CN110790832A - Method for improving wheat processing quality - Google Patents

Abstract

The invention discloses a method for improving the processing quality of wheat. The invention adopts a large primer PCR mutation technology to carry out site-directed mutagenesis on the wheat 1Dx2 gene to obtain a single-site mutation gene 1Dx2m2, and the single-site mutation gene is introduced into a 1Dx2 subunit deletion mutant of a wheat fine variety Kenong 199 to obtain a stable transgenic line TL1Dx2m 2. Quality analysis experiments prove that the mutant high molecular weight glutenin subunit 1Dx2m2 can obviously improve the processing quality of wheat flour. The invention improves the processing quality of wheat by site-directed mutagenesis of HMW-GS gene 1Dx2 and a transgenic method, fills the blank of improving the processing quality of wheat by using the site-directed mutagenesis gene at home and abroad, and opens up a new way for improving the processing quality of wheat.

Description

Method for improving wheat processing quality

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for improving the processing quality of wheat.

Background

Common wheat (Triticum aestivum l., AABBDD, 2n ═ 6x ═ 42) belongs to the gramineous (Poaceae) wheat (Triticum) genus, and is the most important food crop for human beings. Because the wheat dough has unique elasticity and ductility, the wheat dough can be processed into various foods such as bread, biscuits, noodles, steamed bread, dumplings, fried bread sticks and the like through the processes of baking, cooking, frying and the like. The quality of the food is closely related to the quality of the wheat. Wheat quality refers to the degree to which a wheat variety adapts and meets a particular end use and can be divided into nutritional quality and processing quality. The nutritional quality refers to the degree of satisfaction of nutritional ingredients contained in wheat to human (livestock) nutritional needs, including the amount of nutritional ingredients, whether the nutritional ingredients are balanced, the content of protein, the composition of amino acids, and the like. The processing quality is divided into primary processing quality and secondary processing quality. The quality of primary processing is also called grinding quality, and mainly comprises flour yield, flour color, ash content and the like. The secondary processing quality, also called eating quality, refers to the degree of adaptation and satisfaction of wheat flour to the preparation of different foods, and is mainly related to the physicochemical properties of the dough. The edible quality parameters are many and mainly comprise gluten content, sedimentation value, forming time, stabilizing time, resistance to elongation, stretching area and specific indexes aiming at various baked, steamed and fried wheaten foods.

Currently, the quality improvement of wheat is mainly focused on the processing quality, and is also mainly focused on the baking quality of industrially processed bread, biscuits, cakes and the like, and the baking quality mainly depends on the gluten content and quality of flour. After the flour is mixed with water and subjected to a suitable kneading, a dough is formed, the dough is washed with a suitable concentration of weak saline water to remove bran, starch and proteins dissolved in water or dilute salt, and the remaining material having a viscoelastic network structure is called gluten (gluten), which consists of glutenin and gliadin. The properties of gluten determine the rheological properties of the dough and thus the food processing quality of the wheat variety. In many studies, gluten strength is often used to describe the food processing quality of wheat, and wheat can be classified into strong gluten wheat, medium gluten wheat and weak gluten wheat according to the strength of gluten. The method for measuring and identifying the quality of wheat mainly comprises physicochemical detection (including using various special instruments and analysis methods) and food processing detection (including baking, cooking and the like). The main indexes for measuring the processing quality of the wheat flour comprise gluten content, sedimentation value, water absorption, forming time, stabilization time, resistance to elongation, stretching area, swelling index, various kneading and mixing instrument parameters and the like.

SDS-sedimentation value (SDS-SV) is a comprehensive index reflecting wheat gluten content and quality, and is deeply valued by wheat quality breeding workers. The principle is that a certain amount of wheat flour absorbs water to expand under the action of weak acid medium to form floccule and slowly precipitate, and the sedimentation speed and volume reflect the content and quality of gluten. The sedimentation volume in the specified standard time is the sedimentation value, and is taken as the unit of ml. The larger the measured value, the higher the gluten content, the higher the gluten strength, and the better the baking quality of the flour. The Swelling Index (SIG) of glutenin is an important index for wheat quality evaluation, and is in obvious positive correlation with the SDS-sedimentation value. SIG indirectly reflects the content and quality of glutenin based on the swelling capacity of glutenin at different swelling times. SIG measurement has the characteristics of rapidness, simplicity, convenience, small sample consumption and the like, and is often used for quality detection of early-generation materials in wheat quality breeding.

The Farinograph (Farinograph) is one of the most widely used wheat quality detection instruments, and can be used for quality detection and quality control of wheat grains or flour in the processes of wheat breeding, storage, flour processing, food production and the like. The flour quality instrument is used for kneading by adding a proper amount of water into quantitative wheat flour, and a coordinate graph of the change of stirring resistance along with time, namely a flour quality curve, is drawn by computer software. And calculating the quality characteristic parameters of the flour according to the water adding amount and the flour quality curve so as to evaluate the strength of the gluten of the flour. The main parameters measured by the flour quality meter are Water Absorption (WA), dough formation time (DT), dough Stability Time (ST), degree of weakness (DS), and Flour Quality Number (FQN). WA is affected by factors such as protein content and starch granule breakage rate in wheat flour, and the higher the protein content and starch granule breakage rate, the higher the water absorption rate. DT and ST reflect the stability and degree of dough resistance. The longer DT and ST of the dough, indicating greater gluten strength, generally better bake processing characteristics. DS represents the rate of dough breakdown during mixing, reflecting the strength of the gluten. The larger the DS, the weaker the gluten, the more rheological the dough, the less processable and the less good the baking quality. FQN is an important index reflecting rheological characteristics of dough, and has a close relation with gluten strength, the FQN of strong gluten flour is higher, and the FQN of weak gluten flour is lower.

The mixer (mixogrph) is an important instrument for measuring the quality of wheat processing by measuring the change in rheological properties during the stirring of the dough. In the continuous kneading process of the dough, the kneading instrument measures and records the kneading resistance of the dough and draws a kneading curve map to provide the optimal kneading time, stirring endurance, rheological characteristics of other dough, baking estimated water absorption value and other indexes of the dough. The kneading and mixing instrument has the advantages of high detection speed, small flour consumption, high correlation with baking characteristics and the like, and has good guiding function on wheat quality improvement, wheat quality chemical research and development of special flour and flour products. Among the parameters obtained by the kneading apparatus, the Middle Peak Time (MPT) is a very important parameter. Generally, it is considered that the MPT has high correlation with the kneading time of actual and experimental baking and is an important prediction index of bread quality. The midline peak height (MPV) is related to the extensibility of the dough and the toasted volume of the bread, the Midline Peak Width (MPW) is related to the stretch resistance of the dough, and the midline peak area (MPI) is significantly related to the maximum stretch resistance of the dough, the stretch area, and the toasted volume. The fade resistance value (RBD) is related to the kneading resistance of the dough, with the greater the RBD, the weaker the strength of the dough and the poorer the kneading resistance.

Disclosure of Invention

The first object of the present invention is to provide a protein obtained by mutating tyrosine at position 722 of the amino acid sequence of 1Dx2 protein to cysteine, which is designated as 1Dx2m2 protein.

The 1Dx2 protein is a protein shown in a) or b) as follows:

a) the amino acid sequence is a protein shown in a sequence 4;

b) and (b) a fusion protein obtained by connecting a tag to the N-terminal and/or the C-terminal of the protein shown in the sequence 4.

The 1Dx2m2 protein is a protein shown in the following c) or d):

c) the amino acid sequence is a protein shown in a sequence 8;

d) and (b) a fusion protein obtained by connecting a tag to the N-terminal and/or the C-terminal of the protein shown in the sequence 8.

In the above protein, the tag is a polypeptide or protein that is expressed by fusion with a target protein using in vitro recombinant DNA technology, so as to facilitate expression, detection, tracking and/or purification of the target protein. The tag may be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag, and/or a SUMO tag, among others.

It is a second object of the present invention to provide a biomaterial related to the 1Dx2m2 protein.

The biomaterial is any one of the following A1) to A8):

A1) a nucleic acid molecule encoding a 1Dx2m2 protein;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

In the above biological material, the nucleic acid molecule of A1) is a gene represented by the following 1) or 2) or 3):

1) the coding sequence is a cDNA molecule or a DNA molecule shown in a sequence 7;

2) a cDNA molecule or a genome DNA molecule which has 95 percent or more than 95 percent of identity with the nucleotide sequence defined by 1) and codes 1Dx2m2 protein;

3) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence limited by 1) or 2) under strict conditions and codes for 1Dx2m2 protein.

The nucleotide sequence of the present invention encoding 1Dx2m2 can be easily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which have been artificially modified to have 75% or more identity to the nucleotide sequence encoding 1Dx2m2 are derived from and identical to the nucleotide sequence of the present invention as long as they encode 1Dx2m2 and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes nucleotide sequences that are 75% or more, or 85% or more, or 90% or more, or 95% or more identical to the nucleotide sequence of a protein consisting of the amino acid sequence shown in coding sequence 8 of the present invention. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed in percent (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

In the above biological material, the stringent conditions are hybridization and membrane washing at 68 ℃ for 2 times, 5min each, in a solution of 2 XSSC, 0.1% SDS, and hybridization and membrane washing at 68 ℃ for 2 times, 15min each, in a solution of 0.5 XSSC, 0.1% SDS; alternatively, hybridization was carried out at 65 ℃ in a solution of 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS, and the membrane was washed.

In the above biological material, the vector may be a plasmid, a cosmid, a phage, or a viral vector. The recombinant vector can be specifically a recombinant vector p1Bx14PRO-1Dx2m 2.

In the above biological material, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium.

The third purpose of the invention is to provide a new application of the 1Dx2m2 protein or biological material.

The invention provides an application of the 1Dx2m2 protein or the biological material in any one of the following B1) -B10):

B1) regulating and controlling the processing quality of the wheat flour;

B2) regulating and controlling the baking quality of the wheat flour;

B3) regulating and controlling the gluten property and/or gluten strength and/or gluten quality of the wheat flour;

B4) regulating the dough rheological property and/or the extensibility and/or the stretch resistance and/or the kneading resistance of the wheat flour;

B5) regulating and controlling the SDS-sedimentation value of the wheat flour;

B6) regulating and controlling the glutenin swelling index of the wheat flour;

B7) regulating and controlling the water absorption and/or the dough forming time and/or the dough stabilizing time and/or the weakening degree in the flour quality instrument detection parameters of the wheat flour;

B8) regulating and controlling peak time and/or peak area and/or anti-fading value in the parameters of the kneading and mixing instrument of the wheat flour;

B9) cultivating transgenic wheat with improved flour processing quality and/or baking quality and/or gluten quality;

B10) and (5) wheat breeding.

In the application, the regulation and control of the processing quality of the wheat flour is specifically to improve the processing quality of the wheat flour;

the method is characterized in that the baking quality of the wheat flour is regulated and controlled, and specifically the baking quality of the wheat flour is improved;

the gluten property and/or the gluten strength and/or the gluten quality of the wheat flour are regulated and controlled, and specifically the gluten property of the wheat flour is improved and/or the gluten strength of the wheat flour is improved and/or the gluten quality of the wheat flour is improved;

the dough rheological property and/or the extensibility and/or the stretch resistance and/or the kneading resistance of the wheat flour are/is regulated, and particularly the dough rheological property and/or the extensibility and/or the stretch resistance and/or the kneading resistance of the wheat flour are improved;

the SDS-sedimentation value of the wheat flour is specifically adjusted and controlled to be improved;

the glutenin swelling index of the wheat flour is regulated and controlled, and is specifically the glutenin swelling index of the wheat flour is improved;

the method for regulating and controlling the water absorption and/or the dough forming time and/or the dough stabilizing time and/or the weakening degree in the flour quality instrument detection parameters of the wheat flour is to specifically improve the water absorption in the flour quality instrument detection parameters of the wheat flour and/or improve the dough forming time in the flour quality instrument detection parameters of the wheat flour and/or improve the dough stabilizing time in the flour quality instrument detection parameters of the wheat flour and/or reduce the weakening degree in the flour quality instrument detection parameters of the wheat flour;

the peak time and/or the peak area and/or the anti-fading value in the detection parameters of the kneading and mixing instrument for regulating and controlling the wheat flour are/is specifically to improve the peak time in the detection parameters of the kneading and mixing instrument for regulating and controlling the wheat flour and/or improve the peak area in the detection parameters of the kneading and mixing instrument for regulating and controlling the wheat flour and/or reduce the anti-fading value in the detection parameters of the kneading and mixing instrument for regulating and controlling the wheat flour;

the aim of the wheat breeding is to improve the processing quality and/or baking quality and/or gluten quality of wheat flour.

A fourth object of the present invention is to provide a method for breeding transgenic wheat having improved flour processing quality and/or baking quality and/or gluten quality.

The method for cultivating the transgenic wheat with improved flour processing quality and/or baking quality and/or gluten quality comprises the steps of improving the content and/or activity of 1Dx2m2 protein in receptor wheat to obtain transgenic wheat; the transgenic wheat has a higher flour processing quality and/or baking quality and/or gluten quality than the recipient wheat.

In the above method, the transgenic wheat has higher flour processing quality than the recipient wheat as embodied in any one of C1) -C9):

C1) the SDS-sedimentation value of the transgenic wheat flour is higher than that of receptor wheat;

C2) the swelling index of glutenin of the transgenic wheat flour is higher than that of receptor wheat;

C3) the water absorption rate in the detection parameters of the flour quality instrument of the transgenic wheat flour is higher than that of receptor wheat;

C4) the dough forming time in the flour quality instrument detection parameters of the transgenic wheat flour is longer than that of receptor wheat;

C5) the dough stability time in the flour quality instrument detection parameters of the transgenic wheat flour is longer than that of receptor wheat;

C6) the attenuation degree of the detection parameters of the flour quality instrument of the transgenic wheat flour is lower than that of receptor wheat;

C7) the peak time in the detection parameters of the kneading and mixing instrument of the transgenic wheat flour is higher than that of receptor wheat;

C8) the peak value area in the detection parameters of the kneading and mixing instrument of the transgenic wheat flour is higher than that of receptor wheat;

C9) the anti-fading value of the parameters detected by the kneading and mixing instrument of the transgenic wheat flour is lower than that of receptor wheat.

Further, the method for improving the content and/or activity of the 1Dx2m2 protein in the receptor wheat is to over-express the 1Dx2m2 protein in the receptor wheat.

Furthermore, the method for over-expressing the 1Dx2m2 protein in the recipient wheat is to introduce a coding gene of the 1Dx2m2 protein into the recipient wheat. The nucleotide sequence of the coding gene of the 1Dx2m2 protein is specifically shown as a DNA molecule shown as a sequence 7.

In a specific embodiment of the invention, the gene encoding the 1Dx2m2 protein is introduced into recipient wheat through a recombinant vector p1Bx14PRO-1Dx2m 2. The recombinant vector p1Bx14PRO-1Dx2m2 is a vector obtained by replacing a sequence 13 in a sequence table with a vector pUBI, wherein the DNA fragment is positioned between the Pst I and Kpn I enzyme cutting sites of cas, and other sequence structures are kept unchanged.

In the above method, the transgenic plant is understood to include not only the first generation transgenic plant obtained by transforming the 1Dx2m2 gene into a plant of interest, but also its progeny. For transgenic plants, the gene can be propagated in the species, and can also be transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.

In the method, the receptor wheat is a 1Dx2 subunit deletion mutant (kn 2) of wheat elite Kenong 199^-Mutant). The kn2^-The mutant is a 1Dx2 deletion mutant obtained by deleting only 1Dx2 gene (sequence 3) in the genome sequence of the common wheat variety Kenong 199(KN 199).

The invention adopts a large primer PCR mutation technology to carry out site-directed mutagenesis on wheat 1Dx2 gene to obtain single-site mutant gene 1Dx2m2, the mutant gene 1Dx2m2 can be translated into mutant high molecular weight glutenin subunit 1Dx2m2 in vivo, and a gene gun mediated method is adopted to introduce the mutant gene 1Dx2m2 into a 1Dx2 subunit deletion mutant of good variety farmer 199 of wheat to obtain a stable transgenic line TL1Dx2m 2. Quality analysis experiments prove that the mutant high molecular weight glutenin subunit 1Dx2m2 can obviously improve the processing quality of wheat flour. The invention improves the processing quality of wheat by site-directed mutagenesis of HMW-GS gene 1Dx2 and a transgenic method, fills the blank of improving the processing quality of wheat by using the site-directed mutagenesis gene at home and abroad, and opens up a new way for improving the processing quality of wheat.

Drawings

FIG. 1 is an electrophoretogram of PCR amplification products of the full-length sequence of the coding region of 1Dx2 gene. Note: lane M is DNAmarker; the KN199 Lane is a product obtained by performing PCR amplification by using a specific primer combination Dx2F and Dx2R for amplifying the full-length sequence of the coding region of the 1Dx2 gene and taking the genome DNA of the common wheat variety Kenong 199 as a template, and the band marked by 1Dx2 is an amplified fragment of the full-length sequence of the coding region of the 1Dx2 gene.

FIG. 2 is a schematic diagram of the mutation site of 1Dx2m2 gene. Note: SP is a signal peptide sequence; NT is an N-terminal sequence; CRD is the middle repeat region; CT is C-terminal sequence; m2 is 1Dx2m2 gene site-directed mutation site, namely 2165 th base A is mutated into base G.

FIG. 3 is a schematic diagram of the process for obtaining mutant gene 1Dx2m 2. Note: a is the amplification of a site-directed mutagenesis large primer Dx2m2 FR; b is the amplification of the full-length sequence of the coding region of the 1Dx2m2 gene. Lane M is DNA marker; lane 1Dx2 shows PCR amplification products of the coding region of the 1Dx2 gene using primer combinations Dx2m2F and Dx2R (A) and Dx2m2FR and Dx2F (B), respectively, as templates.

FIG. 4 shows the general wheat variety Kenong 199 and its 1Dx2 subunit deletion line kn2^-SDS-PAGE profile of glutenin. Note: kn2^-1Dx2 subunit deletion line for konong 199; KN199 is wild type Kenong 199; the right side labeled 1Dx2 etc. are the corresponding subunits.

FIG. 5 shows the construction process of 1Dx2m2 gene transformation vector p1Bx14PRO-1Dx2m 2.

FIG. 6 is T₀PCR detection of generation 1Dx2m2 transgenic wheat plants. Note: m is DNA marker; + represents a positive plant; -represents a negative plant; kn is a transgenic receptor, namely 1Dx2 subunit deletion mutant kn2 of Kenong 199^-(ii) a KN is wild type Kenong 199; b is blank control. The 414bp band shown by an arrow is a target amplified fragment of the positive plant.

FIG. 7 is T₃SDS-PAGE detection of the generation 1Dx2m2 transgenic line HMW-GS. Note: kn2^-Is a transgenic receptor, namely a deletion mutant of 1Dx2 subunit of Kenong 199; KN199 is wild type Kenong 199; TL1Dx2m2 is a transgenic line of mutant gene 1Dx2m 2; TL1Dx2 is a 1Dx2 transgenic line.

FIG. 8 is a powdery mass map of the 1Dx2m2 transgenic line. Note: kn2^-Is a transgenic receptor, namely a deletion mutant of 1Dx2 subunit of Kenong 199; KN199 is wild type Kenong 199; TL1Dx2 is a 1Dx2 transgenic line; TL1Dx2m2 is a transgenic line for the mutant gene 1Dx2m 2.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The powder quality instrument (Farinograph-E) in the following examples is a product of Brabender, Ohgduisburg, Germany.

The kneading apparatus (mixogrph) in the following examples is a product of National company (National mfg.co., Lincoln, USA).

The vector pAHC20 containing the selection marker gene Bar in the following examples is a product of Pubaezin Biotechnology (Beijing) Ltd.

The general wheat cultivar kong 199 in the following examples was bred by Lijunming researcher of institute of genetics and developmental biology, national institute of sciences, and the cultivar was examined and approved: national scrutiny wheat 2006017.

Example 1 obtaining of wheat mutant Gene 1Dx2m2

1. PCR amplification of wheat 1Dx2 gene coding region full-length sequence

PCR amplification was performed using genomic DNA of Nongman 199 of the family Triticum aestivum variety as a template, using specific primer combinations Dx2F and Dx2R, PrimeSTAR HS DNA polymerase with high fidelity, and 2 XPrimeSTAR GC Buffer (Takara, Dalian). The resulting PCR-amplified fragment 1Dx2 (FIG. 1) was the full-length sequence of the coding region of 1Dx2 gene. The nucleotide sequences of the primer combination Dx2F and Dx2R are respectively sequence 1 and sequence 2 in a sequence table.

The PCR procedure for amplification of the full length sequence of the coding region of 1Dx2 was: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 deg.C for 30sec, renaturation at 72 deg.C and extension for 3min, and circulation for 38 times; finally, extension is carried out for 10min at 72 ℃.

2. Recovery and clone sequencing of 1Dx2 gene PCR amplification product

After the PCR amplification product was separated by 1% agarose gel electrophoresis, the gel fraction (FIG. 1) containing the target band 1Dx2 (about 2500bp) was cut under an ultraviolet lamp and placed in a 1.5ml centrifuge tube, and the amplified fragment 1Dx2 was recovered using an agarose gel recovery kit (Tiangen, Beijing). The recovered fragment was ligated to the Blunt-end cloning vector pEasy blast (all-trans gold, Beijing) and sequenced (Huada gene, Beijing). The sequencing result shows that the length of the cloned DNA fragment is 2523bp, and the nucleotide sequence is the sequence 3 in the sequence table, namely the full-length sequence of the coding region of the 1Dx2 gene. 1Dx2 is a gene without intron, and the coded 1Dx2 protein consists of 839 amino acid residues, and the amino acid sequence of the protein is the sequence 4 in the sequence table.

3. Obtaining of Single-base site-directed mutant Gene 1Dx2m2 of 1Dx2

The m2 site of 1Dx2 is subjected to site-directed mutagenesis by a large primer PCR method to obtain a single-site mutant gene 1Dx2m2, wherein the single-base mutation refers to the mutation of the 2165 th adenine (A) in the coding region sequence of the 1Dx2 gene into guanine (G). The mutation sites are schematically shown in FIG. 2. The specific operation steps are as follows:

(1) using the full-length sequence (sequence 3) of the coding region of 1Dx2 gene as a template, PCR amplification was performed using PrimeSTAR HS DNA polymerase, 2 × PrimeSTAR GC Buffer (precious bio, large ligation) and primer combination Dx2m2F and Dx2R primers for amplification primer sequence, resulting in an amplification product (fig. 3A). The nucleotide sequences of the primer combinations Dx2m2F and Dx2R are respectively sequence 1 and sequence 5 in the sequence table.

The PCR procedure for amplifying the large primer sequences was: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 30sec, annealing at 72 ℃ and extension for 1min for 30 cycles; extension at 72 ℃ for 10 min.

(2) After the PCR product is identified by 1% agarose gel electrophoresis, a large primer sequence containing a mutation site is obtained by recovery sequencing and is named as Dx2m2 FR. The size of the large primer fragment Dx2m2FR is 369bp, and the nucleotide sequence thereof is the sequence 6 in the sequence table.

(3) The full-length sequence (sequence 3) of the coding region of the 1Dx2 gene is used as a template, and a large primer combination Dx2FRm2 (sequence 6) and Dx2F (sequence 2) are used for PCR amplification to obtain a PCR product.

(4) And (4) separating, recovering, cloning and sequencing the PCR product obtained in the step (3) to obtain the full-length sequence of the coding region of the single-base mutant gene 1Dx2m2 of 1Dx 2. The total length of the coding region of 1Dx2m2 is 2523bp, and the nucleotide sequence is the sequence 7 in the sequence table. In fact, the coding region sequence of the 1Dx2m2 gene is a nucleotide sequence which changes the 2165 th base adenine (A) of the coding region sequence of the 1Dx2 gene shown in the sequence 3 in the sequence table into guanine (G) and keeps other sequences unchanged. The protein subunit coded by the mutant gene 1Dx2m2 is HMW-GS with single amino acid residue mutation, and is named as 1Dx2m 2. The mutant subunit 1Dx2m2 consists of 839 amino acid residues, and the amino acid sequence thereof is the sequence 8 in the sequence table. In fact, the amino acid sequence of the mutant subunit 1Dx2m2 is the amino acid sequence which is obtained by mutating the 722 th tyrosine residue (Tyr) of the 1Dx2 subunit shown in the sequence 4 into a cysteine residue (Cys) and keeping other sequences unchanged.

Example 2, 1Dx2m2 obtaining of transgenic wheat

1. Creation of transgenic recipient Material

The transgenic receptor material used by the invention is a high molecular weight glutenin subunit 1Dx2 deletion mutant of common wheat variety Kenong 199(KN199), which is marked as KN2^-。kn2^-Mutants were obtained by EMS mutagenesis. The specific process is as follows: (1) 1000 filled wild type farmer 199 seeds were selected and treated with 0.4% EMS (Sigma, M0880) in the dark for 24 hours and washed with running water for 24 hours, and the seeds were marked M₀；(2)M₀The seeds are planted in the Beijing Changping experiment base of the institute of genetics and development biology of Chinese academy of sciences after normal germination and vernalization treatment (4 ℃) for 4 weeks, normal field management is carried out, and the harvested seeds are recorded as M₁(ii) a From M by SDS-PAGE₁Screening out 1Dx2 subunit deletion mutant from seeds, and marking as kn2^-(FIG. 4); m₁Generation kn2^-The seeds are backcrossed and selfed for two successive generations to obtain enough M₃Generation seeds as the recipient material for genetic transformation of the mutant gene 1Dx2m 2. Sequencing verification shows that: kn2^-The mutant is obtained by mixing common wheat onlyThe 1Dx2 deletion mutant obtained after deletion of 1Dx2 gene (sequence 3) in the genome sequence of the variety Kenong 199(KN199) has the same sequence with the genome sequence of the common wheat variety Kenong 199(KN 199).

2. Construction of transformation vectors for mutant Gene 1Dx2m2 and wild-type Gene 1Dx2

The construction process of the 1Dx2m2 gene transformation vector is shown in FIG. 5. The specific operation steps are as follows:

(1) taking the genome DNA of common wheat variety Elytrigia tritici 54 as a template, utilizing primer combination Bx14proF and Bx14proR to carry out PCR amplification to obtain an 1147bp 1Bx14 promoter sequence, and simultaneously adding recognition sequences of PstI and BamH I restriction endonucleases at the upstream and downstream of the sequence respectively. The nucleotide sequences of the primer combination Bx14proF and Bx14proR are respectively a sequence 9 and a sequence 10 in a sequence table. The obtained 1Bx14 promoter sequence is the sequence 11 in the sequence table.

(2) And (2) inserting the 1Bx14 promoter sequence (sequence 11 in a sequence table) obtained in the step (1) into a vector pUBI: (sequence 12 in the sequence table) between Pst I and BamH I enzyme digestion sites of cas to replace the Ubiquitin promoter sequence, and keeping other sequences of the vector pUBI: (sequence 12 in the sequence table) unchanged to obtain an intermediate vector p1Bx14 PRO.

(3) The single base mutant gene 1Dx2m2 coding region sequence (sequence 7 in the sequence table) is inserted between BamH I and Kpn I enzyme cutting sites of intermediate vector p1Bx14PRO, namely connected to the downstream of 1Bx14 promoter sequence, and other sequences of intermediate vector p1Bx14PRO are kept unchanged, so that recombinant vector p1Bx14PRO-1Dx2m2 is obtained, namely the transformation vector of 1Dx2m2 gene.

(4) Sequencing verification is carried out on the transformation vector p1Bx14PRO-1Dx2m2 to ensure that the sequence inserted in the transformation vector p1Bx14PRO-1Dx2m2 is the correct sequence (sequence 13 in the sequence table) of the 1Bx14 promoter and the coding region of 1Dx2m 2. The transformation vector p1Bx14PRO-1Dx2m2 is a vector obtained by replacing the sequence 13 in the sequence table with the vector pUBI, wherein the DNA fragment is positioned between the Pst I and Kpn I enzyme cutting sites of cas, and other sequence structures are kept unchanged.

The construction process and operation procedure of the wild-type 1Dx2 gene transformation vector are the same as those of the mutant gene 1Dx2m2 transformation vector, except that the coding region sequence of the wild-type 1Dx2 (sequence 3 in the sequence table) is used to replace the coding region sequence of the mutant gene 1Dx2m2 (sequence 7 in the sequence table). The transformation vector was designated p1Bx14PRO-1Dx 2.

3. Genetic transformation of the 1Dx2m2 Gene

Genetic transformation was performed by the particle gun method. The transformation acceptor material is 1Dx2 subunit deletion mutation system kn2 of common wheat variety Kenong 199^-Young embryos about 14 days after flowering. Co-transforming the transformation vector p1Bx14PRO-1Dx2m2 with a vector pAHC20 containing a selection marker gene Bar to obtain T of the mutation-transferred gene 1Dx2m2₀And (5) plant generation. Genetic transformation is carried out on the genetic transformation platform of institute of genetics and developmental biology of the Chinese academy of sciences. The genetic transformation of the wild-type 1Dx2 gene was performed in the same manner as the genetic transformation of the mutant gene 1Dx2m2 except that the transformation vector was p1Bx14PRO-1Dx 2.

4. PCR identification and propagation of 1Dx2m2 gene transformant

T of transgenic 1Dx2m2 Using primer combination Dx2nosF and Dx2nosR₀Performing PCR identification on the generation plants by using a receptor kn2^-Is a negative control. If the PCR amplification product is a 414bp fragment (FIG. 6), the plant is a positive plant of the transmutant gene 1Dx2m2, and if the 414bp amplification fragment does not exist, the plant is a negative plant. The sequences of the primers Dx2nosF and Dx2nosR are respectively sequence 14 and sequence 15 in the sequence table. Identification of wild-type 1Dx2 Gene transformant T was detected by SDS-PAGE₀In the method for generating the glutenin subunit, a plant expressing the 1Dx2 subunit is a positive plant of the 1Dx2 gene, otherwise, the plant is a negative plant.

Planting T₀Generation 1Dx2m2 transgenic positive plants and individual harvesting of seeds. The T with stable HMW-GS expression is obtained by propagating 3 to 4 generations continuously and performing PCR identification on the exogenous gene by generations (figure 6) and SDS-PAGE identification on HMW-GS (figure 7)₃Generations (2016 years) or T₄The generation (2017) 1Dx2m2 transgenic homozygous line is used for processing quality trait determination. Meanwhile, the 1Dx2 transgenic line is propagated and identified by the same method as the 1Dx2m2 transgenic plant, and the transgenic receptor kn2 is propagated in parallel^-And seeds of wild type Kenong 199 used as transgenic line processing of mutant gene 1Dx2m2Quality analysis control.

Example 3, determination of processing quality traits of 1Dx2m2 transgenic lines and comparative analysis with recipient, wild type Kenong 199 and 1Dx2 transgenic lines

The invention provides a method for determining the T obtained in example 2 in 2016 and 2017, respectively₃Generation 1Dx2m2 transgenic line (hybrid line) TL1Dx2m2 and 2T₄The generation 1Dx2m2 transgenic lines TL1Dx2m2-1 and TL1Dx2m2-2 are subjected to processing quality trait determination, and are compared with the transgenic line TL1Dx2 and the transgenic receptor kn2 of the wild type gene 1Dx2^-Comparative analysis was performed with wild type Kenong 199. All assay samples were assigned 3 biological replicates. Data collection, processing and comparative analysis were performed using Excel (Microsoft, USA) software, One-way ANOVA (One-way ANOVA) and multiple comparisons using SPSS 19.0(IBM, USA) software, and multiple comparisons using the Duncon method in One-way ANOVA.

1. Determination of SDS-sedimentation values and comparative analysis

The SDS sedimentation value (SDS-SV) of the 1Dx2m2 transgenic line was determined in 2016 and 2017, respectively, according to the methods described in "Zhang L., Chen Q., Su M., Yan B., Zhang X., Jiano Z., high-molecular-weight genetic dilution with mutation induced by beam and effect factors of Glu-1 loci deletion on heat quality properties. J., Sci., FoodAgr.,2016,96: 1289-1296". The specific operation steps are as follows: weighing 1g flour (14% water content) in 35ml glass test tube with plug scale, adding 16.8ml bromophenol blue aqueous solution (4mg/L), and mixing by reverse rotation for 10-20 sec; placing the test tube on CAU-B sedimentation value analyzer (China university of agriculture), and shaking for 5min for 40 times/min; adding 16.8ml of SDS-lactic acid solution (2% SDS, 0.19% lactic acid), reversing, mixing, placing on a sedimentation value analyzer, and shaking for 5min for 40 times/min; and (5) reversing and mixing for 10-20sec, standing for 5min, and observing and recording sedimentation value results. In the experiment, a 1DX2 transgenic line TL1Dx2 and a transgenic receptor kn2 are respectively used^-Comparative analysis was performed against wild type Kenong 199.

The results of SDS-sedimentation of the transgenic lines 1Dx2m2 and their control material are shown in Table 1. As can be seen from table 1: in 2016, the SDS-sedimentation value of the transgenic line TL1Dx2m2 was significantly greater than 1Dx2 transgenic line TL1Dx2, transgenic receptor kn2^-And wild type Kenong 199(KN 199). The SDS-sedimentation value of two 1Dx2m2 transgenic lines TL1Dx2m2-1 and TL1Dx2m2-2 determined in 2017 is also obviously greater than that of a transgenic receptor kn2^-Wild type Kenong 199 and one of the 1Dx2 transgenic lines TL1Dx 2-12. While another 1Dx2 transgenic line, TL1Dx2-2, had significantly lower SDS-sedimentation values than the 1Dx2m2 transgenic line, TL1Dx2m2-2, but did not differ significantly from TL1Dx2m 2-1. The above results indicate that mutant subunit 1Dx2m2 can significantly increase the SDS-sedimentation value of flour compared to wild-type subunit 1Dx 2.

TABLE 1 SDS-sedimentation values of 1Dx2m2 transgenic lines

Note: (1) TL1Dx2m2 determined in 2016 as T₃Mixed samples of the 1Dx2m2 transgenic line of passage, TL1Dx2 sample was T₃Mixed samples of passage 1Dx2 transgenic line. TL1Dx2m2-1 and TL1Dx2m2-2 determined in 2017 are two T₄Generation 1Dx2m2 transgenic single line, TL1Dx2-2 and TL1Dx-12 are two T₄Generation 1Dx2 transgenic single line. (2) The data in the table are the average of 3 biological replicates, with different letters representing significant differences at the 0.05 level after the assay.

2. Measurement and comparative analysis of glutenin swelling index

The glutenin Swelling Index (SIG) of the 1Dx2m2 transgenic line was determined in 2016 and 2017, respectively, and likewise with the transgenic receptor kn2, according to the method described in the literature "Wang, C., and Kovacs, M.I.P.spinning index of glutenintest.II.application in prediction of dough properties and end-use quality. Central chem.J.2002,79:190-^-1Dx2 transgenic line TL1Dx2 and wild type Kenong 199 were controls. The specific operation steps are as follows: (1) 50ml centrifuge tubes were weighed one by one and recorded as M0. To each tube was added 1.0g of flour of the sample to be tested and weighed as M1. (2) 15ml of distilled water was added to the centrifuge tube, vortexed for 10sec, and allowed to stand at 24 ℃ for 20min, during which vortexed for 2 times for 10 sec. (3) 15ml of each tube was addedSDS-lactic acid solution (3% SDS, 0.19% lactic acid) was vortexed for 10sec, and allowed to stand at 24 ℃ for 20min, during which vortexed for 2 times for 10 sec. (4) Centrifuging at 450 Xg for 5min, taking out the centrifuge tube, sucking most of supernatant liquid by a pipette under the condition of not touching the interface, centrifuging the precipitate at 450 Xg for 3min, immediately inverting the centrifuge tube on a piece of absorbent filter paper, sucking off residual water on the tube wall one by one, and weighing, wherein the mark is M2. (5) The weight of wet batter formed per weight of flour (M2-M0). times.100/(M1-M0). times.100-W, where W is the moisture content of the sample, was calculated as the SIG value.

The SIG measurement results are shown in Table 2. As can be seen from table 2: in 2016, the SIG value of the transgenic line TL1Dx2m2 is significantly greater than that of the transgenic receptor kn2^-1DX2 transgenic line TL1Dx2 and wild type Kenong 199(KN 199). In 2017, the SIG values of two 1Dx2m2 transgenic lines TL1Dx2m2-1 and TL1Dx2m2-2 are also significantly higher than that of a transgenic receptor kn2^-1Dx2 and wild type cronong 199. The expression of the mutant subunit 1Dx2m2 is proved to be capable of obviously improving the swelling index of glutenin compared with the wild type 1Dx2 subunit.

TABLE 2 glutenin swell index of 1Dx2m2 transgenic lines

3. Powder quality instrument parameter determination and comparative analysis

According to American society of cereal chemistry, AACC^thSt.MN, USA American Association of Central Chemistry,2000 "and the program" AACC 54-21 "were used to perform powder quality analysis on the transgenic line expressing the mutant gene 1Dx2m2 and the flour of its control material, respectively. The specific operation steps are as follows: (1) according to the moisture content of the flour, 50g (14% wet basis) of the flour of each sample to be tested is weighed according to the data given by instrument software. After the instrument is opened and zero calibration is carried out, flour is put into a 50g dough kneading bowl of the flour quality instrument, and the bowl cover is covered. (2) Starting the dough kneading machine, stirring and mixing for 1min, and rapidly adding water. After dough kneading until the peak is formed, it is observed whether the peak of the curve is between 500 + -20 FU. (3) If the peak value is between 500 +/-20 FU, continuing kneading dough, continuing softening for 12min after the curve starts to obviously decrease, finishing the powder quality map, and performing data acquisition and comparative analysis.

The results of the powder quality measurement are shown in Table 3 and FIG. 8. As can be seen from table 3 and fig. 8: various indexes (except the water absorption index of 2017) of the powdery instrument of the transgenic line TL1Dx2m2 are obviously superior to those of a transgenic receptor kn2^-And at the same time, the transgenic line TL1Dx2 and wild type Kenong 199(KN199) which are also significantly superior to 1Dx2 are also provided. The mutant subunit 1Dx2m2 is shown to significantly improve the rheological properties of wheat dough.

TABLE 3 powder quality instrument parameters of 1Dx2m2 transgenic line

4. Kneading and mixing instrument analysis

Dough peak time (MPT), peak height (MPV), peak width (MPW), peak area (MPI), and anti-fade value (RBD) of the 1Dx2m2 transgenic line TL1Dx2m2 were analyzed with a kneading mixer, with reference to "AACC 54-40A" and the documents "Sun, j., Yang, w., Liu, d., Zhao, j., Luo, g., Li, x., Liu, y., Guo, j., and Zhang, a. (2015). Improvement on mixograft test through water addition and parameter conversion.j.integer.agr.14, 1715-1722". The kneading bowl used was 10g in size. The total kneading time of the standard kneading machine is 10min, and the weighed amount m of the flour is (10g × 86)/(100-W), wherein W is the water content of the sample. The data obtained were analyzed by MixSmart software (AEW Consulting, Lincoln, Nebraska, USA). The curve of the kneading and mixing instrument is automatically drawn by a computer, the parameters exceed 40, and the analysis usually adopts the middle line (Midline) parameters which are divided into 4 categories of belt height, bandwidth, area and slope. Each index of the kneading and mixing instrument spectrum reflects the rheological characteristics and quality of the wheat dough.

The results of the kneading apparatus are shown in Table 4. It can be seen from table 4 that the dough peak time and the dough peak area of the 1Dx2m2 transgenic line TL1Dx2m2 are significantly higher than the control, both of which are more than twice as high as KN199, the anti-fading value is significantly lower than the control, and the peak height and the peak width are not significantly different from the control, which indicates that the 1Dx2m2 transgenic line TL1Dx2m2 has excellent dough rheological properties, and further indicates that the 1Dx2m2 gene has the functions of improving the gluten strength and improving the baking quality of flour.

TABLE 4 measurement of various indexes of kneading and mixing apparatus

The SDS-sedimentation value (SDS-SV) and the glutenin Swelling Index (SIG) are comprehensive indexes for evaluating the quality and quantity of wheat gluten, and are highly positively correlated with the gluten strength. The peak time (MPT) and the peak area (MPI) in the parameters of the kneading and mixing device, the forming time and the Stable Time (ST) in the parameters of the flour quality device, the flour quality index (FQN) and the gluten quality are positively correlated, and the anti-fading value (RBD) in the parameters of the kneading and mixing device and the weakening Degree (DS) in the parameters of the flour quality device are negatively correlated with the gluten quality.

The experimental results of the above two years are combined to show that: the SDS, SIG, MPT, MPI and FQN of the 1Dx2m2 transgenic line are all significantly higher than those of the control (transgenic receptor kn 2)^-1Dx2 transgenic line and wild type Kenong 199), and control (transgenic receptor kn 2)^-1Dx2 transgenic line and wild type konong 199), has longer formation time and stabilization time, and simultaneously has lower RBD and DS, so that the 1Dx2m2 transgenic line has better gluten quality, thereby indicating that the mutant gene 1Dx2m2 can obviously improve the gluten characteristics of wheat flour and improve the processing quality.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of genetics and developmental biology of Chinese academy of sciences

<120> method for improving wheat processing quality

<160>15

<170>PatentIn version 3.5

<210>1

<211>30

<212>DNA

<213>Artificial Sequence

<400>1

atggctaagc ggttagtcct ctttgtggcg 30

<210>2

<211>29

<212>DNA

<213>Artificial Sequence

<400>2

ctatcactgg ctggccgaca atgcgtcgc 29

<210>3

<211>2523

<212>DNA

<213>Artificial Sequence

<400>3

atggctaagc ggttagtcct ctttgtggcg gtagtcgtcg ccctcgtggc tctcaccgtc 60

gctgaaggtg aggcctctga gcaactacag tgtgagcgcg agctccagga gctccaggag 120

cgcgagctca aggcatgcca gcaggtcatg gaccagcagc tccgagacat tagccccgag 180

tgccaccccg tcgtcgtcag cccggtcgcg ggacaatacg agcagcaaat cgtggtgccg 240

cccaagggcg gatctttcta ccccggcgag accacgccac cgcagcaact ccaacaacgt 300

atattttggg gaatacctgc actactaaaa aggtattacc caagtgtaac ttctccgcag 360

caggtttcat actatccagg ccaagcttct ccgcaacggc caggacaagg tcagcagcca 420

ggacaagggc aacaatcagg acaaggacaa caagggtact acccaacttc tccgcaacag 480

ccaggacaat ggcaacaacc ggaacaaggg caaccagggt actacccaac ttctccgcag 540

cagccaggac aattgcaaca accagcacaa gggcagcaac caggacaagg acaacaaggt 600

cggcagccag gacaagggca accagggtac tacccaactt cttcgcagct gcagccagga 660

caattgcaac aaccagcaca agggcaacaa gggcagcaac caggacaagg gcaacaaggt 720

caacagccag gacaagggca acaaccagga caaggacaac aaggtcaaca gccaggacaa 780

gggcaacaac caggacaagg gcaacaaggt cagcagctcg gacaaggaca acaagggtac 840

tacccaactt ctctgcaaca gtcgggacaa gggcaaccag ggtactaccc aacttctctg 900

cagcagctag gacaagggca atcagggtac tacccaactt ctccgcagca accaggacaa 960

gggcagcagc caggacaatt gcaacaacca gcacaagggc agcaaccaga acaagggcaa 1020

caaggtcagc agccaggaca agggcaacaa ggccagcagc caggacaagg gcagcaaccg 1080

ggacaagggc aaccagggta ctacccaact tctccgcagc agtcaggaca agggcaacca 1140

gggtactacc caacttcttc gcagcagcca acacaatcgc agcaaccagg acaagggcaa 1200

caaggtcagc aggtaggaca agggcaacaa gctcagcagc caggacaagg gcagcaaccg 1260

ggacaagggc agccagggta ctacccaact tctccgctgc agtcaggaca agggcaacca 1320

gggtactacc taacttctcc gcagcagtca ggacaagggc agcagccagg acaattgcaa 1380

caatcagcac aagggcaaaa aggacagcaa ccaggacaag gtcaacagcc agggcaaggg 1440

caacaaggtc agcagccagg acaagggcaa caaggtcagc aaccggggca agggcagcca 1500

gggtactacc caacttctcc gcagcaatca ggacaagggc aacagccagg acaatggcaa 1560

caaccaggac aagggcaacc aggatactac ccaacttctc cgttgcagcc aggacaaggg 1620

caaccagggt acgacccaac ttctccgcaa cagccaggac aagggcagca accaggacaa 1680

ttgcaacaac cagcacaagg gcaacaaggg cagcaactag cacaagggca acaagggcag 1740

caaccagcac aagtgcaaca agggcagcag ccagcacaag ggcaacaagg tcagcagcta 1800

ggacaagggc aacaaggtca gcagccagga caagggcagc aaccagcaca agggcaacaa 1860

ggtcagcagc caggacaagg gcaacaaggt cagcagccag gacaagggca gcaaccggga 1920

caagggcagc catggtacta cccaacttct ccgcaggagt caggacaagg gcaacagcca 1980

ggacaatggc aacaaccagg acaatggcaa caaccaggac aagggcaacc agggtactac 2040

ctaacttctc cgttgcagct aggacaaggg caacaagggt actacccaac ttctctgcaa 2100

caaccaggac aagggcagca accaggacaa tggcaacaat cgggacaagg gcaacatggg 2160

tactacccaa cttctccgca gctgtcagga caagggcaac ggccaggaca atggctgcaa 2220

ccaggacaag ggcaacaagg gtactaccca acttctccgc aacagtcagg acaagggcaa 2280

caactaggac aatggctgca accaggacaa gggcaacaag ggtactaccc aacttctctg 2340

caacagacag gacaagggca gcaatcagga caagggcaac aaggctacta cagctcatac 2400

catgttagcg tggagcacca ggcggccagc ctaaaggtgg caaaggcgca gcagctcgcg 2460

gcacagctgc cggcaatgtg ccggctggag ggcggcgacg cattgtcggc cagccagtga 2520

tag 2523

<210>4

<211>839

<212>PRT

<213>Artificial Sequence

<400>4

Met Ala Lys Arg Leu Val Leu Phe Val Ala Val Val Val Ala Leu Val

1 5 10 15

Ala Leu Thr Val Ala Glu Gly Glu Ala Ser Glu Gln Leu Gln Cys Glu

20 25 30

Arg Glu Leu Gln Glu Leu Gln Glu Arg Glu Leu Lys Ala Cys Gln Gln

35 40 45

Val Met Asp Gln Gln Leu Arg Asp Ile Ser Pro Glu Cys His Pro Val

50 55 60

Val Val Ser Pro Val Ala Gly Gln Tyr Glu Gln Gln Ile Val Val Pro

65 70 75 80

Pro Lys Gly Gly Ser Phe Tyr Pro Gly Glu Thr Thr Pro Pro Gln Gln

85 90 95

Leu Gln Gln Arg Ile Phe Trp Gly Ile Pro Ala Leu Leu Lys Arg Tyr

100 105 110

Tyr Pro Ser Val Thr Ser Pro Gln Gln Val Ser Tyr Tyr Pro Gly Gln

115 120 125

Ala Ser Pro Gln Arg Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln

130 135 140

Gln Ser Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser Pro Gln Gln

145 150 155 160

Pro Gly Gln Trp Gln Gln Pro Glu Gln Gly Gln Pro Gly Tyr Tyr Pro

165 170 175

Thr Ser Pro Gln Gln Pro Gly Gln Leu Gln Gln Pro Ala Gln Gly Gln

180 185 190

Gln Pro Gly Gln Gly Gln Gln Gly Arg Gln Pro Gly Gln Gly Gln Pro

195 200 205

Gly Tyr TyrPro Thr Ser Ser Gln Leu Gln Pro Gly Gln Leu Gln Gln

210 215 220

Pro Ala Gln Gly Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly

225 230 235 240

Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln

245 250 255

Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln Gln

260 265 270

Leu Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser Leu Gln Gln Ser

275 280 285

Gly Gln Gly Gln Pro Gly Tyr Tyr Pro Thr Ser Leu Gln Gln Leu Gly

290 295 300

Gln Gly Gln Ser Gly Tyr Tyr Pro Thr Ser Pro Gln Gln Pro Gly Gln

305 310 315 320

Gly Gln Gln Pro Gly Gln Leu Gln Gln Pro Ala Gln Gly Gln Gln Pro

325 330 335

Glu Gln Gly Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln

340 345 350

Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln Pro Gly Tyr Tyr

355 360 365

Pro Thr Ser Pro GlnGln Ser Gly Gln Gly Gln Pro Gly Tyr Tyr Pro

370 375 380

Thr Ser Ser Gln Gln Pro Thr Gln Ser Gln Gln Pro Gly Gln Gly Gln

385 390 395 400

Gln Gly Gln Gln Val Gly Gln Gly Gln Gln Ala Gln Gln Pro Gly Gln

405 410 415

Gly Gln Gln Pro Gly Gln Gly Gln Pro Gly Tyr Tyr Pro Thr Ser Pro

420 425 430

Leu Gln Ser Gly Gln Gly Gln Pro Gly Tyr Tyr Leu Thr Ser Pro Gln

435 440 445

Gln Ser Gly Gln Gly Gln Gln Pro Gly Gln Leu Gln Gln Ser Ala Gln

450 455 460

Gly Gln Lys Gly Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly

465 470 475 480

Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln Gln Pro Gly

485 490 495

Gln Gly Gln Pro Gly Tyr Tyr Pro Thr Ser Pro Gln Gln Ser Gly Gln

500 505 510

Gly Gln Gln Pro Gly Gln Trp Gln Gln Pro Gly Gln Gly Gln Pro Gly

515 520 525

Tyr Tyr Pro Thr Ser Pro LeuGln Pro Gly Gln Gly Gln Pro Gly Tyr

530 535 540

Asp Pro Thr Ser Pro Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln

545 550 555 560

Leu Gln Gln Pro Ala Gln Gly Gln Gln Gly Gln Gln Leu Ala Gln Gly

565 570 575

Gln Gln Gly Gln Gln Pro Ala Gln Val Gln Gln Gly Gln Gln Pro Ala

580 585 590

Gln Gly Gln Gln Gly Gln Gln Leu Gly Gln Gly Gln Gln Gly Gln Gln

595 600 605

Pro Gly Gln Gly Gln Gln Pro Ala Gln Gly Gln Gln Gly Gln Gln Pro

610 615 620

Gly Gln Gly Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly

625 630 635 640

Gln Gly Gln Pro Trp Tyr Tyr Pro Thr Ser Pro Gln Glu Ser Gly Gln

645 650 655

Gly Gln Gln Pro Gly Gln Trp Gln Gln Pro Gly Gln Trp Gln Gln Pro

660 665 670

Gly Gln Gly Gln Pro Gly Tyr Tyr Leu Thr Ser Pro Leu Gln Leu Gly

675 680 685

Gln Gly Gln Gln Gly Tyr Tyr Pro ThrSer Leu Gln Gln Pro Gly Gln

690 695 700

Gly Gln Gln Pro Gly Gln Trp Gln Gln Ser Gly Gln Gly Gln His Gly

705 710 715 720

Tyr Tyr Pro Thr Ser Pro Gln Leu Ser Gly Gln Gly Gln Arg Pro Gly

725 730 735

Gln Trp Leu Gln Pro Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser

740 745 750

Pro Gln Gln Ser Gly Gln Gly Gln Gln Leu Gly Gln Trp Leu Gln Pro

755 760 765

Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser Leu Gln Gln Thr Gly

770 775 780

Gln Gly Gln Gln Ser Gly Gln Gly Gln Gln Gly Tyr Tyr Ser Ser Tyr

785 790 795 800

His Val Ser Val Glu His Gln Ala Ala Ser Leu Lys Val Ala Lys Ala

805 810 815

Gln Gln Leu Ala Ala Gln Leu Pro Ala Met Cys Arg Leu Glu Gly Gly

820 825 830

Asp Ala Leu Ser Ala Ser Gln

835

<210>5

<211>28

<212>DNA

<213>Artificial Sequence

<400>5

catgggtact gcccaacttc tccgcagc 28

<210>6

<211>369

<212>DNA

<213>Artificial Sequence

<400>6

catgggtact gcccaacttc tccgcagctg tcaggacaag ggcaacggcc aggacaatgg 60

ctgcaaccag gacaagggca acaagggtac tacccaactt ctccgcaaca gtcaggacaa 120

gggcaacaac taggacaatg gctgcaacca ggacaagggc aacaagggta ctacccaact 180

tctctgcaac agacaggaca agggcagcaa tcaggacaag ggcaacaagg ctactacagc 240

tcataccatg ttagcgtgga gcaccaggcg gccagcctaa aggtggcaaa ggcgcagcag 300

ctcgcggcac agctgccggc aatgtgccgg ctggagggcg gcgacgcatt gtcggccagc 360

cagtgatag 369

<210>7

<211>2523

<212>DNA

<213>Artificial Sequence

<400>7

atggctaagc ggttagtcct ctttgtggcg gtagtcgtcg ccctcgtggc tctcaccgtc 60

gctgaaggtg aggcctctga gcaactacag tgtgagcgcg agctccagga gctccaggag 120

cgcgagctca aggcatgcca gcaggtcatg gaccagcagc tccgagacat tagccccgag 180

tgccaccccg tcgtcgtcag cccggtcgcg ggacaatacg agcagcaaat cgtggtgccg 240

cccaagggcg gatctttcta ccccggcgag accacgccac cgcagcaact ccaacaacgt 300

atattttggg gaatacctgc actactaaaa aggtattacc caagtgtaac ttctccgcag 360

caggtttcat actatccagg ccaagcttct ccgcaacggc caggacaagg tcagcagcca 420

ggacaagggc aacaatcagg acaaggacaa caagggtact acccaacttc tccgcaacag 480

ccaggacaat ggcaacaacc ggaacaaggg caaccagggt actacccaac ttctccgcag 540

cagccaggac aattgcaaca accagcacaa gggcagcaac caggacaagg acaacaaggt 600

cggcagccag gacaagggca accagggtac tacccaactt cttcgcagct gcagccagga 660

caattgcaac aaccagcaca agggcaacaa gggcagcaac caggacaagg gcaacaaggt 720

caacagccag gacaagggca acaaccagga caaggacaac aaggtcaaca gccaggacaa 780

gggcaacaac caggacaagg gcaacaaggt cagcagctcg gacaaggaca acaagggtac 840

tacccaactt ctctgcaaca gtcgggacaa gggcaaccag ggtactaccc aacttctctg 900

cagcagctag gacaagggca atcagggtac tacccaactt ctccgcagca accaggacaa 960

gggcagcagc caggacaatt gcaacaacca gcacaagggc agcaaccaga acaagggcaa 1020

caaggtcagc agccaggaca agggcaacaa ggccagcagc caggacaagg gcagcaaccg 1080

ggacaagggc aaccagggta ctacccaact tctccgcagc agtcaggaca agggcaacca 1140

gggtactacc caacttcttc gcagcagcca acacaatcgc agcaaccagg acaagggcaa 1200

caaggtcagc aggtaggaca agggcaacaa gctcagcagc caggacaagg gcagcaaccg 1260

ggacaagggc agccagggta ctacccaact tctccgctgc agtcaggaca agggcaacca 1320

gggtactacc taacttctcc gcagcagtca ggacaagggc agcagccagg acaattgcaa 1380

caatcagcac aagggcaaaa aggacagcaa ccaggacaag gtcaacagcc agggcaaggg 1440

caacaaggtc agcagccagg acaagggcaa caaggtcagc aaccggggca agggcagcca 1500

gggtactacc caacttctcc gcagcaatca ggacaagggc aacagccagg acaatggcaa 1560

caaccaggac aagggcaacc aggatactac ccaacttctc cgttgcagcc aggacaaggg 1620

caaccagggt acgacccaac ttctccgcaa cagccaggac aagggcagca accaggacaa 1680

ttgcaacaac cagcacaagg gcaacaaggg cagcaactag cacaagggca acaagggcag 1740

caaccagcac aagtgcaaca agggcagcag ccagcacaag ggcaacaagg tcagcagcta 1800

ggacaagggc aacaaggtca gcagccagga caagggcagc aaccagcaca agggcaacaa 1860

ggtcagcagc caggacaagg gcaacaaggt cagcagccag gacaagggca gcaaccggga 1920

caagggcagc catggtacta cccaacttct ccgcaggagt caggacaagg gcaacagcca 1980

ggacaatggc aacaaccagg acaatggcaa caaccaggac aagggcaacc agggtactac 2040

ctaacttctc cgttgcagct aggacaaggg caacaagggt actacccaac ttctctgcaa 2100

caaccaggac aagggcagca accaggacaa tggcaacaat cgggacaagg gcaacatggg 2160

tactgcccaa cttctccgca gctgtcagga caagggcaac ggccaggaca atggctgcaa 2220

ccaggacaag ggcaacaagg gtactaccca acttctccgc aacagtcagg acaagggcaa 2280

caactaggac aatggctgca accaggacaa gggcaacaag ggtactaccc aacttctctg 2340

caacagacag gacaagggca gcaatcagga caagggcaac aaggctacta cagctcatac 2400

catgttagcg tggagcacca ggcggccagc ctaaaggtgg caaaggcgca gcagctcgcg2460

gcacagctgc cggcaatgtg ccggctggag ggcggcgacg cattgtcggc cagccagtga 2520

tag 2523

<210>8

<211>839

<212>PRT

<213>Artificial Sequence

<400>8

Met Ala Lys Arg Leu Val Leu Phe Val Ala Val Val Val Ala Leu Val

1 5 10 15

Ala Leu Thr Val Ala Glu Gly Glu Ala Ser Glu Gln Leu Gln Cys Glu

20 25 30

Arg Glu Leu Gln Glu Leu Gln Glu Arg Glu Leu Lys Ala Cys Gln Gln

35 40 45

Val Met Asp Gln Gln Leu Arg Asp Ile Ser Pro Glu Cys His Pro Val

50 55 60

Val Val Ser Pro Val Ala Gly Gln Tyr Glu Gln Gln Ile Val Val Pro

65 70 75 80

Pro Lys Gly Gly Ser Phe Tyr Pro Gly Glu Thr Thr Pro Pro Gln Gln

85 90 95

Leu Gln Gln Arg Ile Phe Trp Gly Ile Pro Ala Leu Leu Lys Arg Tyr

100 105 110

Tyr Pro Ser Val Thr Ser Pro Gln Gln Val Ser Tyr Tyr Pro Gly Gln

115 120 125

Ala Ser Pro Gln Arg Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln

130 135 140

Gln Ser Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser Pro Gln Gln

145 150 155 160

Pro Gly Gln Trp Gln Gln Pro Glu Gln Gly Gln Pro Gly Tyr Tyr Pro

165 170 175

Thr Ser Pro Gln Gln Pro Gly Gln Leu Gln Gln Pro Ala Gln Gly Gln

180 185 190

Gln Pro Gly Gln Gly Gln Gln Gly Arg Gln Pro Gly Gln Gly Gln Pro

195 200 205

Gly Tyr Tyr Pro Thr Ser Ser Gln Leu Gln Pro Gly Gln Leu Gln Gln

210 215 220

Pro Ala Gln Gly Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly

225 230 235 240

Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln

245 250 255

Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln Gln

260 265 270

Leu Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser Leu Gln Gln Ser

275280 285

Gly Gln Gly Gln Pro Gly Tyr Tyr Pro Thr Ser Leu Gln Gln Leu Gly

290 295 300

Gln Gly Gln Ser Gly Tyr Tyr Pro Thr Ser Pro Gln Gln Pro Gly Gln

305 310 315 320

Gly Gln Gln Pro Gly Gln Leu Gln Gln Pro Ala Gln Gly Gln Gln Pro

325 330 335

Glu Gln Gly Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln

340 345 350

Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly Gln Pro Gly Tyr Tyr

355 360 365

Pro Thr Ser Pro Gln Gln Ser Gly Gln Gly Gln Pro Gly Tyr Tyr Pro

370 375 380

Thr Ser Ser Gln Gln Pro Thr Gln Ser Gln Gln Pro Gly Gln Gly Gln

385 390 395 400

Gln Gly Gln Gln Val Gly Gln Gly Gln Gln Ala Gln Gln Pro Gly Gln

405 410 415

Gly Gln Gln Pro Gly Gln Gly Gln Pro Gly Tyr Tyr Pro Thr Ser Pro

420 425 430

Leu Gln Ser Gly Gln Gly Gln Pro Gly Tyr Tyr Leu Thr Ser Pro Gln

435440 445

Gln Ser Gly Gln Gly Gln Gln Pro Gly Gln Leu Gln Gln Ser Ala Gln

450 455 460

Gly Gln Lys Gly Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln Gly

465 470 475 480

Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Gly Gln Gln Pro Gly

485 490 495

Gln Gly Gln Pro Gly Tyr Tyr Pro Thr Ser Pro Gln Gln Ser Gly Gln

500 505 510

Gly Gln Gln Pro Gly Gln Trp Gln Gln Pro Gly Gln Gly Gln Pro Gly

515 520 525

Tyr Tyr Pro Thr Ser Pro Leu Gln Pro Gly Gln Gly Gln Pro Gly Tyr

530 535 540

Asp Pro Thr Ser Pro Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly Gln

545 550 555 560

Leu Gln Gln Pro Ala Gln Gly Gln Gln Gly Gln Gln Leu Ala Gln Gly

565 570 575

Gln Gln Gly Gln Gln Pro Ala Gln Val Gln Gln Gly Gln Gln Pro Ala

580 585 590

Gln Gly Gln Gln Gly Gln Gln Leu Gly Gln Gly Gln Gln Gly Gln Gln

595 600605

Pro Gly Gln Gly Gln Gln Pro Ala Gln Gly Gln Gln Gly Gln Gln Pro

610 615 620

Gly Gln Gly Gln Gln Gly Gln Gln Pro Gly Gln Gly Gln Gln Pro Gly

625 630 635 640

Gln Gly Gln Pro Trp Tyr Tyr Pro Thr Ser Pro Gln Glu Ser Gly Gln

645 650 655

Gly Gln Gln Pro Gly Gln Trp Gln Gln Pro Gly Gln Trp Gln Gln Pro

660 665 670

Gly Gln Gly Gln Pro Gly Tyr Tyr Leu Thr Ser Pro Leu Gln Leu Gly

675 680 685

Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser Leu Gln Gln Pro Gly Gln

690 695 700

Gly Gln Gln Pro Gly Gln Trp Gln Gln Ser Gly Gln Gly Gln His Gly

705 710 715 720

Tyr Cys Pro Thr Ser Pro Gln Leu Ser Gly Gln Gly Gln Arg Pro Gly

725 730 735

Gln Trp Leu Gln Pro Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser

740 745 750

Pro Gln Gln Ser Gly Gln Gly Gln Gln Leu Gly Gln Trp Leu Gln Pro

755 760765

Gly Gln Gly Gln Gln Gly Tyr Tyr Pro Thr Ser Leu Gln Gln Thr Gly

770 775 780

Gln Gly Gln Gln Ser Gly Gln Gly Gln Gln Gly Tyr Tyr Ser Ser Tyr

785 790 795 800

His Val Ser Val Glu His Gln Ala Ala Ser Leu Lys Val Ala Lys Ala

805 810 815

Gln Gln Leu Ala Ala Gln Leu Pro Ala Met Cys Arg Leu Glu Gly Gly

820 825 830

Asp Ala Leu Ser Ala Ser Gln

835

<210>9

<211>33

<212>DNA

<213>Artificial Sequence

<400>9

aactgcagag ggaaagacaa tggacatgca aag 33

<210>10

<211>33

<212>DNA

<213>Artificial Sequence

<400>10

cgggatccct cggtgaactg tcagtgaatt gat 33

<210>11

<211>1147

<212>DNA

<213>Artificial Sequence

<400>11

agggaaagac aatggacatg caaagaggta ggggcaggga agaaacactt ggagatcata 60

gaagaacata agaggttaaa cataggagca gtggcggagc ttgggctgat tttatggagg 120

ggcaaatggg ctggaggggc aagaaatatg agtttgggct gattttaact gggcatatgg 180

gctgaatact aggggatata tgctagtttt ctcatgggct gggggggcaa tggcccaggt 240

tgctctccac taagctccgc cactgcatag gagggcataa tggacaatta aatctacatt 300

aattgaactc atttgggaag taaacaaaat ccatattctg gtgtaaatca aactatttga 360

tgcggattta ctaagatcct atgttaattt tagacatgac tggccaaagg tttcagttag 420

ttcatttgtc acggaaaggt gttttcataa gtccaaaact ctaccaactt ttttgcacgt 480

catagcatag atagatgttg tgagtcattg gatagatatt gtgagtcagc atggatttgt 540

gttgcctgga aatccaacta aatgacaagc aacaaaacct gaaatgggct ttaggagaga 600

tggtttatca atttacatgt tccatgcagg ctaccttcca ctactcgaca tggttagaag 660

ttttgagtgc cgcatatttg cggaagcaat ggcactactc gacatggtta gaagttttga 720

gtgccgcata tttgcggaag caatggctaa cagatacata ttctgccaaa ccccaagaag 780

gataatcact cctcttagat aaaaagaaca gaccaatgta caaacatcca cacttctgca 840

aacaatacac cagaactagg attaagccca ttacgtggct ttagcagacc gtccaaaaat 900

ctgttttgca agcaccaatt gctccttact tatccagctt cttttgtgtt ggcaaactgc 960

ccttttccaa ccgattttgt tcttctcacg ctttcttcat aggctaaact aacctcggcg 1020

tgcacacaac catgtcctga accttcacct cgtccctata aaagcccatc caaccttcac 1080

aatctcatca tcacccacaa caccgagcac cccaatctac agatcaattc actgacagtt 1140

caccgag 1147

<210>12

<211>4691

<212>DNA

<213>Artificial Sequence

<400>12

gaaccctgca gtgcagcgtg acccggtcgt gcccctctct agagataatg agcattgcat 60

gtctaagtta taaaaaatta ccacatattt tttttgtcac acttgtttga agtgcagttt 120

atctatcttt atacatatat ttaaacttta ctctacgaat aatataatct atagtactac 180

aataatatca gtgttttaga gaatcatata aatgaacagt tagacatggt ctaaaggaca 240

attgagtatt ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc 300

tttttttttg caaatagctt cacctatata atacttcatc cattttatta gtacatccat 360

ttagggttta gggttaatgg tttttataga ctaatttttt tagtacatct attttattct 420

attttagcct ctaaattaag aaaactaaaa ctctatttta gtttttttat ttaataattt 480

agatataaaa tagaataaaa taaagtgact aaaaattaaa caaataccct ttaagaaatt 540

aaaaaaacta aggaaacatt tttcttgttt cgagtagata atgccagcct gttaaacgcc 600

gtcgacgagt ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa 660

gcagacggca cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc 720

gttggacttg ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc 780

ggcacggcag gcggcctcct cctcctctca cggcacggca gctacggggg attcctttcc 840

caccgctcct tcgctttccc ttcctcgcccgccgtaataa atagacaccc cctccacacc 900

ctctttcccc aacctcgtgt tgttcggagc gcacacacac acaaccagat ctcccccaaa 960

tccacccgtc ggcacctccg cttcaaggta cgccgctcgt cctccccccc cccccctctc 1020

taccttctct agatcggcgt tccggtccat ggttagggcc cggtagttct acttctgttc 1080

atgtttgtgt tagatccgtg tttgtgttag atccgtgctg ctagcgttcg tacacggatg 1140

cgacctgtac gtcagacacg ttctgattgc taacttgcca gtgtttctct ttggggaatc 1200

ctgggatggc tctagccgtt ccgcagacgg gatcgatttc atgatttttt ttgtttcgtt 1260

gcatagggtt tggtttgccc ttttccttta tttcaatata tgccgtgcac ttgtttgtcg 1320

ggtcatcttt tcatgctttt ttttgtcttg gttgtgatga tgtggtctgg ttgggcggtc 1380

gttctagatc ggagtagaat tctgtttcaa actacctggt ggatttatta attttggatc 1440

tgtatgtgtg tgccatacat attcatagtt acgaattgaa gatgatggat ggaaatatcg 1500

atctaggata ggtatacatg ttgatgcggg ttttactgat gcatatacag agatgctttt 1560

tgttcgcttg gttgtgatga tgtggtgtgg ttgggcggtc gttcattcgt tctagatcgg 1620

agtagaatac tgtttcaaac tacctggtgt atttattaat tttggaactg tatgtgtgtg 1680

tcatacatct tcatagttac gagtttaaga tggatggaaa tatcgatcta ggataggtat 1740

acatgttgat gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat 1800

atgctctaac cttgagtacc tatctattat aataaacaag tatgttttat aattattttg 1860

atcttgatat acttggatga tggcatatgc agcagctata tgtggatttt tttagccctg 1920

ccttcatacg ctatttattt gcttggtact gtttcttttg tcgatgctca ccctgttgtt 1980

tggtgttact tctgcaggtc gactctagag gatccccggg taccgagctc gaatttcccc 2040

gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcg 2100

atgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc 2160

atgacgttat ttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac 2220

gcgatagaaa acaaaatata gcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct 2280

atgttactag atcgggaatt catcgatgat atcagatctg ccggtctccc tatagtgagt 2340

cgtattaatt tcgataagcc aggttaacct gcattaatga atcggccaac gcgcggggag 2400

aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 2460

cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 2520

atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 2580

taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 2640

aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 2700

tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 2760

gtccgccttt ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct 2820

cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 2880

cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 2940

atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 3000

tacagagttc ttgaagtggt ggcctaacta cggctacact agaagaacag tatttggtat 3060

ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 3120

acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 3180

aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 3240

aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 3300

tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 3360

cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 3420

catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 3480

ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 3540

aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 3600

ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 3660

caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 3720

attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 3780

agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 3840

actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 3900

ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 3960

ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 4020

gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 4080

atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 4140

cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 4200

gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 4260

gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 4320

ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc taagaaacca ttattatcat 4380

gacattaacc tataaaaata ggcgtatcac gaggcccttt cgtctcgcgc gtttcggtga 4440

tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc 4500

ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg 4560

ctggcttaac tatgcggcat cagagcagat tgtactgaga gtgcaccata tggacatatt 4620

gtcgttagaa cgcggctaca attaatacat aaccttatgt atcatacaca tacgatttag 4680

gtgacactat a 4691

<210>13

<211>3676

<212>DNA

<213>Artificial Sequence

<400>13

agggaaagac aatggacatg caaagaggta ggggcaggga agaaacactt ggagatcata 60

gaagaacata agaggttaaa cataggagca gtggcggagc ttgggctgat tttatggagg 120

ggcaaatggg ctggaggggc aagaaatatg agtttgggct gattttaact gggcatatgg 180

gctgaatact aggggatata tgctagtttt ctcatgggct gggggggcaa tggcccaggt 240

tgctctccac taagctccgc cactgcatag gagggcataa tggacaatta aatctacatt 300

aattgaactc atttgggaag taaacaaaat ccatattctg gtgtaaatca aactatttga 360

tgcggattta ctaagatcct atgttaattt tagacatgac tggccaaagg tttcagttag 420

ttcatttgtc acggaaaggt gttttcataa gtccaaaact ctaccaactt ttttgcacgt 480

catagcatag atagatgttg tgagtcattg gatagatatt gtgagtcagc atggatttgt 540

gttgcctgga aatccaacta aatgacaagc aacaaaacct gaaatgggct ttaggagaga 600

tggtttatca atttacatgt tccatgcagg ctaccttcca ctactcgaca tggttagaag 660

ttttgagtgc cgcatatttg cggaagcaat ggcactactc gacatggtta gaagttttga 720

gtgccgcata tttgcggaag caatggctaa cagatacata ttctgccaaa ccccaagaag 780

gataatcact cctcttagat aaaaagaaca gaccaatgta caaacatcca cacttctgca 840

aacaatacac cagaactagg attaagccca ttacgtggct ttagcagacc gtccaaaaat 900

ctgttttgca agcaccaatt gctccttact tatccagctt cttttgtgtt ggcaaactgc 960

ccttttccaa ccgattttgt tcttctcacg ctttcttcat aggctaaact aacctcggcg 1020

tgcacacaac catgtcctga accttcacct cgtccctata aaagcccatc caaccttcac 1080

aatctcatca tcacccacaa caccgagcac cccaatctac agatcaattc actgacagtt 1140

caccgaggga tccatggcta agcggttagt cctctttgtg gcggtagtcg tcgccctcgt 1200

ggctctcacc gtcgctgaag gtgaggcctc tgagcaacta cagtgtgagc gcgagctcca 1260

ggagctccag gagcgcgagc tcaaggcatg ccagcaggtc atggaccagc agctccgaga 1320

cattagcccc gagtgccacc ccgtcgtcgt cagcccggtc gcgggacaat acgagcagca 1380

aatcgtggtg ccgcccaagg gcggatcttt ctaccccggc gagaccacgc caccgcagca 1440

actccaacaa cgtatatttt ggggaatacc tgcactacta aaaaggtatt acccaagtgt 1500

aacttctccg cagcaggttt catactatcc aggccaagct tctccgcaac ggccaggaca 1560

aggtcagcag ccaggacaag ggcaacaatc aggacaagga caacaagggt actacccaac 1620

ttctccgcaa cagccaggac aatggcaaca accggaacaa gggcaaccag ggtactaccc 1680

aacttctccg cagcagccag gacaattgca acaaccagca caagggcagc aaccaggaca 1740

aggacaacaa ggtcggcagc caggacaagg gcaaccaggg tactacccaa cttcttcgca 1800

gctgcagcca ggacaattgc aacaaccagc acaagggcaa caagggcagc aaccaggaca 1860

agggcaacaa ggtcaacagc caggacaagg gcaacaacca ggacaaggac aacaaggtca 1920

acagccagga caagggcaac aaccaggaca agggcaacaa ggtcagcagc tcggacaagg 1980

acaacaaggg tactacccaa cttctctgca acagtcggga caagggcaac cagggtacta 2040

cccaacttct ctgcagcagc taggacaagg gcaatcaggg tactacccaa cttctccgca 2100

gcaaccagga caagggcagc agccaggaca attgcaacaa ccagcacaag ggcagcaacc 2160

agaacaaggg caacaaggtc agcagccagg acaagggcaa caaggccagc agccaggaca 2220

agggcagcaa ccgggacaag ggcaaccagg gtactaccca acttctccgc agcagtcagg 2280

acaagggcaa ccagggtact acccaacttc ttcgcagcag ccaacacaat cgcagcaacc 2340

aggacaaggg caacaaggtc agcaggtagg acaagggcaa caagctcagc agccaggaca 2400

agggcagcaa ccgggacaag ggcagccagg gtactaccca acttctccgc tgcagtcagg 2460

acaagggcaa ccagggtact acctaacttc tccgcagcag tcaggacaag ggcagcagcc 2520

aggacaattg caacaatcag cacaagggca aaaaggacag caaccaggac aaggtcaaca 2580

gccagggcaa gggcaacaag gtcagcagcc aggacaaggg caacaaggtc agcaaccggg 2640

gcaagggcag ccagggtact acccaacttc tccgcagcaa tcaggacaag ggcaacagcc 2700

aggacaatgg caacaaccag gacaagggca accaggatac tacccaactt ctccgttgca 2760

gccaggacaa gggcaaccag ggtacgaccc aacttctccg caacagccag gacaagggca 2820

gcaaccagga caattgcaac aaccagcaca agggcaacaa gggcagcaac tagcacaagg 2880

gcaacaaggg cagcaaccag cacaagtgca acaagggcag cagccagcac aagggcaaca 2940

aggtcagcag ctaggacaag ggcaacaagg tcagcagcca ggacaagggc agcaaccagc 3000

acaagggcaa caaggtcagc agccaggaca agggcaacaa ggtcagcagc caggacaagg 3060

gcagcaaccg ggacaagggc agccatggta ctacccaact tctccgcagg agtcaggaca 3120

agggcaacag ccaggacaat ggcaacaacc aggacaatgg caacaaccag gacaagggca 3180

accagggtac tacctaactt ctccgttgca gctaggacaa gggcaacaag ggtactaccc 3240

aacttctctg caacaaccag gacaagggca gcaaccagga caatggcaac aatcgggaca 3300

agggcaacat gggtactgcc caacttctcc gcagctgtca ggacaagggc aacggccagg 3360

acaatggctg caaccaggac aagggcaaca agggtactac ccaacttctc cgcaacagtc 3420

aggacaaggg caacaactag gacaatggct gcaaccagga caagggcaac aagggtacta 3480

cccaacttct ctgcaacaga caggacaagg gcagcaatca ggacaagggc aacaaggcta 3540

ctacagctca taccatgtta gcgtggagca ccaggcggcc agcctaaagg tggcaaaggc 3600

gcagcagctc gcggcacagc tgccggcaat gtgccggctg gagggcggcg acgcattgtc 3660

ggccagccag tgatag 3676

<210>14

<211>20

<212>DNA

<213>Artificial Sequence

<400>14

tcggccagcc agtgataggg 20

<210>15

<211>20

<212>DNA

<213>Artificial Sequence

<400>15

tacgcaaacc gcctctcccc 20

Claims (10)

1.1Dx2m2 protein, which is obtained by mutating the 722 th tyrosine of 1Dx2 protein amino acid sequence to cysteine;

the 1Dx2 protein is a protein shown in a) or b) as follows:

a) the amino acid sequence is a protein shown in a sequence 4;

b) and (b) a fusion protein obtained by connecting a tag to the N-terminal and/or the C-terminal of the protein shown in the sequence 4.

2. The protein of claim 1, wherein: the 1Dx2m2 protein is a protein shown in the following c) or d):

c) the amino acid sequence is a protein shown in a sequence 8;

d) and (b) a fusion protein obtained by connecting a tag to the N-terminal and/or the C-terminal of the protein shown in the sequence 8.

3. The biomaterial related to the 1Dx2m2 protein of claim 1 or 2, being any one of the following a1) to a 8):

A1) a nucleic acid molecule encoding the 1Dx2m2 protein of claim 1;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

4. The related biological material according to claim 3, wherein: A1) the nucleic acid molecule is a gene shown in the following 1) or 2) or 3):

1) the coding sequence is a cDNA molecule or a DNA molecule shown in a sequence 7;

2) a cDNA molecule or genomic DNA molecule having 95% or more identity to the nucleotide sequence defined in 1) and encoding the 1Dx2m2 protein of claim 1;

3) a cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in 1) or 2) and encodes the 1Dx2m2 protein of claim 1.

5. Use of the protein of claim 1 or 2 or the related biomaterial of claim 3 or 4) in any one of the following B1) -B10):

B1) regulating and controlling the processing quality of the wheat flour;

B2) regulating and controlling the baking quality of the wheat flour;

B3) regulating and controlling the gluten property and/or gluten strength and/or gluten quality of the wheat flour;

B4) regulating the dough rheological property and/or the extensibility and/or the stretch resistance and/or the kneading resistance of the wheat flour;

B5) regulating and controlling the SDS-sedimentation value of the wheat flour;

B6) regulating and controlling the glutenin swelling index of the wheat flour;

B7) regulating and controlling the water absorption and/or the dough forming time and/or the dough stabilizing time and/or the weakening degree in the flour quality instrument detection parameters of the wheat flour;

B8) regulating and controlling peak time and/or peak area and/or anti-fading value in the parameters of the kneading and mixing instrument of the wheat flour;

B9) cultivating transgenic wheat with improved flour processing quality and/or baking quality and/or gluten quality;

B10) and (5) wheat breeding.

6. A transgenic wheat having improved flour processing quality and/or baking quality and/or gluten quality, comprising the step of increasing the content and/or activity of the 1Dx2m2 protein of claim 1 in a recipient wheat to obtain a transgenic wheat; the transgenic wheat has a higher flour processing quality and/or baking quality and/or gluten quality than the recipient wheat.

7. The method of claim 6, wherein: the transgenic wheat has higher flour processing quality and/or baking quality and/or gluten quality than the acceptor wheat as shown in any one of C1-C9):

C1) the SDS-sedimentation value of the transgenic wheat flour is higher than that of receptor wheat;

C2) the swelling index of glutenin of the transgenic wheat flour is higher than that of receptor wheat;

C3) the water absorption rate in the detection parameters of the flour quality instrument of the transgenic wheat flour is higher than that of receptor wheat;

C4) the dough forming time in the flour quality instrument detection parameters of the transgenic wheat flour is longer than that of receptor wheat;

C5) the dough stability time in the flour quality instrument detection parameters of the transgenic wheat flour is longer than that of receptor wheat;

C6) the attenuation degree of the detection parameters of the flour quality instrument of the transgenic wheat flour is lower than that of receptor wheat;

C7) the peak time in the detection parameters of the kneading and mixing instrument of the transgenic wheat flour is higher than that of receptor wheat;

C8) the peak value area in the detection parameters of the kneading and mixing instrument of the transgenic wheat flour is higher than that of receptor wheat;

C9) the anti-fading value of the parameters detected by the kneading and mixing instrument of the transgenic wheat flour is lower than that of receptor wheat.

8. The method according to claim 6 or 7, characterized in that: the method for increasing the content and/or activity of the 1Dx2m2 protein in the receptor wheat is to overexpress the 1Dx2m2 protein in the receptor wheat.

9. The method of claim 8, wherein: the method for over-expressing the 1Dx2m2 protein of claim 1 in recipient wheat is to introduce the gene encoding the 1Dx2m2 protein of claim 1 into recipient wheat.

10. The method of claim 9, wherein: the nucleotide sequence of the coding gene of the 1Dx2m2 protein is a DNA molecule shown in a sequence 7.

Images