthesis process is regulated by a series of enzymes.

Disclosure of Invention

The invention aims to provide a method for improving the resistant starch content of wheat by genome editing and a technical system thereof.

The invention provides a method for improving resistant starch content and/or amylose content and/or total pentosan content in wheat seeds, which comprises the following steps: reducing the abundance of SBEIIa protein in wheat.

The "reduction of the abundance of the SBEIIa protein in wheat" can be specifically achieved by inhibiting the expression of the SBEIIa gene. The "reduction of the abundance of the SBEIIa protein in wheat" can be specifically realized by knocking out the SBEIIa gene. The knockout includes the knockout of the entire gene, as well as the knockout of a partial segment of the gene.

The "reducing the abundance of the SBEIIa protein in wheat" can be specifically achieved by silencing the SBEIIa gene.

The "reduction of the abundance of the SBEIIa protein in wheat" can be specifically realized by gene editing of the SBEIIa gene.

The invention provides a method for improving resistant starch content and/or amylose content and/or total pentosan content in wheat seeds, which comprises the following steps: and (4) carrying out gene editing on the SBEIIa gene.

Any of the above gene editing is realized by means of a CRISPR/Cas9 system.

In the CRISPR/Cas9 system, the target sequence of sgRNA (sgRNA1) is as follows: tcctgagccgcgcggcctct are provided.

In the CRISPR/Cas9 system, the target sequence of sgRNA (sgRNA2) is as follows: gggaaggtcctggtgcctga are provided.

The gene editing is realized by introducing a specific DNA molecule containing a coding gene of Cas9 protein and a coding gene of sgRNA1 into recipient wheat. The gene editing is realized by introducing a recombinant plasmid containing the specific DNA molecule into receptor wheat.

The gene editing is realized by introducing a DNA molecule containing a coding gene of Cas9 protein and a DNA molecule containing a coding gene of sgRNA1 into recipient wheat respectively.

The gene editing is realized by introducing a specific DNA molecule containing a coding gene of Cas9 protein and a coding gene of sgRNA2 into recipient wheat. The gene editing is realized by introducing a recombinant plasmid containing the specific DNA molecule into receptor wheat.

The gene editing is realized by introducing a DNA molecule containing a coding gene of Cas9 protein and a DNA molecule containing a coding gene of sgRNA2 into recipient wheat respectively.

The invention also protects specific sgrnas. The specific sgRNA is sgRNA1 or sgRNA 2.

The invention also protects the specific recombinant plasmid. The specific recombinant plasmid is pCXUN-Cas9-gRNA1 or pCXUN-Cas9-gRNA 2.

The target sequences of sgRNA1 are as follows: tcctgagccgcgcggcctct are provided.

The target sequences of sgRNA2 are as follows: gggaaggtcctggtgcctga are provided.

pCXUN-Cas9-gRNA1 contains the gene encoding the Cas9 protein and the gene encoding the sgRNA 1.

pCXUN-Cas9-gRNA2 contains the gene encoding the Cas9 protein and the gene encoding the sgRNA 2.

The encoding gene of the Cas9 protein can be specifically a DNA molecule which is reversely complementary with the 392-4522 th nucleotide in the sequence 1 of the sequence table.

The pCXUN-Cas9-gRNA1 can be specifically shown as a sequence 1 in a sequence table.

The difference between pCXUN-Cas9-gRNA2 compared to pCXUN-Cas9-gRNA1 is only that "AGAGGCCGCGCGGCTCAGGA" is replaced with "GGGAAGGTCCTGGTGCCTGA".

The invention also provides a method for preparing transgenic wheat, which comprises the following steps: and (3) introducing the coding gene of the specific sgRNA and the coding gene of the Cas9 protein into receptor wheat to obtain transgenic wheat of which the resistant starch content and/or the amylose content and/or the total pentosan content in seeds are higher than those of the receptor wheat. The encoding gene of the specific sgRNA and the encoding gene of the Cas9 protein are specifically introduced into receptor wheat through the recombinant plasmid.

The invention also provides a method for preparing gene-edited wheat, which comprises the following steps: introducing the coding gene of the specific sgRNA and the coding gene of the Cas9 protein into receptor wheat to obtain transgenic wheat, and identifying the wheat with gene editing and the gene editing type thereof (screening the wheat with gene editing and SBEIIa gene expression inhibited from the transgenic wheat); then, the transgenic gene is edited and wheat is selfed to obtain selfed progeny; then screening the selfed progeny for a gene-edited wheat without transgene, wherein the resistant starch content and/or amylose content and/or total pentosan content of the wheat seeds without transgene is higher than that of the receptor wheat. The encoding gene of the specific sgRNA and the encoding gene of the Cas9 protein are specifically introduced into receptor wheat through the recombinant plasmid.

The gene editing wheat is wheat which meets the following conditions: the A genome, the B genome and the D genome are all mutated in target regions and are all homozygous mutants.

The gene editing wheat is wheat which meets the following conditions: the A genome, the B genome and the D genome are all mutated in a target region and are all homozygous mutant types; no vector sequence was carried.

The gene-edited wheat may specifically be: t obtained in example 3₀Inbreeding generation plant B041-S103 to obtain T₁Generation plants from which T mutants based on the target sequence were selected of the type "homozygous mutant for a genome D13 and homozygous mutant for B genome D10 and homozygous mutant for D genome D41₁And (5) plant generation.

The gene-edited wheat may specifically be: t obtained in example 3₀Inbreeding generation plant B041-S103 to obtain T₁Generation plants from which T with the type of mutation based on the target sequence of "homozygous mutant for a genome D13 and homozygous mutant for B genome D10 and homozygous mutant for D genome D41 and not carrying a vector sequence" were selected₁And (5) plant generation.

And (3) selfing the gene editing wheat to obtain a progeny, namely the gene editing strain.

The invention also protects the application of the specific sgRNA or the specific recombinant plasmid in wheat breeding; the aim of the wheat breeding is to increase the resistant starch content and/or the amylose content and/or the total pentosan content in wheat seeds.

The invention also provides a method for improving the resistant starch content and/or the amylose content and/or the total pentosan content in wheat seeds, which comprises the following steps: inhibiting the activity of SBEIIa protein in wheat.

The SBEIIa protein is (a1), or (a2) or (a 3):

(a1) a protein consisting of an amino acid sequence shown in a sequence 2 or a sequence 4 or a sequence 6 in a sequence table;

(a2) a protein derived from the protein obtained by substituting and/or deleting and/or adding (a1) one or more amino acid residues and having the same function;

(a3) a protein derived from wheat, having 98% or more identity to (a1) and having the same function.

The SBEIIa gene is a nucleic acid molecule for coding the SBEIIa protein.

The SBEIIa gene is a DNA molecule of 1) or 2) or 3) or 4) or 5) or 6) or 7) or 8) as follows:

1) the coding region is a DNA molecule shown as a sequence 3 in a sequence table;

2) the coding region is a DNA molecule shown as a sequence 5 in a sequence table;

3) the coding region is a DNA molecule shown as a sequence 7 in a sequence table;

4) DNA molecule shown in sequence 3 in the sequence table;

5) DNA molecule shown in sequence 5 in the sequence table;

6) DNA molecule shown in sequence 7 in the sequence table;

7) a DNA molecule which hybridizes under stringent conditions with a DNA sequence as defined in any one of 1) to 6) and which encodes said SBEIIa protein;

8) a DNA molecule derived from wheat and having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% or more homology to a DNA sequence defined in any one of 1) to 6) and encoding said SBEIIa protein.

The encoding gene of the sgRNA1 is shown as the 6915-position 7017 nucleotide in the sequence 1 of the sequence table.

The encoding gene for sgRNA2 differed from the encoding gene for sgRNA1 only in that "AGAGGCCGCGCGGCTCAGGA" was replaced with "GGGAAGGTCCTGGTGCCTGA".

The receptor wheat can be Zheng wheat 7698.

The invention utilizes CRISPR/Cas9 technology to edit wheat SBEIIa gene at fixed point, knocks out the wheat SBEIIa gene by causing frameshift mutation, and obtains a new generation of wheat new germplasm with obviously improved amylose, resistant starch and total pentosan (healthy fiber) content. Compared with the wild type control, the obtained editing line with three genomes of the SBEIIa gene knocked out at fixed points has the advantages that the content of amylose, resistant starch and total pentosan in seeds is obviously increased, the content of amylopectin with the polymerization degree of DP 9-12 is reduced, and the content of long-chain starch with the polymerization degree of DP >13 is increased. RVA measurement results show that: the starch peak viscosity value and the final viscosity value are both obviously reduced. The invention has great application and popularization value for wheat breeding.

Drawings

FIG. 1 is the electrophoresis chart of 5 regenerated plants obtained in example 2 after enzyme digestion

FIG. 2 shows the results of sequencing 5 regenerated plants in example 2

FIG. 3 shows a part T in example 2₁The identification result of the step (4) is carried out on the generation plant

FIG. 4 is the electrophoresis chart of 2 regenerated plants obtained in example 3 after enzyme digestion

FIG. 5 shows the partial sequencing results of 2 regenerated plants in example 3

FIG. 6 shows a part T in example 3₁The identification result of the step (4) is carried out on the generation plant

FIG. 7 shows the results of the analysis of the properties of starch granules in example 4.

FIG. 8 shows the results of determination of amylose and resistant starch contents in example 4.

FIG. 9 shows the results of the starch RVA value determination in example 4.

FIG. 10 shows the results of analysis of the distribution of starch chain lengths in example 4.

FIG. 11 shows the results of the determination of the total pentosan content in example 4.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Zheng wheat 7698. Reference to the literature of "zheng mai 7698" (referred to in the literature as "Zhengmai 7698"): guo G, Lei M, Wang Y, Song B, Yang J, et al, accumulation of As, Cd, and Pb in pure white particles in associated resources and associated Health assessment [ J ]. Journal of Environmental Research and Public Health,2018,15(11):2601. Zheng Mai7698 is denoted by WT, the corresponding sequence in the A genome is denoted by WT-A, the corresponding sequence in the B genome is denoted by WT-B, and the corresponding sequence in the D genome is denoted by WT-D.

Example 1 preparation of recombinant plasmid

Artificially synthesizing a recombinant plasmid pCXUN-Cas9-gRNA1 and a recombinant plasmid pCXUN-Cas9-gRNA 2. The recombinant plasmid pCXUN-Cas9-gRNA1 and the recombinant plasmid pCXUN-Cas9-gRNA2 are both circular plasmids.

The recombinant plasmid pCXUN-Cas9-gRNA1 is shown as a sequence 1 in a sequence table. In the sequence 1 of the sequence table, the 115-position 367 nucleotide is reversely complementary with the NOS terminator, the 392-position 4522 nucleotide is reversely complementary with the coding gene of the Cas9 protein, the 4544-position 6533 nucleotide is reversely complementary with the Ubi promoter, the 6552-position 6914 nucleotide is a U6 promoter, and the 6915-position 7017 nucleotide is the coding gene of the sgRNA1 (wherein the 6915-position 6934 nucleotide is a target sequence recognition region). The recombinant plasmid pCXUN-Cas9-gRNA1 expresses sgRNA1, and the target sequence of the sgRNA1 is positioned in the second exon of the wheat SBEIIa gene.

The recombinant plasmid pCXUN-Cas9-gRNA2 differs from the recombinant plasmid pCXUN-Cas9-gRNA1 only in that "AGAGGCCGCGCGGCTCAGGA" is replaced with "GGGAAGGTCCTGGTGCCTGA". "GGGAAGGTCCTGGTGCCTGA" is the target sequence recognition region of sgRNA 2. The recombinant plasmid pCXUN-Cas9-gRNA2 expresses sgRNA2, and the target sequence of the sgRNA2 is positioned in the second exon of the wheat SBEIIa gene.

In wheat cDNA: the coding region of the SBEIIa gene in the genome A (corresponding to the genome A) is shown as a sequence 3 in a sequence table (protein shown as a sequence 2 in the coding sequence table), and the 146 th and 243 th nucleotides in the sequence 3 are second exons of the gene in the genome DNA; the coding region of the SBEIIa gene in the B genome (corresponding to the B chromosome group) is shown as a sequence 5 in a sequence table (protein shown as a sequence 4 in the coding sequence table), and the 143 rd and 243 rd nucleotides in the sequence 5 are second exons of the gene in the genome DNA; the coding region of the SBEIIa gene in the D genome (corresponding to the D chromosome group) is shown as a sequence 7 in the sequence table (coding a protein shown as a sequence 6 in the sequence table), and the 134-231 th nucleotide in the sequence 7 is a second exon of the gene in the genome DNA.

Example 2 Gene-edited wheat obtained by biolistic method Using sgRNA1

One, genetic gun mediated wheat genetic transformation

1. And taking the young embryo of Zhengmai7698 which is a wheat variety about 14 days after pollination as an explant. The explants were inoculated into induction medium (MS +1mg/L VB1+150mg/L ASP +2 mg/L2, 4-D) and cultured in the dark at 22-25 ℃ for 1-2 days.

2. The recombinant plasmid pCXUN-Cas9-gRNA1 is used as DNA to be transformed, a PDS-1000/He gene gun of BIO-RAD company is adopted to bombard the young embryo in the step 1 (Psi900, 27.5cm Hg column), the bombarded young embryo is transferred to a new induction culture medium, and dark culture is carried out for 2-3 weeks at the temperature of 22-25 ℃.

3. Taking the explant which is subjected to the step 2, and sequentially regenerating, screening and strengthening the seedling to obtain T₀Regenerating plants.

Second, detection of fixed point editing

1. For T₀Identification of generative plants

The test plants were: 102 strains T obtained in step one₀A regenerated plant, Zheng wheat 7698 (as a reference plant of the regenerated plant).

(1) Extracting the genome DNA of the leaves of the tested plants, and respectively adopting three specific primer pairs to carry out PCR amplification. The three specific primer pairs are respectively: a primer pair consisting of SBE-C2-AF1 and SBE-C2-AR1 (the target sequence of the primer pair in the wheat genome DNA is shown as sequence 8 in the sequence table, and the second exon of the SBEIIa gene in the wheat A genome is located therein), a primer pair consisting of SBE-C2-BF1 and SBE-C2-BR1 (the target sequence of the primer pair in the wheat genome DNA is shown as sequence 9 in the sequence table, and the second exon of the SBEIIa gene in the wheat B genome is located therein), and a primer pair consisting of SBE-C2-DF1 and SBE-C2-DR1 (the target sequence of the primer pair in the wheat genome DNA is shown as sequence 10 in the sequence table, and the second exon of the SBEIIa gene in the wheat D genome is located therein).

SBE-C2-AF1：CGCTCCAATCTCCCCGTCCA；SBE-C2-AR1：GAAGATTTCCCGGCACGATG；

SBE-C2-BF1：TCTCCCCGTCTGTTTTTGGG；SBE-C2-BR1：GTTGCGCTGGAGTGGCCGCC；

SBE-C2-DF1：CTCGAATCTCCCCCGTCTGGC；SBE-C2-DR1：CCTGACGCATCCGTGGTTG。

(2) After the step (1) is completed, recovering the PCR amplification product, performing single enzyme digestion by using restriction enzyme DdeI, and then performing electrophoresis.

(3) And (3) after the step (1) is completed, recovering PCR amplification products and sequencing.

If the PCR amplification product of the regenerated plant has only one kind and is identical to the nucleotide sequence of the PCR amplification product of Zheng Mai7698, the regenerated plant is wild type. If the PCR amplification products of the regenerated plant are two, one is identical to the nucleotide sequence of the PCR amplification product of Zheng Mai7698, and the other is mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the nucleotide sequence of the PCR amplification product of Zheng Mai7698, the regenerated plant is heterozygous. If the PCR amplification products of the regenerated plant are two, both of them are mutated (mutation including deletion, insertion or substitution of one or more nucleotides) compared with the nucleotide sequence of the PCR amplification product of Zheng Mai7698, the regenerated plant is biallelic mutant. If the PCR amplification product of the regenerated plant is one and mutation (mutation including deletion, insertion or substitution of one or more nucleotides) occurs compared to the nucleotide sequence of the PCR amplification product of Zheng Mai7698, the regenerated plant is a homozygous mutant. The electrophoresis of the enzyme digestion product of the wild type regeneration plant shows two bands, the electrophoresis of the enzyme digestion product of the heterozygous type regeneration plant shows three bands, and the electrophoresis of the regeneration plant of the biallelic mutant type and the regeneration plant of the homozygous mutant type show one band. If the PCR amplification products of the regeneration plant are more than three, the regeneration plant is chimeric. Plants of heterozygous, biallelic, homozygous, and chimeric types are collectively referred to as edited plants.

Of the 102 regenerated plants, 5 were editing plants (4.9%) and 97 were wild-type (94.1%).

The electrophoresis chart of 5 regenerated plants after enzyme digestion is shown in figure 1. In fig. 1: m: DL2000 Marker; 1 represents T₀The generation plants B017-1 and 2 represent T017-1₀The generation plants B13-C14 and 3 represent T₀The generation plant B62-16, 4 represent T₀The generation plants B86-E8 and 5 represent T₀Generation plant B49-S70; wild type represents Zheng Mai7698, + represents enzyme digestion product, -represents PCR amplification product.

The results of sequencing 5 regenerated plants are shown in FIG. 2. In fig. 2: CCG is a PAM site, underlined sequence is a target sequence, and "-" indicates base deletion.

(4) Extracting genome DNA of leaves of a test plant, identifying a Cas9 gene by adopting a primer pair consisting of Cas9-F and Cas9-R, and identifying an sgRNA gene by adopting a primer pair consisting of TaU6F and gRNAR; and identifying the hptII gene by adopting a primer pair consisting of HptF and HptR.

Cas9-F：5’-TCGACAAGAAGTACTCCATCGGC-3’；Cas9-R：5’-CAAGAGAGAGGGCGATCAGGTTG-3’。

TaU6F：5’-GCACTGCAGGAATTCGATATCAAGC-3’；gRNAR：5’-CCAATACGCAAACCGCCTCTC-3’。

HptF：5’-GAGGGCGTGGATATGTCCTG-3’；HptR：5’-ATTGACCGATTCCTTGCGGT-3’。

The genotype of 5 regenerated plants based on the target sequence ABD genome, the mutation type based on the target sequence, the case of carrying the Cas9 gene, the case of carrying the sgRNA1 gene and the case of carrying the hptII gene are shown in Table 1.

TABLE 1

Note: i represents an insertion, i1 represents an insertion of 1 nucleotide, and so on; d represents deletion, d1 represents deletion of 1 nucleotide, and so on; wt represents wild type; before and after "/" represent two chromosomes, respectively; for example, d15/d42 represents d15 for one chromosome and d42 for the target sequence in the A genome. For example, d5i3 represents d5i3 for the target sequence in the B genome for both chromosomes. Y represents that the identification result is positive, and N represents that the identification result is negative.

2. For T₁Identification of the plant

Get T₀Generation plant B017-1, T₀Generation plants B13-C14 and T₀Generation plant B62-16, T₀Generation plants B86-E8 and T₀Generation plants B49-S70, selfing and harvesting T₁Seed generation and T cultivation₁Seed generation to obtain T₁And (5) plant generation.

According to the method of step 1, for each T₁And identifying the generation plants.

Part T₁The identification result of the generation plant in the step (4) is shown in figure 3(Actin is an internal reference gene). In FIG. 3, WT represents Zheng Mai7698, and 1-23 represent different T₁And (5) plant generation.

The results of the various identifications are shown in Table 2.

TABLE 2

Note: the meanings of the symbols are as in Table 1; 6d42/d15 represents that 6 strains are heterozygous biallelic mutations of d42/d15, 16d5i3 represents that 16 strains are homozygous mutations of d5i3, and the like.

The results show that T₀The homozygous strain of the generation SBEIIa which is subjected to site-directed mutation can stably inherit T₁Generation, T by strict selfing of Diallelic mutant lines of SBEIIa edited in site-directed manner₁The segregation situation conforms to Mendelian inheritance rule at T₁No new types of variation were found in the passage lines. At T₁Editing strains with target regions mutated and without carrying vector sequences can be obtained.

3. Off-target analysis of CRISPR/Cas9

Predicting the possible existing off-target site of the sgRNA1 target point of the SBEIIa gene according to online prediction software (http:// crispr. dbcls. jp /), and designing a primer according to the flanking sequence of the possible existing off-target site: a primer pair consisting of OFT1F1 and OFT1R1, a primer pair consisting of OFT1F2 and OFT1R2, and a primer pair consisting of OFT1F3 and OFT1R 3.

OFT1F1：5’-AGCGCTTGCTTTACTAGGGT-3’；OFT1R1：5’-GTCATCGGCATGTGGCAAAG-3’。

OFT1F2：5’-AGGGGGTAAACCTTGTGCAG-3’；OFT1R2：5’-CGAAACTTTTCCACGCGCAG-3’。

OFT1F3：5’-GAAGACACGTTCCTGCTCCA-3；OFT1R3：5’-GCCCGGCGGAGAATAGATAC-3’。

(1) The regenerated plants obtained in the first step (i.e., 102 plants in step 1) were taken and genomic DNA was extracted.

(2) And (2) taking the genomic DNA extracted in the step (1) as a template, and respectively carrying out PCR amplification by adopting a primer pair consisting of OFT1F1 and OFT1R1, a primer pair consisting of OFT1F2 and OFT1R2 and a primer pair consisting of OFT1F3 and OFT1R 3.

(3) Sequencing the PCR amplification product obtained in the step (2).

The information on the off-target sites is shown in Table 3.

TABLE 3

The results show that no off-target phenomenon was detected in 102 plants for the 3 predicted possible off-target sites, i.e., no off-target condition existed in the gRNA 1.

Example 3 Gene-edited wheat obtained by biolistic method Using sgRNA2

Obtaining of transgenic plants

The procedure of example 2 was followed, substituting recombinant plasmid pCXUN-Cas9-gRNA2 for recombinant plasmid pCXUN-Cas9-gRNA 1.

Second, detection of fixed point editing

1. For T₀Identification of generative plants

The test plants were: 62 strains of T obtained in step one₀A regenerated plant, Zheng wheat 7698 (as a reference plant of the regenerated plant).

(1) Extracting the genome DNA of the leaves of the tested plants, and respectively adopting three specific primer pairs to carry out PCR amplification. The three specific primer pairs are respectively: a primer pair consisting of SBE-C2-AF1 and SBE-C2-AR1, a primer pair consisting of SBE-C2-BF1 and SBE-C2-BR1, and a primer pair consisting of SBE-C2-DF1 and SBE-C2-DR 1.

(2) And (2) after the step (1) is finished, recovering a PCR amplification product, uniformly mixing the PCR amplification product with a PCR product of Zheng Mai7698 in an equal amount, sequentially carrying out heating denaturation and annealing renaturation, carrying out single enzyme digestion by adopting T7 endonulase I (T7EI), and carrying out electrophoresis. T7EI recognizes and cleaves incompletely paired DNA.

(3) And (3) after the step (1) is completed, recovering PCR amplification products and sequencing.

Of the 62 regenerated plants, 2 were editing plants (3.22%) and 60 were wild-type (96.78%).

The electrophoretogram of 2 regenerated plants after enzyme cleavage is shown in FIG. 4. In fig. 4: m: DL2000 Marker; 1 represents T₀The generation plant B028-8 and 2 represent T₀Generation plant B041-S103; wild type for Zheng Mai7698, + represents an enzyme cleavage product, -represents a PCR amplification product.

The results of partial sequencing of 2 regenerated plants are shown in FIG. 5. In fig. 5: CGG is a PAM site, underlined sequence is a target sequence, and "-" indicates a base deletion.

(4) Extracting genome DNA of leaves of a test plant, identifying a Cas9 gene by adopting a primer pair consisting of Cas9-F and Cas9-R, and identifying an sgRNA gene by adopting a primer pair consisting of TaU6F and gRNAR; and identifying the hptII gene by adopting a primer pair consisting of HptF and HptR.

The genotypes of 2 regenerated plants based on the target sequence ABD genome, the mutation types based on the target sequence, the case of carrying the Cas9 gene, the case of carrying the sgRNA2 gene and the case of carrying the hptII gene are shown in Table 4.

TABLE 4

Note: the meanings of the symbols are given in tables 1 and 2.

2. For T₁Identification of the plant

Get T₀Generation plants B028-8 and B041-S103, which are selfed and harvested respectively₁Seed generation and T cultivation₁Seed generation to obtain T₁And (5) plant generation.

According to the method of step 1, for each T₁And identifying the generation plants.

Part T₁The identification result of the generation plant in the step (4) is shown in figure 6(Actin is an internal reference gene). In FIG. 6, WT represents Zheng Mai7698, and 1-12 represent different T₁And (5) plant generation.

The results of the various identifications are shown in Table 5.

TABLE 5

Note: the meanings of the symbols are given in tables 1 and 2.

The results show that T₀Substituted SBEIIa being fixed pointMutant homozygous lines can stably inherit T₁Generation, T by strict selfing of Diallelic mutant lines of SBEIIa edited in site-directed manner₁The segregation situation conforms to Mendelian inheritance rule at T₁No new types of variation were found in the passage lines. At T₁Editing strains with target regions mutated and without carrying vector sequences can be obtained.

3. Off-target analysis of CRISPR/Cas9

Predicting the possible existing off-target site of the sgRNA2 target point of the SBEIIa gene according to online prediction software (http:// crispr. dbcls. jp /), and designing a primer according to the flanking sequence of the possible existing off-target site: a primer pair consisting of OFT2F1 and OFT2R1, and a primer pair consisting of OFT2F2 and OFT2R 2.

OFT2F1：5-CATCCGCTCGAACCTGCC-3’；OFT2R1：5-CGACGAGGACAAAACGGC-3’。

OFT2F2：5-CATGCATCGCTTTCGCTTGG-3’；OFT2R2：5-GTGCTATGTGCACCTTCACG-3’。

(1) The 62 regenerated plants obtained in the first step (i.e., 62 plants in step 1) were taken and genomic DNA was extracted.

(2) And (2) taking the genomic DNA extracted in the step (1) as a template, and respectively carrying out PCR amplification by adopting a primer pair consisting of OFT2F1 and OFT2R1 and a primer pair consisting of OFT2F2 and OFT2R 2.

(3) Sequencing the PCR amplification product obtained in the step (2).

The information on the off-target sites is shown in Table 6.

TABLE 6

The results show that for the 2 predicted possible off-target sites, 62 plants have no off-target phenomenon, namely that the gRNA2 has no off-target condition.

Example 4 detection of Properties

First, analysis of starch granule character

Plant editing trial: t obtained in example 3₀Inbreeding generation plant B041-S103 to obtain T₁Generation plants from which a T-mutant based on the target sequence and having the mutation type "homozygous mutant for a genome D13 and homozygous mutant for B genome D10 and homozygous mutant for D genome D41" and not carrying a vector sequence was selected₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing. Zheng Mai7698 as wild type control plant for test editing plant. The test editing plants and the control plants are both provided with 10-20 biological repeats.

And normally planting plants to be edited and harvesting seeds.

An electron micrograph of starch granules in the kernel is shown in fig. 7A. Compared with starch granules of Zheng wheat 7698, starch granules of plants with SBEIIa genes with site-directed mutation on three genomes are irregular in shape, and a large number of A-type starch granules are obtained.

The observation picture of the starch grain size during grain development is shown in figure 7B. Compared with starch granules of Zheng wheat 7698, starch granules of plants in which three genomes of the SBEIIa gene are subjected to site-directed mutation obviously show irregular shapes.

II, determination of amylose and resistant starch content

Plant editing trial: t obtained in example 3₀Inbreeding generation plant B041-S103 to obtain T₁Generation plants from which a T-mutant based on the target sequence and having the mutation type "homozygous mutant for a genome D13 and homozygous mutant for B genome D10 and homozygous mutant for D genome D41" and not carrying a vector sequence was selected₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing. Zheng Mai7698 as wild type control plant for test editing plant. The test editing plants and the control plants are both provided with 10-20 biological repeats.

Normally cultivating the plant to be edited, harvesting seeds, shelling, grinding, and peeling to obtain the flour to be tested.

Detecting the mass percentage of the Total Starch in the flour to be detected (Total Starch Assay Kit of Megazyme company is adopted and detected according to the instruction book, and the Kit has the product number of K-TSTA). The results are shown in FIG. 8A. The results show that: compared with Zheng wheat 7698, the total starch content of flour to be tested prepared by editing plant seeds with SBEIIa gene ABD genomes knocked out at fixed points is reduced.

Detecting the mass percentage of Amylose and Amylopectin in the flour to be detected (adopting an Amylose/Amylopectin Assay Kit of Megazyme company and detecting according to the instruction book, wherein the Kit has the product number of K-AMYL), and calculating the mass ratio of the Amylose to the Amylopectin. The mass percentage of amylose is shown in FIG. 8B. The mass ratio of amylose to amylopectin is shown in FIG. 8C. The results show that: the amylose content of flour to be detected prepared from seeds of plants with three genomes of SBEIIa genes knocked out at fixed points reaches about 45 percent, and is remarkably higher than that of Zheng wheat 7698 serving as a contrast receptor material; the ratio of amylose to amylopectin of flour to be detected prepared from seeds of plants with three genomes of SBEIIa genes knocked out at fixed points is extremely higher than that of Zheng wheat 7698 serving as a control receptor material.

Detecting the mass percentage of the Resistant Starch in the flour to be detected (adopting Resistant Starch Assay Kit of Megazyme company and detecting according to the instruction, wherein the Kit has the product number of K-RSTAR). The results are shown in FIG. 8D. The resistant starch content of the flour to be detected prepared from the Zheng wheat 7698 seeds is less than 0.5 percent 0, and the resistant starch content of the flour to be detected prepared from the seeds of the plants of which three genomes of the SBEIIa genes are knocked out in a fixed-point mode is as high as 5 percent.

The results show that the content of amylose and resistant starch can be obviously improved by knockout mutation of the SBEIIa gene in three wheat genomes.

Determination of starch RVA value

Plant editing trial: t obtained in example 3₀Inbreeding generation plant B041-S103 to obtain T₁Generation plants from which a T-mutant based on the target sequence and having the mutation type "homozygous mutant for a genome D13 and homozygous mutant for B genome D10 and homozygous mutant for D genome D41" and not carrying a vector sequence was selected₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing. Zheng Mai7698 as wild type control plant for test editing plant. Both the test editing plants and the control plants were set 1020 biological replicates.

Normally cultivating the plant to be edited, harvesting seeds, shelling, peeling and grinding to obtain the flour to be tested. The starch viscosity spectrum (RVA spectrum) of the flour to be detected is detected by a 3D type viscosity rapid tester (Australian Newport scientific instrument company) with matched software TCW (thermal Cycle for Windows).

The results are shown in FIG. 9. The result shows that the starch peak viscosity value and the final viscosity value of the flour to be detected prepared by the seeds of the plants with three genomes of the SBEIIa gene ABD knocked out in a fixed point mode are obviously lower than those of Zheng wheat 7698.

IV, analysis of starch chain length distribution

Plant editing trial: t obtained in example 3₀Inbreeding generation plant B041-S103 to obtain T₁Generation plants from which a T-mutant based on the target sequence and having the mutation type "homozygous mutant for a genome D13 and homozygous mutant for B genome D10 and homozygous mutant for D genome D41" and not carrying a vector sequence was selected₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing. Zheng Mai7698 as wild type control plant for test editing plant. The test editing plants and the control plants are both provided with 10-20 biological repeats.

Normally cultivating the plant to be edited, harvesting seeds, shelling, peeling and grinding to obtain the flour to be tested. The average value of chain length polymerization degree of amylopectin of flour to be detected is detected by a BioLC analyzer produced by Dionexco company in the United states for comparative analysis.

Relative chain length distribution is the chain length distribution of amylopectin in the flour to be tested prepared from the seeds of the transgenic plants-the chain length distribution of amylopectin in the flour to be tested prepared from the seeds of Zheng Mai 7698.

The results of the chain length distribution are shown in FIG. 10A, and the results of the relative chain length distribution are shown in FIG. 10B. The results show that: compared with Zheng wheat 7698, in the flour to be tested prepared from seeds of plants with three genomes of SBEIIa gene knocked out at fixed points, amylopectin with degree of polymerization DP <9 is increased, amylopectin between DP 9 and DP 12 is decreased, amylopectin with DP 13 to DP 19 is increased, amylopectin with DP 20 to DP 33 is decreased, and long-chain starch with degree of polymerization DP >35 is increased.

Fifthly, determining the content of total pentosan

Trial editing plant 1: t obtained in example 3₀Inbreeding generation plant B028-8 to obtain T₁Generation plants from which T with the type of mutation based on the target sequence of "A genome wt wild type and B genome wt wild type and D genome D7 homozygous mutant" and not carrying a vector sequence were selected₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing.

Trial editing plant 2: example 2T₀Inbreeding generation plant B86-E8 to obtain T₁Generation plants from which T are selected on the basis of the type of the mutation of the target sequence which is "homozygous mutant for the A genome D8 and homozygous mutant for the B genome D1 and wild type for the D genome wt" and which do not carry a vector sequence₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing.

Trial editing plant 3: example 2T₀Inbreeding generation plant B49-S70 to obtain T₁Generation plants from which T-plants were selected, based on the target sequence, which had the type of mutation "homozygous mutant for A genome i1 and homozygous mutant for B genome wt wild type and homozygous mutant for D genome D1" and which did not carry a vector sequence₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing.

Trial editing plant 4: example 2T₀Inbreeding generation plant B13-C14 to obtain T₁Generation plants from which a T-mutant based on the target sequence and having the mutation type "homozygous mutant for a genome D6 and homozygous mutant for B genome D7 and homozygous mutant for D genome i 1" and not carrying a vector sequence was selected₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing.

Trial editing plant 5: t obtained in example 3₀Inbred of generation plant B041-S103To obtain T₁Generation plants from which a T-mutant based on the target sequence and having the mutation type "homozygous mutant for a genome D13 and homozygous mutant for B genome D10 and homozygous mutant for D genome D41" and not carrying a vector sequence was selected₁Plant generation, selecting the T₁Selfing the plant to obtain T₂A plant of the generation, the T₂The generation plants were used as the plants for the trial editing.

Zheng Mai7698 as wild type control plant for test editing plant.

10-20 biological replicates were set for each test edited plant and control plant.

Normally cultivating the plant to be edited, harvesting seeds, shelling, grinding, and peeling to obtain the flour to be tested. And detecting the total pentosan content in the flour to be detected. The determination method of the total pentosan content is disclosed in the literature: butardo VM, Fitzgerald MA, Bird AR, Gidley MJ, Flanagan BM, Larroque O, Resurrecion AP, Laidlaw HK, Jobling SA, Morell MK, Rahman S, et al.Impact of down-regulation of static branched enzyme IIb in rice by specific microRNA-and hairpin RNA-mediated RNA Silencing [ J ] Journal of Experimental Box, 2011 Oct; 62(14):4927-41..

The mass percentage (%) of the total pentosan in the flour to be tested is shown in fig. 11. The results show that: compared with Zheng wheat 7698, the content of pentosan in the flour to be detected prepared from the seeds of the plants with different genotypes and the knocked-out SBEIIa genes is improved, and the total pentosan content of the flour to be detected prepared from the seeds of the plants with the three genomes of the SBEIIa genes knocked-out at fixed points is highest.

SEQUENCE LISTING

<110> institute of crop science of Chinese academy of agricultural sciences

<120> method for improving resistant starch content of wheat by genome editing and technical system thereof

<130> GNCYX192067

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 15756

<212> DNA

<213> Artificial sequence

<400> 1

gaattcgagc tcggtacccc tggcgaaagg gggatgtgct gcaaggcgat taagttgggt 60

aacgccaggg ttttcccagt cacgacgttg taaaacgacg gccagtgaat tcccgatcta 120

gtaacataga tgacaccgcg cgcgataatt tatcctagtt tgcgcgctat attttgtttt 180

ctatcgcgta ttaaatgtat aattgcggga ctctaatcat aaaaacccat ctcataaata 240

acgtcatgca ttacatgtta attattacat gcttaacgta attcaacaga aattatatga 300

taatcatcgc aagaccggca acaggattca atcttaagaa actttattgc caaatgtttg 360

aacgatcggg gaaattcgga tccccaatac ttcaatcgcc gccgagttgt gagaggtcga 420

tgcgtgtctc gtagaggcct gtgatagact ggtggatgag ggtggcgtcg agaacctcct 480

tggtagaggt gtagcgcttg cggtcgatgg tggtgtcgaa gtacttgaag gcggctggag 540

cgccgaggtt ggtgagggtg aagaggtgga tgatgttctc ggcctgctcg cgaattggct 600

tatcgcggtg cttgttgtag gcgctgagca ccttatcgag gttggcatcg gcgaggatca 660

cgcgcttgga gaactcggag atctgctcga tgatctcgtc gaggtagtgc ttgtgctgct 720

cgacgaacag ctgcttttgc tcgttgtcct ctggggagcc cttgagcttc tcgtagtggg 780

aggcgaggta gaggaagttc acgtacttgg acgggagagc aagctcgttg cccttctgaa 840

gctcgccagc agaggcgagc attctcttgc ggccgttctc aagctcgaag aggctgtact 900

tcgggagctt gatgatgagg tccttcttca cctccttgta gcccttggcc tcgaggaagt 960

cgattgggtt cttctcgaag ctgctgcgct ccatgatcgt gatgcccagc agctccttga 1020

cggacttgag cttcttgctc ttgcccttct cgaccttggc aaccacgagc acagagtagg 1080

ccacggtcgg agaatcgaag ccgccatact tcttcgggtc ccagtccttc ttgcgggcga 1140

tcagcttgtc ggagttgcgc tttgggagga tggactcctt ggagaagccg ccggtctgaa 1200

cctcggtctt cttcacgatg ttcacttgcg gcatggagag caccttgcgc actgtggcga 1260

aatccctgcc cttgtcccac acgatctcgc ctgtctcgcc gtttgtctcg atgagcggcc 1320

tcttcctaat ctcgccgttg gcgagcgtga tctcggtctt gaagaaattc atgatgttgg 1380

agtagaagaa gtacttggcg gtcgccttgc cgatctcttg ctcggacttg gcgatcatct 1440

tgcgcacgtc gtacaccttg tagtcgccgt acacgaactc ggactcgagc tttgggtact 1500

tcttgatgag ggctgtgccc accacggcat tgaggtaggc gtcgtgggcg tggtggtagt 1560

tgttgatctc gcgcaccttg tagaactgga agtccttgcg gaagtcggac acgagcttgg 1620

acttgagggt gatgaccttc acctcgcgga tgagcttgtc gttctcgtcg tacttggtgt 1680

tcatgcggga gtcgaggatc tgggccacgt gctttgtgat ctggcgtgtc tcgacgagct 1740

ggcgcttgat gaagccggcc ttatcaagct cggaaaggcc gcctctctcg gccttggtga 1800

ggttgtcgaa cttcctctgg gtgatgagct tggcgttgag gagctggcgc cagtagttct 1860

tcatcttctt gacgacctct tcggacggca cgttatcgga cttgcccctg ttcttgtcgg 1920

agcgggtgag caccttgttg tcgatggagt cgtccttcag gaaggactgc ggcacaatat 1980

ggtccacgtc gtagtcggag aggcggttga tgtccagctc ttggtccacg tacatgtcgc 2040

ggccgttctg gaggtagtag aggtagagct tctcgttctg gagctgggtg ttctcgactg 2100

ggtgctcctt gaggatctgg gagcccagct ccttaatgcc ctcctcgatc ctcttcatgc 2160

gctcgcggga gttcttttgg cccttctgtg tggtctggtt ctcgcgggcc atctcgatca 2220

cgatgttctc tggcttgtgc ctgcccatca ccttcaccag ctcgtccacc accttcacgg 2280

tctggagaat gcccttcttg atagccgggg agccggcgag attggcgata tgctcatgga 2340

gggaatcgcc ttggccggac acctgggcct tttggatgtc ctccttgaag gtgagggagt 2400

cgtcgtggat gagctgcatg aagttgcggt tggcgaagcc gtcggacttg aggaagtcga 2460

ggatcgtctt gccggactgc ttgtcgcgga tgccgttgat gagcttccta gagagcctgc 2520

cccagccggt atagcgcctg cgcttcagct gcttcatcac cttgtcgtcg aagaggtggg 2580

cgtatgtctt gaggcgctcc tcgatcatct cgcggtcctc gaagagggtg agggtgagca 2640

cgatgtcctc gaggatgtcc tcgttctcct cgttgtcgag gaagtccttg tccttgataa 2700

tcttgaggag gtcgtggtag gtcccgaggg aggcattgaa cctatcctcg acgccggaga 2760

tctcgacgga gtcgaagcac tcgattttct tgaagtagtc ctccttgagc tgcttcacgg 2820

tcaccttgcg gttggtcttg aacagcaggt cgacgatggc cttcttttgc tcgccgctaa 2880

ggaaagctgg cttcctcatc ccctcggtca cgtacttcac cttggtcagc tcgttgtaca 2940

cggtgaagta ctcgtagagg agtgagtgct tcgggagcac cttctcgttc gggaggttct 3000

tgtcgaagtt ggtcatgcgc tcgatgaaag actgggcaga ggcgccctta tccaccacct 3060

cctcgaagtt ccagggggtg attgtctcct cggactttct ggtcatccag gcgaacctgg 3120

agttgcccct ggcgagcggg cccacgtagt acgggatgcg gaaggtgagg atcttctcaa 3180

tcttctcgcg gttgtccttg aggaacgggt agaagtcctc ttgcctgcgg aggatagcat 3240

gaagctcgcc gaggtggatc tggtgcggga tggagccatt atcgaaggtg cgctgcttgc 3300

ggaggaggtc ctctctattg agcttcacga gcagctcctc ggtgccgtcc atcttctcga 3360

ggatcggctt gatgaacttg tagaactcct cttgagaagc gccgccatcg atgtagccgg 3420

cgtagccgtt cttggactgg tcgaagaaga tctccttgta cttctctggg agctgctgtc 3480

tcacgagggc cttgaggagt gtgaggtcct ggtggtgctc gtcgtacctc ttgatcatgg 3540

aggcggagag tggggccttg gtgatctcgg tgttcaccct gaggatgtcg ctgaggagga 3600

tggcgtcgga gagattcttg gcggcgagga acagatcggc gtactgatcg ccaatctggg 3660

cgaggagatt gtcgaggtcg tcgtcgtagg tgtccttgga aagctggagc ttggcgtcct 3720

cggcgaggtc gaagttggac ttgaagttcg gggtgaggcc aagagagagg gcgatcaggt 3780

tgccgaagag gccattcttc ttctcgcccg gaagttgggc gatcagattc tcgagcctgc 3840

gggacttaga gagcctggca gagagaatag ccttggcgtc aacgccagag gcgttgatcg 3900

ggttctcctc gaacagctgg ttgtaggtct gcacgagctg gatgaacagc ttgtccacat 3960

cggagttgtc cgggttgagg tcgccctcga tgaggaagtg gcccctgaac ttgatcatgt 4020

gggcgagggc gaggtagatg agcctgaggt cggccttatc ggtggagtcg acgagcttct 4080

tgcggaggtg gtagatggtc gggtacttct cgtggtaggc cacctcatcc acgatgttgc 4140

cgaagatcgg atggcgctcg tgcttcttgt cctcctcgac gaggaagctc tcctcgagcc 4200

tgtggaagaa gctgtcgtcc accttggcca tctcgttgga gaagatctct tggaggtagc 4260

agatgcggtt cttgcgcctg gtgtacctgc gtctagcggt cctcttgagc cttgtagcct 4320

cggctgtctc gccagagtcg aacagcaggg cgccgatgag attcttcttg atggagtggc 4380

ggtcggtgtt gccgaggacc ttgaacttct tggacggcac cttgtactcg tcggtgatca 4440

cggcccagcc aacagaattg gtgccgatgt cgaggccgat ggagtacttc ttgtcgacct 4500

tgcgcttctt ctttggggcc atagtattgg ggatcccccg ggctgcagaa gtaacaccaa 4560

acaacagggt gagcatcgac aaaagaaaca gtaccaagca aataaatagc gtatgaaggc 4620

agggctaaaa aaatccacat atagctgctg catatgccat catccaagta tatcaagatc 4680

aaaataatta taaaacatac ttgtttatta taatagatag gtactcaagg ttagagcata 4740

tgaatagatg ctgcatatgc catcatgtat atgcatcagt aaaacccaca tcaacatgta 4800

tacctatcct agatcgatat ttccatccat cttaaactcg taactatgaa gatgtatgac 4860

acacacatac agttccaaaa ttaataaata caccaggtag tttgaaacag tattctactc 4920

cgatctagaa cgaatgaacg accgcccaac cacaccacat catcacaacc aagcgaacaa 4980

aaagcatctc tgtatatgca tcagtaaaac ccgcatcaac atgtatacct atcctagatc 5040

gatatttcca tccatcatct tcaattcgta actatgaata tgtatggcac acacatacag 5100

atccaaaatt aataaatcca ccaggtagtt tgaaacagaa ttctactccg atctagaacg 5160

accgcccaac cagaccacat catcacaacc aagacaaaaa aaagcatgaa aagatgaccc 5220

gacaaacaag tgcacggcat atattgaaat aaaggaaaag ggcaaaccaa accctatgca 5280

acgaaacaaa aaaaatcatg aaatcgatcc cgtctgcgga acggctagag ccatcccagg 5340

attccccaaa gagaaacact ggcaagttag caatcagaac gtgtctgacg tacaggtcgc 5400

atccgtgtac gaacgctagc agcacggatc taacacaaac acggatctaa cacaaacatg 5460

aacagaagta gaactaccgg gccctaacca tggaccggaa cgccgatcta gagaaggtag 5520

agaggggggg ggggggagga cgagcggcgt accttgaagc ggaggtgccg acgggtggat 5580

ttgggggaga tctggttgtg tgtgtgtgcg ctccgaacaa cacgaggttg gggaaagagg 5640

gtgtggaggg ggtgtctatt tattacggcg ggcgaggaag ggaaagcgaa ggagcggtgg 5700

gaaaggaatc ccccgtagct gccgtgccgt gagaggagga ggaggccgcc tgccgtgccg 5760

gctcacgtct gccgctccgc cacgcatttc tggatgccga cagcggagca agtccaacgg 5820

tggagcggaa ctctcgagag gggtccagag gcagcgacag agatgccgtg ccgtctgctt 5880

cgcttggccc gacgcgacgc tgctggttcg ctggttggtg tccgttagac tcgtcgacgg 5940

cgtttaacag gctggcatta tctactcgaa acaagaaaaa tgtttcctta gtttttttaa 6000

tttcttaaag ggtatttgtt taatttttag tcactttatt ttattctatt ttatatctaa 6060

attattaaat aaaaaaacta aaatagagtt ttagttttct taatttagag gctaaaatag 6120

aataaaatag atgtactaaa aaaattagtc tataaaaacc attaacccta aaccctaaat 6180

ggatgtacta ataaaatgga tgaagtatta tataggtgaa gctatttgca aaaaaaaagg 6240

agaacacatg cacactaaaa agataaaact gtagagtcct gttgtcaaaa tactcaattg 6300

tcctttagac catgtctaac tgttcattta tatgattctc taaaacactg atattattgt 6360

agtactatag attatattat tcgtagagta aagtttaaat atatgtataa agatagataa 6420

actgcacttc aaacaagtgt gacaaaaaaa atatgtggta attttttata acttagacat 6480

gcaatgctca ttatctctag agaggggcac gaccgggtca cgctgcactg caggaattcg 6540

atatcaagct tgaccaagcc cgttattctg acagttctgg tgctcaacac atttatattt 6600

atcaaggagc acattgttac tcactgctag gagggaatcg aactaggaat attgatcaga 6660

ggaactacga gagagctgaa gataactgcc ctctagctct cactgatctg ggtcgcatag 6720

tgagatgcag cccacgtgag ttcagcaacg gtctagcgct gggcttttag gcccgcatga 6780

tcgggctttt gtcgggtggt cgacgtgttc acgattgggg agagcaacgc agcagttcct 6840

cttagtttag tcccacctcg cctgtccagc agagttctga ccggtttata aactcgcttg 6900

ctgcatcaga cttgagaggc cgcgcggctc aggagtttta gagctagaaa tagcaagtta 6960

aaataaggct agtccgttat caacttgaaa aagtggcacc gagtcggtgc tttttttggt 7020

accctgcatg ggagaggcgg tttgcgtatt ggtttaaaca tagctaaact atcagtgttt 7080

gacaggatat attggcgggt aaacctaaga gaaaagagcg tttattagaa taacggatat 7140

ttaaaagggc gtgaaaaggt ttatccgttc gtccatttgt atgtgcatgc caaccacagg 7200

gttcccctcg ggatcaaagt actttgatcc aacccctccg ctgctatagt gcagtcggct 7260

tctgacgttc agtgcagccg tcttctgaaa acgacatgtc gcacaagtcc taagttacgc 7320

gacaggctgc cgccctgccc ttttcctggc gttttcttgt cgcgtgtttt agtcgcataa 7380

agtagaatac ttgcgactag aaccggagac attacgccat gaacaagagc gccgccgctg 7440

gcctgctggg ctatgcccgc gtcagcaccg acgaccagga cttgaccaac caacgggccg 7500

aactgcacgc ggccggctgc accaagctgt tttccgagaa gatcaccggc accaggcgcg 7560

accgcccgga gctggccagg atgcttgacc acctagccct ggcgacgttg tgacagtgac 7620

caggctagac cgcctggccc gcagcacccg cgacctactg gacattgccg agcgcatcca 7680

ggaggccggc gcgggcctgc gtagcctggc agagccgtgg gccgacacca ccacgccggc 7740

cggccgcatg gtgttgaccg tgttcgccgg cattgccgag ttcgagcgtt ccctaatcat 7800

cgaccgcacc cggagcgggc gcgaggccgc caaggcccga ggcgtgaagt ttggcccccg 7860

ccctaccctc accccggcac agatcgcgca cgcccgcgag ctgatcgacc aggaaggccg 7920

caccgtgaaa gaggcggctg cactgcttgg cgtgcatcgc tcgaccctgt accgcgcact 7980

tgagcgcagc gaggaagtga cgcccaccga ggccaggcgg cgcggtgcct tccgtgagga 8040

cgcattgacc gaggccgacg ccctggcggc cgccgagaat gaacgccaag aggaacaagc 8100

atgaaaccgc accaggacgg ccaggacgaa ccgtttttca ttaccgaaga gatcgaggcg 8160

gagatgatcg cggccgggta cgtgttcgag ccgcccgcgc acgtctcaac cgtgcggctg 8220

catgaaatcc tggccggttt gtctgatgcc aagctggcgg cctggccggc cagcttggcc 8280

gctgaagaaa ccgagcgccg ccgtctaaaa aggtgatgtg tatttgagta aaacagcttg 8340

cgtcatgcgg tcgctgcgta tatgatgcga tgagtaaata aacaaatacg caaggggaac 8400

gcatgaaggt tatcgctgta cttaaccaga aaggcgggtc aggcaagacg accatcgcaa 8460

cccatctagc ccgcgccctg caactcgccg gggccgatgt tctgttagtc gattccgatc 8520

cccagggcag tgcccgcgat tgggcggccg tgcgggaaga tcaaccgcta accgttgtcg 8580

gcatcgaccg cccgacgatt gaccgcgacg tgaaggccat cggccggcgc gacttcgtag 8640

tgatcgacgg agcgccccag gcggcggact tggctgtgtc cgcgatcaag gcagccgact 8700

tcgtgctgat tccggtgcag ccaagccctt acgacatatg ggcaaccgcc gacctggtgg 8760

agctggttaa gcagcgcatt gaggtcacgg atggaaggct acaagcggcc tttgtcgtgt 8820

cgcgggcgat caaaggcacg cgcatcggcg gtgaggttgc cgaggcgctg gccgggtacg 8880

agctgcccat tcttgagtcc cgtatcacgc agcgcgtgag ctacccaggc actgccgccg 8940

ccggcacaac cgttcttgaa tcagaacccg agggcgacgc tgcccgcgag gtccaggcgc 9000

tggccgctga aattaaatca aaactcattt gagttaatga ggtaaagaga aaatgagcaa 9060

aagcacaaac acgctaagtg ccggccgtcc gagcgcacgc agcagcaagg ctgcaacgtt 9120

ggccagcctg gcagacacgc cagccatgaa gcgggtcaac tttcagttgc cggcggagga 9180

tcacaccaag ctgaagatgt acgcggtacg ccaaggcaag accattaccg agctgctatc 9240

tgaatacatc gcgcagctac cagagtaaat gagcaaatga ataaatgagt agatgaattt 9300

tagcggctaa aggaggcggc atggaaaatc aagaacaacc aggcaccgac gccgtggaat 9360

gccccatgtg tggaggaacg ggcggttggc caggcgtaag cggctgggtt gtctgccggc 9420

cctgcaatgg cactggaacc cccaagcccg aggaatcggc gtgacggtcg caaaccatcc 9480

ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg tggagaagtt gaaggccgcg 9540

caggccgccc agcggcaacg catcgaggca gaagcacgcc ccggtgaatc gtggcaagcg 9600

gccgctgatc gaatccgcaa agaatcccgg caaccgccgg cagccggtgc gccgtcgatt 9660

aggaagccgc ccaagggcga cgagcaacca gattttttcg ttccgatgct ctatgacgtg 9720

ggcacccgcg atagtcgcag catcatggac gtggccgttt tccgtctgtc gaagcgtgac 9780

cgacgagctg gcgaggtgat ccgctacgag cttccagacg ggcacgtaga ggtttccgca 9840

gggccggccg gcatggccag tgtgtgggat tacgacctgg tactgatggc ggtttcccat 9900

ctaaccgaat ccatgaaccg ataccgggaa gggaagggag acaagcccgg ccgcgtgttc 9960

cgtccacacg ttgcggacgt actcaagttc tgccggcgag ccgatggcgg aaagcagaaa 10020

gacgacctgg tagaaacctg cattcggtta aacaccacgc acgttgccat gcagcgtacg 10080

aagaaggcca agaacggccg cctggtgacg gtatccgagg gtgaagcctt gattagccgc 10140

tacaagatcg taaagagcga aaccgggcgg ccggagtaca tcgagatcga gctagctgat 10200

tggatgtacc gcgagatcac agaaggcaag aacccggacg tgctgacggt tcaccccgat 10260

tactttttga tcgatcccgg catcggccgt tttctctacc gcctggcacg ccgcgccgca 10320

ggcaaggcag aagccagatg gttgttcaag acgatctacg aacgcagtgg cagcgccgga 10380

gagttcaaga agttctgttt caccgtgcgc aagctgatcg ggtcaaatga cctgccggag 10440

tacgatttga aggaggaggc ggggcaggct ggcccgatcc tagtcatgcg ctaccgcaac 10500

ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg agcagatgct agggcaaatt 10560

gccctagcag gggaaaaagg tcgaaaaggt ctctttcctg tggatagcac gtacattggg 10620

aacccaaagc cgtacattgg gaaccggaac ccgtacattg ggaacccaaa gccgtacatt 10680

gggaaccggt cacacatgta agtgactgat ataaaagaga aaaaaggcga tttttccgcc 10740

taaaactctt taaaacttat taaaactctt aaaacccgcc tggcctgtgc ataactgtct 10800

ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc ttcggtcgct gcgctcccta 10860

cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc gctcaaaaat ggctggccta 10920

cggccaggca atctaccagg gcgcggacaa gccgcgccgt cgccactcga ccgccggcgc 10980

ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat 11040

gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg 11100

tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc agtcacgtag 11160

cgatagcgga gtgtatactg gcttaactat gcggcatcag agcagattgt actgagagtg 11220

caccatatgc ggtgtgaaat accgcacaga tgcgtaagga gaaaataccg catcaggcgc 11280

tcttccgctt cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta 11340

tcagctcact caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag 11400

aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg 11460

tttttccata ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg 11520

tggcgaaacc cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg 11580

cgctctcctg ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga 11640

agcgtggcgc tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc 11700

tccaagctgg gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt 11760

aactatcgtc ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact 11820

ggtaacagga ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg 11880

cctaactacg gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt 11940

accttcggaa aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt 12000

ggtttttttg tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct 12060

ttgatctttt ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg 12120

gtcatgcatt ctaggtacta aaacaattca tccagtaaaa tataatattt tattttctcc 12180

caatcaggct tgatccccag taagtcaaaa aatagctcga catactgttc ttccccgata 12240

tcctccctga tcgaccggac gcagaaggca atgtcatacc acttgtccgc cctgccgctt 12300

ctcccaagat caataaagcc acttactttg ccatctttca caaagatgtt gctgtctccc 12360

aggtcgccgt gggaaaagac aagttcctct tcgggctttt ccgtctttaa aaaatcatac 12420

agctcgcgcg gatctttaaa tggagtgtct tcttcccagt tttcgcaatc cacatcggcc 12480

agatcgttat tcagtaagta atccaattcg gctaagcggc tgtctaagct attcgtatag 12540

ggacaatccg atatgtcgat ggagtgaaag agcctgatgc actccgcata cagctcgata 12600

atcttttcag ggctttgttc atcttcatac tcttccgagc aaaggacgcc atcggcctca 12660

ctcatgagca gattgctcca gccatcatgc cgttcaaagt gcaggacctt tggaacaggc 12720

agctttcctt ccagccatag catcatgtcc ttttcccgtt caacatcata ggtggtccct 12780

ttataccggc tgtccgtcat ttttaaatat aggttttcat tttctcccac cagcttatat 12840

accttagcag gagacattcc ttccgtatct tttacgcagc ggtatttttc gatcagtttt 12900

ttcaattccg gtgatattct cattttagcc atttattatt tccttcctct tttctacagt 12960

atttaaagat accccaagaa gctaattata acaagacgaa ctccaattca ctgttccttg 13020

cattctaaaa ccttaaatac cagaaaacag ctttttcaaa gttgttttca aagttggcgt 13080

ataacatagt atcgacggag ccgattttga aaccgcggtg atcacaggca gcaacgctct 13140

gtcatcgtta caatcaacat gctaccctcc gcgagatcat ccgtgtttca aacccggcag 13200

cttagttgcc gttcttccga atagcatcgg taacatgagc aaagtctgcc gccttacaac 13260

ggctctcccg ctgacgccgt cccggactga tgggctgcct gtatcgagtg gtgattttgt 13320

gccgagctgc cggtcgggga gctgttggct ggctggtggc aggatatatt gtggtgtaaa 13380

caaattgacg cttagacaac ttaataacac attgcggacg tttttaatgt actgaattaa 13440

cgccgaatta attcggggga tctggatttt agtactggat tttggtttta ggaattagaa 13500

attttattga tagaagtatt ttacaaatac aaatacatac taagggtttc ttatatgctc 13560

aacacatgag cgaaacccta taggaaccct aattccctta tctgggaact actcacacat 13620

tattatggag aaactcgagc ttgtcgatcg acagatccgg tcggcatcta ctctatttct 13680

ttgccctcgg acgagtgctg gggcgtcggt ttccactatc ggcgagtact tctacacagc 13740

catcggtcca gacggccgcg cttctgcggg cgatttgtgt acgcccgaca gtcccggctc 13800

cggatcggac gattgcgtcg catcgaccct gcgcccaagc tgcatcatcg aaattgccgt 13860

caaccaagct ctgatagagt tggtcaagac caatgcggag catatacgcc cggagtcgtg 13920

gcgatcctgc aagctccgga tgcctccgct cgaagtagcg cgtctgctgc tccatacaag 13980

ccaaccacgg cctccagaag aagatgttgg cgacctcgta ttgggaatcc ccgaacatcg 14040

cctcgctcca gtcaatgacc gctgttatgc ggccattgtc cgtcaggaca ttgttggagc 14100

cgaaatccgc gtgcacgagg tgccggactt cggggcagtc ctcggcccaa agcatcagct 14160

catcgagagc ctgcgcgacg gacgcactga cggtgtcgtc catcacagtt tgccagtgat 14220

acacatgggg atcagcaatc gcgcatatga aatcacgcca tgtagtgtat tgaccgattc 14280

cttgcggtcc gaatgggccg aacccgctcg tctggctaag atcggccgca gcgatcgcat 14340

ccatagcctc cgcgaccggt tgtagaacag cgggcagttc ggtttcaggc aggtcttgca 14400

acgtgacacc ctgtgcacgg cgggagatgc aataggtcag gctctcgcta aactccccaa 14460

tgtcaagcac ttccggaatc gggagcgcgg ccgatgcaaa gtgccgataa acataacgat 14520

ctttgtagaa accatcggcg cagctattta cccgcaggac atatccacgc cctcctacat 14580

cgaagctgaa agcacgagat tcttcgccct ccgagagctg catcaggtcg gagacgctgt 14640

cgaacttttc gatcagaaac ttctcgacag acgtcgcggt gagttcaggc tttttcatat 14700

ctcattgccc cccggatctg cgaaagctcg agagagatag atttgtagag agagactggt 14760

gatttcagcg tgtcctctcc aaatgaaatg aacttcctta tatagaggaa ggtcttgcga 14820

aggatagtgg gattgtgcgt catcccttac gtcagtggag atatcacatc aatccacttg 14880

ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc 14940

atctttggga ccactgtcgg cagaggcatc ttgaacgata gcctttcctt tatcgcaatg 15000

atggcatttg taggtgccac cttccttttc tactgtcctt ttgatgaagt gacagatagc 15060

tgggcaatgg aatccgagga ggtttcccga tattaccctt tgttgaaaag tctcaatagc 15120

cctttggtct tctgagactg tatctttgat attcttggag tagacgagag tgtcgtgctc 15180

caccatgtta tcacatcaat ccacttgctt tgaagacgtg gttggaacgt cttctttttc 15240

cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag aggcatcttg 15300

aacgatagcc tttcctttat cgcaatgatg gcatttgtag gtgccacctt ccttttctac 15360

tgtccttttg atgaagtgac agatagctgg gcaatggaat ccgaggaggt ttcccgatat 15420

taccctttgt tgaaaagtct caatagccct ttggtcttct gagactgtat ctttgatatt 15480

cttggagtag acgagagtgt cgtgctccac catgttggca agctgctcta gccaatacgc 15540

aaaccgcctc tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc 15600

gactggaaag cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca 15660

ccccaggctt tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa 15720

caatttcaca caggaaacag ctatgaccat gattac 15756

<210> 2

<211> 823

<212> PRT

<213> Triticum aestivum

<400> 2

Met Ala Thr Phe Ala Val Ser Gly Ala Thr Leu Gly Val Ala Arg Pro

1 5 10 15

Ala Gly Ala Gly Gly Gly Leu Leu Pro Arg Ser Gly Ser Glu Arg Arg

20 25 30

Gly Gly Val Asp Leu Pro Ser Leu Leu Leu Arg Lys Lys Asp Ser Ser

35 40 45

Arg Ala Val Leu Ser Arg Ala Ala Ser Pro Gly Lys Val Leu Val Pro

50 55 60

Asp Gly Glu Ser Asp Asp Leu Ala Ser Pro Ala Gln Pro Glu Glu Leu

65 70 75 80

Gln Ile Pro Glu Asp Ile Glu Glu Gln Thr Ala Glu Val Asn Met Thr

85 90 95

Gly Gly Thr Ala Glu Lys Leu Glu Ser Ser Glu Pro Thr Gln Gly Ile

100 105 110

Val Glu Thr Ile Thr Asp Gly Val Thr Lys Gly Val Lys Glu Leu Val

115 120 125

Val Gly Glu Lys Pro Arg Val Val Pro Lys Pro Gly Asp Gly Gln Lys

130 135 140

Ile Tyr Glu Ile Asp Pro Thr Leu Lys Asp Phe Arg Ser His Leu Asp

145 150 155 160

Tyr Arg Tyr Ser Glu Tyr Arg Arg Ile Arg Ala Ala Ile Asp Gln His

165 170 175

Glu Gly Gly Leu Glu Ala Phe Ser Arg Gly Tyr Glu Lys Leu Gly Phe

180 185 190

Thr Arg Ser Ala Glu Gly Ile Thr Tyr Arg Glu Trp Ala Pro Gly Ala

195 200 205

His Ser Ala Ala Leu Val Gly Asp Phe Asn Asn Trp Asn Pro Asn Ala

210 215 220

Asp Thr Met Thr Arg Asp Asp Tyr Gly Val Trp Glu Ile Phe Leu Pro

225 230 235 240

Asn Asn Ala Asp Gly Ser Pro Ala Ile Pro His Gly Ser Arg Val Lys

245 250 255

Ile Arg Met Asp Thr Pro Ser Gly Val Lys Asp Ser Ile Ser Ala Trp

260 265 270

Ile Lys Phe Ser Val Gln Ala Pro Gly Glu Ile Pro Phe Asn Gly Ile

275 280 285

Tyr Tyr Asp Pro Pro Glu Glu Glu Lys Tyr Val Phe Gln His Pro Gln

290 295 300

Pro Lys Arg Pro Glu Ser Leu Arg Ile Tyr Glu Ser His Ile Gly Met

305 310 315 320

Ser Ser Pro Glu Pro Lys Ile Asn Ser Tyr Ala Asn Phe Arg Asp Glu

325 330 335

Val Leu Pro Arg Ile Lys Arg Leu Gly Tyr Asn Ala Val Gln Ile Met

340 345 350

Ala Ile Gln Glu His Ser Tyr Tyr Ala Ser Phe Gly Tyr His Val Thr

355 360 365

Asn Phe Phe Ala Pro Ser Ser Arg Phe Gly Thr Pro Glu Asp Leu Lys

370 375 380

Ser Leu Ile Asp Arg Ala His Glu Leu Gly Leu Leu Val Leu Met Asp

385 390 395 400

Ile Val His Ser His Ser Ser Asn Asn Thr Leu Asp Gly Leu Asn Gly

405 410 415

Phe Asp Gly Thr Asp Thr His Tyr Phe His Gly Gly Pro Arg Gly His

420 425 430

His Trp Met Trp Asp Ser Arg Leu Phe Asn Tyr Gly Ser Trp Glu Val

435 440 445

Leu Arg Phe Leu Leu Ser Asn Ala Arg Trp Trp Leu Glu Glu Tyr Lys

450 455 460

Phe Asp Gly Phe Arg Phe Asp Gly Val Thr Ser Met Met Tyr Thr His

465 470 475 480

His Gly Leu Gln Met Thr Phe Thr Gly Asn Tyr Gly Glu Tyr Phe Gly

485 490 495

Phe Ala Thr Asp Val Asp Ala Val Val Tyr Leu Met Leu Val Asn Asp

500 505 510

Leu Ile His Gly Leu His Pro Asp Ala Val Ser Ile Gly Glu Asp Val

515 520 525

Ser Gly Met Pro Thr Phe Cys Ile Pro Val Pro Asp Gly Gly Val Gly

530 535 540

Phe Asp Tyr Arg Leu His Met Ala Val Ala Asp Lys Trp Ile Glu Leu

545 550 555 560

Leu Lys Gln Ser Asp Glu Ser Trp Lys Met Gly Asp Ile Val His Thr

565 570 575

Leu Thr Asn Arg Arg Trp Leu Glu Lys Cys Val Thr Tyr Ala Glu Ser

580 585 590

His Asp Gln Ala Leu Val Gly Asp Lys Thr Ile Ala Phe Trp Leu Met

595 600 605

Asp Lys Asp Met Tyr Asp Phe Met Ala Leu Asp Arg Pro Ser Thr Pro

610 615 620

Arg Ile Asp Arg Gly Ile Ala Leu His Lys Met Ile Arg Leu Val Thr

625 630 635 640

Met Gly Leu Gly Gly Glu Gly Tyr Leu Asn Phe Met Gly Asn Glu Phe

645 650 655

Gly His Pro Glu Trp Ile Asp Phe Pro Arg Gly Pro Gln Thr Leu Pro

660 665 670

Thr Gly Lys Val Leu Pro Gly Asn Asn Asn Ser Tyr Asp Lys Cys Arg

675 680 685

Arg Arg Phe Asp Leu Gly Asp Ala Asp Phe Leu Arg Tyr Arg Gly Met

690 695 700

Gln Glu Phe Asp Gln Ala Met Gln His Leu Glu Glu Lys Tyr Gly Phe

705 710 715 720

Met Thr Ser Glu His Gln Tyr Val Ser Arg Lys His Glu Glu Asp Lys

725 730 735

Val Ile Ile Phe Glu Arg Gly Asp Leu Val Phe Val Phe Asn Phe His

740 745 750

Trp Ser Asn Ser Phe Phe Asp Tyr Arg Val Gly Cys Ser Arg Pro Gly

755 760 765

Lys Tyr Lys Val Ala Leu Asp Ser Asp Asp Ala Leu Phe Gly Gly Phe

770 775 780

Ser Arg Leu Asp His Asp Val Asp Tyr Phe Thr Thr Glu His Pro His

785 790 795 800

Asp Asn Arg Pro Arg Ser Phe Ser Val Tyr Thr Pro Ser Arg Thr Ala

805 810 815

Val Val Tyr Ala Leu Thr Glu

820

<210> 3

<211> 2472

<212> DNA

<213> Triticum aestivum

<400> 3

atggcgacgt ttgcggtgtc cggcgcgacc ctcggtgtgg cgcggcccgc cggcgccggc 60

ggcggactgc tgccgcgatc cggctcggag cggaggggcg gggtggacct gccgtcgctg 120

ctcctcagga agaaggactc ctctcgcgcc gtcctgagcc gcgcggcctc tccagggaag 180

gtcctggtgc ctgacggtga gagcgacgac ttggcaagtc cggcgcaacc tgaagaatta 240

cagatacctg aagacatcga ggagcaaacg gctgaagtaa acatgacagg ggggactgca 300

gaaaaacttg aatcttcaga accgactcaa ggcattgtgg aaacaatcac tgatggtgta 360

accaaaggag ttaaggaact agtcgtgggg gagaaaccgc gagttgtccc aaaaccagga 420

gatgggcaga aaatatacga gattgaccca acgctgaaag attttcggag ccatcttgac 480

taccgataca gcgaatacag gagaattcgt gctgctattg accaacatga aggtggattg 540

gaagcatttt ctcgtggtta tgaaaagctt ggatttaccc gcagtgctga aggtatcact 600

taccgagaat gggctcctgg agcgcattct gcagcattag taggtgactt caacaattgg 660

aatccgaatg cagatactat gaccagagat gattatggtg tttgggagat tttcctccct 720

aacaatgctg atggatcccc agctattcct catggctcac gtgtaaagat acggatggat 780

actccatctg gtgtgaagga ttcaatttct gcttggatca agttctctgt gcaggctcca 840

ggtgaaatac cattcaatgg catatattat gatccacctg aagaggagaa gtatgtcttc 900

caacatcctc aacctaaacg accagagtca ctgaggattt atgaatcaca cattggaatg 960

agcagcccag aaccgaagat aaattcatat gctaatttta gggatgaggt gctgccaaga 1020

attaaaaggc ttggatacaa tgcagtgcag ataatggcaa tccaggagca ttcatactat 1080

gcgagctttg ggtaccatgt tactaatttt tttgcaccaa gtagccgttt tggaactcca 1140

gaggacttaa aatccctgat cgatagagca catgagcttg gtttgcttgt tcttatggat 1200

attgttcata gtcattcatc aaataatacc cttgacggct tgaatggttt cgatggcact 1260

gatacacatt acttccacgg tggtccacgt ggccatcatt ggatgtggga ttctcgtcta 1320

ttcaactatg ggagttggga agtattgaga ttcttactgt caaacgcgag atggtggctt 1380

gaagaatata agtttgatgg atttcgattt gatggggtga cctccatgat gtatactcac 1440

catggattac aaatgacatt tactgggaac tatggcgagt attttggatt tgctactgat 1500

gttgacgcgg tagtttactt gatgctggtc aacgatctaa ttcatggact tcatcctgat 1560

gctgtatcca ttggtgaaga tgtcagtgga atgcccacat tttgcatccc tgttccagat 1620

ggtggtgttg gttttgacta tcgcttgcat atggctgtag cagataaatg gattgaactc 1680

ctcaagcaaa gtgacgaatc ttggaaaatg ggtgatattg tgcacaccct aacaaataga 1740

aggtggcttg agaagtgtgt aacttatgca gaaagtcatg atcaagcact agttggtgac 1800

aagactattg cattctggtt gatggataag gatatgtatg atttcatggc tctggatagg 1860

ccttcaactc ctcgcattga tcgtggcata gcattacata aaatgatcag gcttgtcacc 1920

atgggtttag gtggtgaagg ctatcttaac ttcatgggaa atgagtttgg gcatcctgaa 1980

tggatagatt ttccaagagg tccgcaaact cttccaaccg gcaaagttct ccctggaaat 2040

aacaatagtt atgataaatg ccgccgtaga tttgatcttg gagatgcaga ttttcttaga 2100

tatcgtggta tgcaagagtt cgatcaggca atgcagcatc ttgaggaaaa atatgggttt 2160

atgacatctg agcaccagta tgtttcacgg aaacacgagg aagataaggt gatcatcttc 2220

gaaagaggag atttggtatt tgttttcaac ttccactgga gcaatagctt ttttgactac 2280

cgtgttgggt gttccaggcc tgggaagtac aaggtggcct tagactccga cgatgcactc 2340

tttggtggat tcagcaggct tgatcatgat gtcgactact tcacaaccga acatccgcat 2400

gacaacaggc cgcgctcttt ctcggtgtac actccgagca gaactgcggt cgtgtatgcc 2460

cttacagagt aa 2472

<210> 4

<211> 823

<212> PRT

<213> Triticum aestivum

<400> 4

Met Ala Thr Phe Ala Val Ser Gly Ala Thr Leu Gly Val Ala Arg Pro

1 5 10 15

Ala Ser Ala Gly Gly Gly Leu Leu Arg Ser Gly Ser Glu Arg Arg Gly

20 25 30

Gly Val Asp Leu Pro Ser Leu Leu Leu Arg Lys Lys Asp Ser Ser Arg

35 40 45

Ala Val Leu Ser Arg Ala Ala Ser Pro Gly Lys Val Leu Val Pro Asp

50 55 60

Gly Glu Ser Asp Asp Leu Ala Ala Thr Pro Ala Gln Pro Glu Glu Leu

65 70 75 80

Gln Ile Pro Glu Asp Ile Glu Glu Gln Thr Ala Glu Val Asn Met Thr

85 90 95

Gly Gly Thr Ala Glu Lys Leu Gln Tyr Ser Glu Pro Thr Gln Gly Ile

100 105 110

Val Glu Thr Ile Thr Asp Gly Val Thr Lys Gly Val Lys Glu Leu Val

115 120 125

Val Gly Glu Lys Pro Arg Val Val Pro Lys Pro Gly Asp Gly Gln Lys

130 135 140

Ile Tyr Glu Ile Asp Pro Thr Leu Lys Asp Phe Arg Ser His Leu Asp

145 150 155 160

Tyr Arg Tyr Ser Glu Tyr Lys Arg Ile Arg Ala Ala Ile Asp Gln His

165 170 175

Glu Gly Gly Leu Glu Ala Phe Ser Arg Gly Tyr Glu Lys Leu Gly Phe

180 185 190

Thr Arg Ser Ala Glu Gly Ile Thr Tyr Arg Glu Trp Ala Pro Gly Ala

195 200 205

His Ser Ala Ala Leu Val Gly Asp Phe Asn Asn Trp Asn Pro Asn Ala

210 215 220

Asp Thr Met Thr Arg Asp Asp Tyr Gly Val Trp Glu Ile Phe Leu Pro

225 230 235 240

Asn Asn Ala Asp Gly Ser Pro Ala Ile Pro His Gly Ser Arg Val Lys

245 250 255

Ile Arg Met Asp Thr Pro Ser Gly Val Lys Asp Ser Ile Ser Ala Trp

260 265 270

Ile Lys Phe Ser Val Gln Ala Pro Gly Glu Ile Pro Phe Asn Gly Ile

275 280 285

Tyr Tyr Asp Pro Pro Glu Glu Glu Lys Tyr Val Phe Gln His Pro Gln

290 295 300

Pro Lys Arg Pro Glu Ser Leu Arg Ile Tyr Glu Ser His Ile Gly Met

305 310 315 320

Ser Ser Pro Glu Pro Lys Ile Asn Ser Tyr Ala Asn Phe Arg Asp Gly

325 330 335

Val Leu Pro Arg Ile Lys Arg Leu Gly Tyr Asn Ala Val Gln Ile Met

340 345 350

Ala Ile Gln Glu His Ser Tyr Tyr Ala Ser Phe Gly Tyr His Val Thr

355 360 365

Asn Phe Phe Ala Pro Ser Ser Arg Phe Gly Thr Pro Glu Asp Leu Lys

370 375 380

Ser Leu Ile Asp Arg Ala His Glu Leu Gly Leu Leu Val Leu Met Asp

385 390 395 400

Ile Val His Ser His Ser Ser Asn Asn Thr Leu Asp Gly Leu Asn Gly

405 410 415

Phe Asp Gly Thr Asp Thr His Tyr Phe His Gly Gly Pro Arg Gly His

420 425 430

His Trp Met Trp Asp Ser Arg Leu Phe Asn Tyr Gly Ser Trp Glu Val

435 440 445

Leu Arg Phe Leu Leu Ser Asn Ala Arg Trp Trp Leu Glu Glu Tyr Lys

450 455 460

Phe Asp Gly Phe Arg Phe Asp Gly Val Thr Ser Met Met Tyr Thr His

465 470 475 480

His Gly Leu Gln Met Thr Phe Thr Gly Asn Tyr Gly Glu Tyr Phe Gly

485 490 495

Phe Ala Thr Asp Val Asp Ala Val Val Tyr Leu Met Leu Val Asn Asp

500 505 510

Leu Ile His Gly Leu Tyr Pro Asp Ala Val Ser Ile Gly Glu Asp Val

515 520 525

Ser Gly Met Pro Thr Phe Cys Ile Pro Val Pro Asp Gly Gly Val Gly

530 535 540

Phe Asp Tyr Arg Leu His Met Ala Val Ala Asp Lys Trp Ile Glu Leu

545 550 555 560

Leu Lys Gln Ser Asp Glu Ser Trp Lys Met Gly Asp Ile Val His Thr

565 570 575

Leu Thr Asn Arg Arg Trp Leu Glu Lys Cys Val Thr Tyr Ala Glu Ser

580 585 590

His Asp Gln Ala Leu Val Gly Asp Lys Thr Ile Ala Phe Trp Leu Met

595 600 605

Asp Lys Asp Met Tyr Asp Phe Met Ala Leu Asp Arg Pro Ser Thr Pro

610 615 620

Arg Ile Asp Arg Gly Ile Ala Leu His Lys Met Ile Arg Leu Val Thr

625 630 635 640

Met Gly Leu Gly Gly Glu Gly Tyr Leu Asn Phe Met Gly Asn Glu Phe

645 650 655

Gly His Pro Glu Trp Ile Asp Phe Pro Arg Gly Pro Gln Thr Leu Pro

660 665 670

Thr Gly Lys Val Leu Pro Gly Asn Asn Asn Ser Tyr Asp Lys Cys Arg

675 680 685

Arg Arg Phe Asp Leu Gly Asp Ala Asp Phe Leu Arg Tyr Arg Gly Met

690 695 700

Gln Glu Phe Asp Gln Ala Met Gln His Leu Glu Glu Lys Tyr Gly Phe

705 710 715 720

Met Thr Ser Glu His Gln Tyr Val Ser Arg Lys His Glu Glu Asp Lys

725 730 735

Val Ile Ile Phe Glu Arg Gly Asp Leu Val Phe Val Phe Asn Phe His

740 745 750

Trp Ser Asn Ser Phe Phe Asp Tyr Arg Val Gly Cys Ser Lys Pro Gly

755 760 765

Lys Tyr Lys Val Ala Leu Asp Ser Asp Asp Ala Leu Phe Gly Gly Phe

770 775 780

Ser Arg Leu Asp His Asp Val Asp Tyr Phe Thr Thr Glu His Pro His

785 790 795 800

Asp Asn Arg Pro Arg Ser Phe Leu Val Tyr Thr Pro Ser Arg Thr Ala

805 810 815

Val Val Tyr Ala Leu Thr Glu

820

<210> 5

<211> 2472

<212> DNA

<213> Triticum aestivum

<400> 5

atggcgacgt tcgcggtgtc cggcgcgacc ctcggtgtgg cgcggcccgc cagcgccggc 60

ggcggactgc tgcgatccgg ctcggagcgg aggggcgggg tggacttgcc gtcgctgctc 120

ctcaggaaga aggactcctc tcgcgccgtc ctgagccgcg cggcctctcc agggaaggtc 180

ctggtgcctg acggtgagag cgacgacttg gcggccactc cagcgcaacc cgaagaatta 240

cagatacctg aagatatcga ggagcaaacg gctgaagtga acatgacagg ggggactgca 300

gagaaacttc aatattcaga accgactcag ggcattgtgg aaacaatcac tgatggtgta 360

accaaaggag ttaaggaact agtcgtgggg gagaaaccgc gagttgtccc aaaaccagga 420

gatgggcaga aaatatacga gattgaccca acgctgaaag attttcggag ccatcttgac 480

taccgataca gcgaatacaa gagaattcgt gctgctattg accaacatga aggtggattg 540

gaagcatttt ctcgtggtta tgaaaagctt ggatttaccc gcagtgctga aggtatcact 600

taccgagaat gggctcctgg agcgcattct gcagcattag taggtgactt caacaattgg 660

aatccaaatg cagatactat gaccagagat gattatggtg tttgggagat cttcctccct 720

aacaatgctg atggatcccc agctattcct catggctcac gtgtaaagat acggatggat 780

actccatctg gtgtgaagga ttcgatttct gcttggatca agttctctgt gcaggctcca 840

ggtgaaatac cattcaatgg catatattat gatccacctg aagaggagaa gtatgtcttc 900

caacatcctc aacctaaacg accagagtca ctaaggattt atgaatcaca cattggaatg 960

agcagcccgg aaccgaagat aaattcatat gctaatttta gggatggggt gctgccaaga 1020

attaaaaggc ttggatacaa tgcagtgcag ataatggcaa tccaggagca ttcatactat 1080

gcaagctttg ggtaccatgt tactaatttt tttgcaccaa gtagccgttt tggaactcca 1140

gaggacttaa aatccttgat cgatagagca catgagcttg gtttgcttgt tcttatggat 1200

attgttcata gtcattcgtc aaataatacc cttgacggtt tgaatggttt cgatggcact 1260

gatacacatt acttccacgg tggtccacgt ggccatcatt ggatgtggga ttctcgtctg 1320

ttcaactatg ggagttggga agtattaaga ttcttactgt caaacgcgag atggtggctt 1380

gaagaatata agtttgatgg atttcgattt gatggggtga cctccatgat gtatactcac 1440

catggattac aaatgacatt tactgggaac tatggcgagt attttggatt tgccactgat 1500

gttgatgcgg tggtatactt aatgctggtc aacgatctaa ttcatggact ttatcctgat 1560

gctgtatcca ttggtgaaga tgtcagtgga atgcctacat tttgcatccc tgttccagat 1620

ggtggtgttg gttttgacta tcgcctgcat atggctgtag cagataaatg gatcgaactc 1680

ctcaagcaaa gtgacgaatc ttggaaaatg ggtgatattg tgcacaccct aacaaataga 1740

aggtggcttg agaagtgcgt cacttatgca gaaagtcatg atcaagcact agttggtgac 1800

aagactattg cattctggtt gatggataag gatatgtatg atttcatggc tctggataga 1860

ccttcaactc ctcgcattga tcgtggcata gcattacata aaatgatcag gcttgtcacc 1920

atgggtttag gtggcgaagg ctatcttaac ttcatgggaa atgagtttgg gcatcctgaa 1980

tggatagatt ttccaagagg tccgcaaact cttccaaccg gcaaagttct ccctggaaat 2040

aacaatagtt atgataaatg ccgccgtaga tttgatcttg gagatgcaga ttttcttaga 2100

tatcgtggta tgcaagagtt cgaccaggca atgcagcatc ttgaggaaaa atatgggttt 2160

atgacatctg agcaccagta tgtttcacgg aaacatgagg aagataaggt gatcatcttc 2220

gaaagaggag atttggtatt tgttttcaac ttccactgga gcaatagctt ttttgactac 2280

cgtgttgggt gttccaagcc tgggaagtac aaggtggcct tagactccga cgatgcactc 2340

tttggtggat tcagcaggct tgatcatgat gtcgactact tcacaaccga acatccgcat 2400

gacaataggc cgcgctcttt cttggtgtac actcctagca gaactgcggt cgtgtatgcc 2460

cttacagagt aa 2472

<210> 6

<211> 819

<212> PRT

<213> Triticum aestivum

<400> 6

Met Ala Thr Phe Ala Val Ser Gly Ala Thr Leu Gly Val Ala Arg Ala

1 5 10 15

Gly Val Gly Val Ala Arg Ala Gly Ser Glu Arg Arg Gly Gly Ala Asp

20 25 30

Leu Pro Ser Leu Leu Leu Arg Lys Lys Asp Ser Ser Arg Ala Val Leu

35 40 45

Ser Arg Ala Ala Ser Pro Gly Lys Val Leu Val Pro Asp Gly Glu Ser

50 55 60

Asp Asp Leu Ala Ser Pro Ala Gln Pro Glu Glu Leu Gln Ile Pro Glu

65 70 75 80

Asp Ile Glu Glu Gln Thr Ala Glu Val Asn Met Thr Gly Gly Thr Ala

85 90 95

Glu Lys Leu Gln Ser Ser Glu Pro Thr Gln Gly Ile Val Glu Thr Ile

100 105 110

Thr Asp Gly Val Thr Lys Gly Val Lys Glu Leu Val Val Gly Glu Lys

115 120 125

Pro Arg Val Val Pro Lys Pro Gly Asp Gly Gln Lys Ile Tyr Glu Ile

130 135 140

Asp Pro Thr Leu Lys Asp Phe Arg Ser His Leu Asp Tyr Arg Tyr Ser

145 150 155 160

Glu Tyr Lys Arg Ile Arg Ala Ala Ile Asp Gln His Glu Gly Gly Leu

165 170 175

Glu Ala Phe Ser Arg Gly Tyr Glu Lys Leu Gly Phe Thr Arg Ser Ala

180 185 190

Glu Gly Ile Thr Tyr Arg Glu Trp Ala Pro Gly Ala His Ser Ala Ala

195 200 205

Leu Val Gly Asp Phe Asn Asn Trp Asn Pro Asn Ala Asp Thr Met Thr

210 215 220

Arg Asp Asp Tyr Gly Val Trp Glu Ile Phe Leu Pro Asn Asn Ala Asp

225 230 235 240

Gly Ser Ser Ala Ile Pro His Gly Ser Arg Val Lys Ile Arg Met Asp

245 250 255

Thr Pro Ser Gly Val Lys Asp Ser Ile Ser Ala Trp Ile Lys Phe Ser

260 265 270

Val Gln Ala Pro Gly Glu Ile Pro Phe Asn Gly Ile Tyr Tyr Asp Pro

275 280 285

Pro Glu Glu Glu Lys Tyr Val Phe Gln His Pro Gln Arg Lys Arg Pro

290 295 300

Glu Ser Leu Arg Ile Tyr Glu Ser His Ile Gly Met Ser Ser Pro Glu

305 310 315 320

Pro Lys Ile Asn Ser Tyr Ala Asn Phe Arg Asp Glu Val Leu Pro Arg

325 330 335

Ile Lys Arg Leu Gly Tyr Asn Ala Val Gln Ile Met Ala Ile Gln Glu

340 345 350

His Ser Tyr Tyr Ala Ser Phe Gly Tyr His Val Thr Asn Phe Phe Ala

355 360 365

Pro Ser Ser Arg Phe Gly Thr Pro Glu Asp Leu Lys Ser Leu Ile Asp

370 375 380

Arg Ala His Glu Leu Gly Leu Leu Val Leu Met Asp Ile Val His Ser

385 390 395 400

His Ser Ser Asn Asn Thr Leu Asp Gly Leu Asn Gly Phe Asp Gly Thr

405 410 415

Asp Thr His Tyr Phe His Gly Gly Pro Arg Gly His His Trp Met Trp

420 425 430

Asp Ser Arg Leu Phe Asn Tyr Gly Ser Trp Glu Val Leu Arg Phe Leu

435 440 445

Leu Ser Asn Ala Arg Trp Trp Leu Glu Glu Tyr Lys Phe Asp Gly Phe

450 455 460

Arg Phe Asp Gly Val Thr Ser Met Met Tyr Thr His His Gly Leu Gln

465 470 475 480

Met Thr Phe Thr Gly Asn Tyr Gly Glu Tyr Phe Gly Phe Ala Thr Asp

485 490 495

Val Asp Ala Val Val Tyr Leu Met Leu Val Asn Asp Leu Ile His Gly

500 505 510

Leu Tyr Pro Asp Ala Val Ser Ile Gly Glu Asp Val Ser Gly Met Pro

515 520 525

Thr Phe Cys Ile Pro Val Pro Asp Gly Gly Val Gly Phe Asp Tyr Arg

530 535 540

Leu His Met Ala Val Ala Asp Lys Trp Ile Glu Leu Leu Lys Gln Ser

545 550 555 560

Asp Glu Ser Trp Lys Met Gly Asp Ile Val His Thr Leu Thr Asn Arg

565 570 575

Arg Trp Leu Glu Lys Cys Val Thr Tyr Ala Glu Ser His Asp Gln Ala

580 585 590

Leu Val Gly Asp Lys Thr Ile Ala Phe Trp Leu Met Asp Lys Asp Met

595 600 605

Tyr Asp Phe Met Ala Leu Asp Arg Pro Ser Thr Leu Arg Ile Asp Arg

610 615 620

Gly Ile Ala Leu His Lys Met Ile Arg Leu Val Thr Met Gly Leu Gly

625 630 635 640

Gly Glu Gly Tyr Leu Asn Phe Met Gly Asn Glu Phe Gly His Pro Glu

645 650 655

Trp Ile Asp Phe Pro Arg Gly Pro Gln Thr Leu Pro Thr Gly Lys Val

660 665 670

Leu Pro Gly Asn Asn Asn Ser Tyr Asp Lys Cys Arg Arg Arg Phe Asp

675 680 685

Leu Gly Asp Ala Asp Phe Leu Arg Tyr Arg Gly Met Gln Glu Phe Asp

690 695 700

Gln Ala Met Gln His Leu Glu Glu Lys Tyr Gly Phe Met Thr Ser Glu

705 710 715 720

His Gln Tyr Val Ser Arg Lys His Glu Glu Asp Lys Val Ile Ile Leu

725 730 735

Lys Arg Gly Asp Leu Val Phe Val Phe Asn Phe His Trp Ser Asn Ser

740 745 750

Phe Phe Asp Tyr Arg Val Gly Cys Ser Lys Pro Gly Lys Tyr Lys Val

755 760 765

Ala Leu Asp Ser Asp Asp Ala Leu Phe Gly Gly Phe Ser Arg Leu Asp

770 775 780

His Asp Val Asp Tyr Phe Thr Thr Glu His Pro His Asp Asn Arg Pro

785 790 795 800

Arg Ser Phe Ser Val Tyr Thr Pro Ser Arg Thr Ala Val Val Tyr Ala

805 810 815

Leu Thr Glu

<210> 7

<211> 2460

<212> DNA

<213> Triticum aestivum

<400> 7

atggcgacgt tcgcggtgtc cggcgcgact ctcggtgtgg cgcgggccgg cgtcggagtg 60

gcgcgggccg gctcggagcg gaggggcggg gcggacttgc cgtcgctgct cctcaggaag 120

aaggactcct ctcgcgccgt cctgagccgc gcggcctctc cagggaaggt cctggtgcct 180

gacggcgaga gcgacgactt ggcaagtccg gcgcaacctg aagaattaca gatacctgaa 240

gatatcgagg agcaaacggc ggaagtgaac atgacagggg ggactgcaga gaaacttcaa 300

tcttcagaac cgactcaggg cattgtggaa acaatcactg atggtgtaac caaaggagtt 360

aaggaactag tcgtggggga gaaaccgcga gttgtcccaa aaccaggaga tgggcagaaa 420

atatacgaga ttgacccaac actgaaagat tttcggagcc atcttgacta ccgatacagc 480

gaatacaaga gaattcgtgc tgctattgac caacatgaag gtggattgga agcattttct 540

cgtggttatg aaaagcttgg atttacccgc agtgctgaag gtatcactta ccgagaatgg 600

gctcctggag cgcattctgc agcattagta ggtgacttca acaattggaa tccaaatgca 660

gatactatga ccagagatga ttatggtgtt tgggagattt tcctccctaa caacgctgat 720

ggatcctcag ctattcctca tggctcacgt gtaaagatac ggatggatac tccatccggt 780

gtgaaggatt caatttctgc ttggatcaag ttctctgtgc aggctccagg tgaaatacct 840

ttcaatggca tatattatga tccacctgaa gaggagaagt atgtcttcca acatcctcaa 900

cgtaaacgac cagagtcact aaggatttat gaatcacaca ttggaatgag cagcccggaa 960

ccgaagataa attcatatgc taattttagg gatgaggtgt tgccaagaat taaaaggctt 1020

ggatacaatg cagtgcagat aatggcaatc caggagcatt catactatgc aagctttggg 1080

taccatgtta ctaatttttt tgcaccaagt agccgttttg gaactccaga ggacttaaaa 1140

tccttgatcg atagagcaca tgagcttggt ttgcttgttc ttatggatat tgttcatagt 1200

cattcgtcaa ataataccct tgacggtttg aatggtttcg atggcactga tacacattac 1260

ttccacggtg gtccacgcgg ccatcattgg atgtgggatt ctcgtctatt caactatggg 1320

agttgggaag tattgagatt cttactgtca aacgcgagat ggtggcttga agaatataag 1380

tttgatggat ttcgatttga tggggtgacc tccatgatgt atactcacca tggattacaa 1440

atgacattta ctgggaacta tggcgaatat tttggatttg ctactgatgt tgatgcggta 1500

gtttacttga tgctggtcaa cgatctaatt catggacttt atcctgatgc tgtatccatt 1560

ggtgaagatg tcagtggaat gcctacattt tgcatccctg ttccagatgg tggtgttggt 1620

tttgactacc gcctgcatat ggctgtagca gataaatgga ttgaactcct caagcaaagt 1680

gacgaatctt ggaaaatggg cgatattgtg cacaccctaa caaatagaag gtggcttgag 1740

aagtgtgtaa cttatgcaga aagtcatgat caagcactag ttggtgacaa gactattgca 1800

ttctggttga tggataagga tatgtatgat ttcatggctc tggataggcc ttcaactctt 1860

cgcattgatc gtggcatagc attacataaa atgatcaggc ttgtcaccat gggtttaggt 1920

ggtgaaggct atcttaactt catgggaaat gagtttgggc atcctgaatg gatagatttt 1980

ccaagaggcc cacaaactct tccaaccggc aaagttctcc ctggaaataa caatagttat 2040

gataaatgcc gccgtagatt tgatcttgga gatgcagatt ttcttagata tcgtggtatg 2100

caagagttcg atcaggcaat gcagcatctt gaggaaaaat atgggtttat gacatctgag 2160

caccagtatg tttcacggaa acatgaggaa gataaggtga tcatcctcaa aagaggagat 2220

ttggtatttg ttttcaactt ccactggagc aatagctttt ttgactaccg tgttgggtgt 2280

tccaagcctg ggaagtacaa ggtggccttg gactctgacg atgcactctt tggtggattc 2340

agcaggcttg atcatgatgt cgactacttc acaaccgaac atccgcatga caacaggccg 2400

cgctctttct cggtgtacac tccgagcaga actgcggtcg tgtatgccct tacagagtaa 2460

<210> 8

<211> 420

<212> DNA

<213> Triticum aestivum

<400> 8

ctcgctccaa tctccccgtc catttttgcc ccccttctct ctccctatct gcgcgcgcat 60

ggcctgttcg atgctgttcc ccagttgatc tccatcaacg agagagatag ctggattagg 120

cgatcgcctg cgtcagtgtc acccaggccc tggtgttatc acggctttga tcatctcctc 180

ccattctgat attttctcac tctttcttct gttcttgctg taactgcaag ttgtagcatt 240

gtctcactat tgtagtcatc cttgcattgc aggcgccgtc ctgagccgcg cggcctctcc 300

agggaaggtc ctggtgcctg acggtgagag cgacgacttg gcaagtccgg cgcaacctga 360

agaattacag gtacacacca tcgtgccggg aaatcttcat acaatcgtta ttcacttacc 420

<210> 9

<211> 441

<212> DNA

<213> Triticum aestivum

<400> 9

tctccccgtc tgtttttggg cccccttctc tctccctcgc ctctctgcgc gcgcatggcc 60

tgttcgatgc tgttccccag ttgatctcca tgaacgagag agatagctgg attaggcgat 120

cgcctcaggc cctggtgtta ccacggcttt gatcatctcc tcctttcatg ctgatatttt 180

ctcactcttt cttctgttct tgctgtaact gcaagttgta gcattttttt ggcgaataag 240

ttgtagcatt gtctcactat tgtactcatc cttgcatttg caggcgccgt cctgagccgc 300

gcggcctctc cagggaaggt cctggtgcct gacggtgaga gcgacgactt ggcggccact 360

ccagcgcaac ccgaagaatt acaggtacac accgtcgtgc cggaaaatct tcatgcaccc 420

gttattcact taccaaatat c 441

<210> 10

<211> 496

<212> DNA

<213> Triticum aestivum

<400> 10

ctcgaatctc ccccgtctgg ctttggctcc ccttctctct cctctgcgcg cgcatggcct 60

gttcgatgct gttccccaat tgatctccat gagtgagaga gatagctgga ttaggcgatc 120

gcgcttcctg aacctgtatt ttttcccccg cggggaaatg cgttagtgtc acccaggccc 180

tggtgttacc acggctttga tcattcctcg tttcattctg atatatattt tctcattctt 240

tttcttcctg ttcttgctgt aactgcaagt tgtggcgttt tttcactatt gtagtcatcc 300

ttgcattttg caggcgccgt cctgagccgc gcggcctctc cagggaaggt cctggtgcct 360

gacggcgaga gcgacgactt ggcaagtccg gcgcaacctg aagaattaca ggtacacaca 420

ctcgtgccgg taaatcttca tacaatcgtt attcacttac caaatgccgg atgaaaccaa 480

ccacggatgc gtcagg 496

Claims (4)

1. A method of increasing the resistant starch content and/or amylose content and/or total pentosan content in wheat seeds comprising the steps of: reducing the abundance of SBEIIa protein in wheat by gene editing of the SBEIIa gene;

the gene editing is realized by means of a CRISPR/Cas9 system;

in the CRISPR/Cas9 system, the target sequences of sgrnas are as follows: tcctgagccgcgcggcctct, respectively; alternatively, in the CRISPR/Cas9 system, the target sequences of sgrnas are as follows: gggaaggtcctggtgcctga are provided.

2. A specific sgRNA or a specific recombinant plasmid;

the specific sgRNA is sgRNA1 or sgRNA 2;

the target sequences of sgRNA1 are as follows: tcctgagccgcgcggcctct, respectively;

the target sequences of sgRNA2 are as follows: gggaaggtcctggtgcctga, respectively;

the specific recombinant plasmid is pCXUN-Cas9-gRNA1 or pCXUN-Cas9-gRNA 2;

pCXUN-Cas9-gRNA1 contains a gene encoding a Cas9 protein and a gene encoding the sgRNA 1;

pCXUN-Cas9-gRNA2 contains the gene encoding the Cas9 protein and the gene encoding the sgRNA 2.

3. A method of preparing gene-edited wheat comprising the steps of: introducing the coding gene of the specific sgRNA of claim 2 and the coding gene of the Cas9 protein into recipient wheat to obtain transgenic wheat; then selfing the transgenic wheat to obtain selfed progeny; then screening the genetic editing wheat from the selfing progeny; the content of resistant starch and/or amylose and/or total pentosan in the wheat seeds edited by the gene is higher than that of the receptor wheat.

4. Use of a specific sgRNA according to claim 2 or a specific recombinant plasmid according to claim 2 in wheat breeding; the aim of the wheat breeding is to increase the resistant starch content and/or the amylose content and/or the total pentosan content in wheat seeds.

Images