CN110787291A

CN110787291A - Reinforced adjuvant

Info

Publication number: CN110787291A
Application number: CN201810874208.4A
Authority: CN
Inventors: 王元涛; 刘勇
Original assignee: Individual
Current assignee: Individual
Priority date: 2018-08-03
Filing date: 2018-08-03
Publication date: 2020-02-14

Abstract

The invention discloses a reinforced adjuvant which comprises mineral oil 3:1 lanolin (v/m), 0.01% skl (m/v), 1mg/ml inactivated BCG, 50 microgram/ml IL32 gamma active protein and 12% Tween 80; the use amount of the BCG vaccine is reduced, and the BCG vaccine is safer to immune animals; IL32 is added, the immunoreactivity of animals is enhanced, and the yield of antibodies is improved; tween80 reduces the emulsification difficulty, enhances the emulsification strength, makes the emulsification simpler, makes the release of antigen in vivo more scientific, and the immune reaction time of organism longer 4.SKL increases the activity existence rate of antigen, makes the antigen emulsified in the active protein state to the maximum extent, can improve the specific recognition of antibody to antigen, improves the recognition rate of antibody to antigen three-dimensional structure, and reduces the antigen usage amount.

Description

Reinforced adjuvant

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a reinforced adjuvant.

Background

The vaccine product is prepared with microbe, cell and other biological material obtained through gene engineering, cell engineering, protein engineering, fermentation engineering and other biological technology, and is used in preparing medicine for preventing, treating and diagnosing human diseases. The vaccine product is different from general medical medicines, and the efficacy is achieved only by stimulating the immune system of the organism to generate immune substances (such as antibodies), and humoral immunity, cellular immunity or cell-mediated immunity appears in the human body; it is a product brought by the deep understanding of human beings to things and the improvement of science and technology, and is a great advantage for human beings to resist the threat of external adverse factors and improve the health quality. From the inoculation of smallpox by Chinese in the first 10 th century to the development of modern microbiology, immunology and molecular biology and other disciplines to produce inactivated vaccines, attenuated live vaccines, polypeptide vaccines, monoclonal antibodies, etc., humans have been a great step in the field of vaccine preparations.

However, with the continuous popularization of vaccine products, the application limitation caused by the natural property of the vaccine products is exposed continuously. Most vaccine preparations have a relatively short half-life in the isolated state, and particularly under catalysis of temperature, the half-life decreases more linearly with increasing temperature. Thus, most vaccine preparations require a suitable storage condition to maintain their stability, and the liquid environment in which they are contained plays a particularly critical role in maintaining stability. The pH value, ionic strength and other components (such as some carbohydrate molecules, amino acid components, esters and the like) which maintain stability of the liquid environment can influence the stability period of the vaccine product, so that the search for a proper preparation formula to protect the stability of the vaccine product in the processes of production, storage and transportation has a very important significance for the application and popularization of the vaccine product.

Meanwhile, for vaccine-type biological products, the single active ingredient of the vaccine-type biological products is affected by various biological pathways in the process of immune presentation, so that the expected immune effect cannot be realized, and some adjuvants capable of enhancing the immune response of organisms to vaccine antigens or changing the type of the immune response are needed as assistance. The most commonly used vaccine adjuvants at present are aluminium hydroxide adjuvants, in addition to lipopolysaccharides, cytokines, alum, etc. These substances prolong the retention time of antigens in the body, mainly by changing the physical shape of the antigens; stimulating the antigen-presenting ability of mononuclear phagocytes; stimulating lymphocyte differentiation, increasing immune response capacity, and the like.

For example, Freund's adjuvant is commonly used, wherein the dosage of inactivated BCG vaccine is large, and the antigen is large in dosage, so that when the antigen is injected into an animal body, germs can be generated in the animal body, and the life health safety of the animal is harmed.

Disclosure of Invention

The invention provides a reinforced adjuvant, aiming at reducing the using amount of antigen and being safer for immune animals.

The invention is realized by mineral oil 3:1 lanolin (v/m), 0.01% skl (m/v), 1mg/ml inactivated BCG, 50 microgram/ml IL32 gamma active protein, 12% Tween 80.

Wherein, the IL32 gamma also comprises 6 different isforms such as IL32Beta, IL32Delta, IL32Alpha and the like, and the amino acid sequence is as follows: 31Ala-234 Arg.

Wherein the base sequence is:

TTCCCGAAGGTCCTCTCTGATGACATGAAGAAGCTGAAGGCCCGAATGGTAATGCTCCTCCCTACTTCTGCTCAGGGGTTGGGGGCCTGGGTCTCAGCGTGTGACACTGAGGACACTGTGGGACACCTGGGACCCTGGAGGGACAAGGATCCGGCCCTTTGGTGCCAACTCTGCCTCTCTTCACAGCACCAGGCCATAGAAAGATTTTATGATAAAATGCAAAATGCAGAATCAGGACGTGGACAGGTGATGTCGAGCCTGGCAGAGCTGGAGGACGACTTCAAAGAGGGCTACCTGGAGACAGTGGCGGCTTATTATGAGGAGCAGCACCCAGAGCTCACTCCTCTACTTGAAAAAGAAAGAGATGGATTACGGTGCCGAGGCAACAGATCCCCTGTCCCGGATGTTGAGGATCCCGCAACCGAGGAGCCTGGGGAGAGCTTTTGTGACAAGGTCATGAGATGGTTCCAGGCCATGCTGCAGCGGCTGCAGACCTGGTGGCACGGGGTTCTGGCCTGGGTGAAGGAGAAGGTGGTGGCCCTGGTCCATGCAGTGCAGGCCCTCTGGAAACAGTTCCAGAGTTTCTGCTGCTCTCTGTCAGAGCTCTTCATGTCCTCTTTCCAGTCCTACGGAGCCCCACGGGGGGACAAGGAGGAGCTGACACCCCAGAAGTGCTCTGAACCCCAATCCTCAAAATGA

selecting a recombinant expression system as an Ecoli expression system, wherein codon preference exists in the Ecoli, so that JCat is selected according to a codon optimization tool

Codons were optimized with the results:

GCTTGGGTTTCTGCTTGCGACACCGAAGACACCGTTGGTCACCTGGGTCC；

GTGGCGTGACAAAGACCCGGCTCTGTGGTGCCAGCTGTGCCTGTCTTCTC；

AGCACCAGGCTATCGAACGTTTCTACGACAAAATGCAGAACGCTGAATCT；

GGTCGTGGTCAGGTTATGTCTTCTCTGGCTGAACTGGAAGACGACTTCAA；

AGAAGGTTACCTGGAAACCGTTGCTGCTTACTACGAAGAACAGCACCCGG；

AACTGACCCCGCTGCTGGAAAAAGAACGTGACGGTCTGCGTTGCCGTGGT；

AACCGTTCTCCGGTTCCGGACGTTGAAGACCCGGCTACCGAAGAACCGGG

TGAATCTTTCTGCGACAAAGTTATGCGTTGGTTCCAGGCTATGCTGCAG；

GTCTGCAGACCTGGTGGCACGGTGTTCTGGCTTGGGTTAAAGAAAAAGTT；

GTTGCTCTGGTTCACGCTGTTCAGGCTCTGTGGAAACAGTTCCAGTCTTT；

CTGCTGCTCTCTGTCTGAACTGTTCATGTCTTCTTTCCAGTCTTACGGTG；

CTCCGCGTGGTGACAAAGAAGAACTGACCCCGCAGAAATGCTCTGAACCG；

CAGTCTTCTAAATAA（615BP，23.4KD）。

gene synthesis, constructing a vector Pet28a-IL32 with IL32 gene in MCS of Pet28a vector, converting the vector Pet28a-IL32 into a competent BL21(DE 3), selecting positive clone from a kanamycin culture medium, inducing IL32 expression by IPTG, carrying out metal ion affinity purification to obtain protein with the purity of more than or equal to 95%, then carrying out a cell activity test, detecting the activity of IL32 protein, and using active IL32 for developing a new enhanced immune adjuvant.

Compared with the prior art, the invention has the beneficial effects that: the reinforced adjuvant reduces the using amount of the BCG vaccine and is safer for immune animals; IL32 is added, the immunoreactivity of animals is enhanced, and the yield of antibodies is improved; tween80 reduces the emulsification difficulty, enhances the emulsification strength, makes the emulsification simpler, makes the release of antigen in vivo more scientific, and makes the immune reaction time of organism longer 4.SKL increases the activity existence rate of antigen, makes the antigen emulsified in the active protein state to the maximum extent, can improve the specific recognition of antibody to antigen, improves the recognition rate of antibody to antigen three-dimensional structure, and reduces the antigen usage amount (especially important to precious antigen);

in a word, the safety of the adjuvant is improved, the using amount of the antigen is reduced, the emulsifying difficulty is reduced, the emulsifying success rate is improved, the damage of the adjuvant to the antigen is reduced, the antigen keeps a free three-dimensional structure, the specific recognition rate of the antibody to the three-dimensional structure of the antigen is enhanced, and the specificity of the antibody is enhanced.

Drawings

FIG. 1 is a diagram showing the double digestion results of plasmid NheI and XhoI of Pet28a-IL32 according to the present invention;

FIG. 2 is a diagram of a cell culture according to the present invention;

FIG. 3 is a graph showing a comparison of the immunological potency of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

In the description of the present invention, it is to be understood that the terms "length", "width", "upper", "lower", "front", "rear", "left", "right", "vertical", "horizontal", "top", "bottom", "inner", "outer", and the like, indicate orientations or positional relationships based on those shown in the drawings, and are used only for convenience in describing the present invention and for simplicity in description, and do not indicate or imply that the devices or elements referred to must have a particular orientation, be constructed in a particular orientation, and be operated, and thus, are not to be construed as limiting the present invention. Further, in the description of the present invention, "a plurality" means two or more unless specifically defined otherwise.

Referring to fig. 1-3, the present invention provides a technical solution: comprises mineral oil 3:1 lanolin (v/m), 0.01% skl (m/v), 1mg/ml inactivated BCG, 50 microgram/ml IL32 gamma active protein, 12% Tween 80.

Further, the IL32 γ further includes 6 different isforms such as IL32Beta, IL32Delta, IL32Alpha, etc., and the amino acid sequence is: 31Ala-234 Arg.

In this embodiment, interleukin 32 γ (IL-32 γ) is an interleukin, a cytokine signaling molecule in the immune system. IL-32 γ plays an important role in the critical functions of the immune system, tolerance and immunity primarily through its direct effects on T cells. In the thymus, as T cells mature, it suppresses autoimmune diseases by promoting the differentiation of certain immature T cells into regulatory T cells, thereby suppressing other T cells that are otherwise activated to attack normal healthy cells in the body. When naive T cells are also stimulated by antigens, IL-32 γ also promotes T cell differentiation into effector T cells and into memory T cells, thereby helping the body to fight infection. To measure the effect of IL-32 γ on cell proliferation, CTLL-2 cells were seeded into triplicate wells of 96-well plates at a density of 2000 cells/well with 2% serum standard 1640 containing different concentrations of recombinant human IL-32 γ. After 96h incubation, cells were observed under an inverted microscope and cell proliferation was determined by cell count KIT-8 (CCK-8). Briefly, 10 grams L of CCK-8 solution was added to each well of the plate, and the absorbance at 450 nm was measured using a microplate reader after incubating the plate for 1-4 hours at 37 ℃. And observing the proliferation condition of the CTLL-2 cells after the IL-32 gamma is incubated for 96h by an inverted microscope. After 96h incubation with recombinant human IL-32. gamma. cell viability was measured by CCK-8 method and the results are shown in FIG. 2. IL-32 gamma significantly increased the survival of CTLL-2 cells.

Fig. 3 is a graph showing a comparison of the immune potency of the present embodiment, wherein the specificity is as follows:

antigen emulsification and immunization process:

(1) antigen emulsification:

the Freund complete adjuvant is selected for the primary immunization, and the Freund incomplete adjuvant is selected for the subsequent immunization. Taking a tube of antigen protein to be immunized at-20 ℃, unfreezing the tube on an ice box or crushed ice, taking the tube into an EP (Eppendorf) tube according to the immunizing dose (0.8 mg once for rabbit, 0.2mg once for rat and 0.1mg once for mouse), adding an equal volume of adjuvant, and shaking and emulsifying in a silver-mercury mixer for 40 s. Complete emulsification is characterized by the fact that the whole is milky white, and the emulsified antigen is taken and dropped one drop to the cold water without spreading the oil drop). If the emulsification effect is not good, the emulsion is emulsified again for 40 s until the emulsification is complete. The emulsified antigen was stored at 4 ℃ and the immunization was completed within one day. After emulsification, the antigen is sucked into a 1mL sterile syringe, and an item number and an immune serial number are marked on a label to be used as a subsequent antiserum and antibody information search evidence.

(2) Immunization (subcutaneous):

new Zealand white rabbits: the rabbit immune dose is 0.8 mg/time, the total immune amount after emulsification is about 600-800 muL, one point of immunization is carried out at intervals of 4cm on both sides of the back, 6-8 points of subcutaneous immunization are adopted, and each point is 100 muL. After each immunization, the immunization is carried out again at an interval of two weeks.

Mice: the immunization dose is 0.1 mg/time, the total immunization amount after emulsification is about 120-.

Rat: the immunization dose is 0.2 mg/time, the total amount of the emulsified immunization is about 240-.

In addition, a competence preparation process and a protein purification process are included, as follows:

the competence manufacturing process comprises the following steps: and (3) picking single E.coliBL21 colony from a solid plate, inoculating the single E.coliBL21 colony into a sterilized sample bottle containing 5mLLB liquid culture medium, and performing shake culture at 220rpm for 8-10 h at 37 ℃.

The 500. mu.L of the bacterial suspension was inoculated into 50mLLB medium and cultured at 37 ℃ and 22rpm with shaking until OD600= 0.4-0.6.

The bacterial solution was dispensed into pre-cooled sterilized 1.5ml of LEP, centrifuged at 12,000 g for 2min at 4 ℃ and the supernatant discarded, leaving the residual liquid to be aspirated.

mu.L of a pre-cooled mixed solution of MgCl2/CaCl2 (80 mM/20 mM) was added to each tube to suspend the cells, centrifuged at 12,000 rmp at 4 ℃ for 2min (min), the supernatant was discarded, and the residue was aspirated off.

Coli competent cells were obtained by adding 100. mu.L of pre-cooled 100mM CaCl2 solution (containing 20% glycerol) per tube to suspend the cells.

Wherein, the remarks are:

when a large amount of competent cells are prepared, the volume can be proportionally expanded, and the prepared competent cells are subpackaged into a precooled sterilized 1.5mL centrifuge tube according to 100 mu L/tube and stored at the temperature of-70 ℃ (within 6 months).

The just prepared escherichia coli competent cells are stored for 12-24 hours at 4 ℃ or in an ice bath, and the transformation efficiency can be increased by 4-6 times.

The transformation process is as follows: taking BL21(DE 3) which is melted on 100 microliters of ice, adding the target plasmid, gently mixing, and standing on ice for 30min

Heating in 42 deg.C water bath for 45s, rapidly placing on ice, standing for 2min, and shaking to reduce conversion rate

Adding 700 microliters of nonresistant LB medium into the centrifuge tube, uniformly mixing, and recovering for 60min at 37 ℃ and 200rpm

The cells were collected by centrifugation at 5000rpm for 1min, and about 100. mu.l of the supernatant was retained, and the resuspended cells were gently blown out and spread on LB plates containing kanamycin resistance, and cultured overnight at 37 ℃.

The expression process is as follows: strains stored on plates Single colonies containing the recombinant plasmid were picked from the plates, inoculated in 5mLLB medium containing resistance, and cultured overnight at 37 ℃.

Inoculating 500 mu L of the bacterial liquid into 50mLLB culture medium containing corresponding resistance, and culturing at 37 ℃ until OD600= 0.6-0.8.

In the sterile operating station, 1mL of the inoculum was added to sterilized 2mLEP as an uninduced control. Adding IPTG storage solution into the rest bacterial solution until the final concentration of IPTG is 0.5mM, and culturing the induced and non-induced bacterial solution according to the following conditions:

pET vector expression: culturing at 30 deg.C for more than 5 hr;

pCold vector expression: culturing at 15 deg.C for more than 12 hr.

Bacterial strain preserved in seed preservation pipe

Taking out a tube of target strain from a refrigerator at-80 deg.C, preserving the strain, quickly inserting into ice box filled with ice for re-melting, inoculating into 5mLLB culture medium containing resistance, and placing in a shaker at 37 deg.C for 12 h.

The medium was inoculated into a flask containing LB medium at 1/100 volumes and incubated at 37 ℃ in a shaker to an OD600= 0.6.

In the sterile operating station, 1mL of the inoculum was added to sterilized 2mLEP as an uninduced control. Adding IPTG storage solution into the rest bacterial solution until the final concentration of IPTG is 0.5mM, and culturing the induced and non-induced bacterial solution according to the following conditions: pET vector expression: culturing at 37 deg.C for more than 5 hr.

The protein purification process was as follows: anhydrous ethanol

0.5MNaOH

Stock solution a (stock solution a) (10X):

29.3g NaCl and 2.76g NaH2PO4 were dissolved in 90mL deionized water and adjusted to 100mL after complete dissolution

Stock solution B (stock solution B) (10X):

2.84g Na2HPO4 and 29.3g NaCl were dissolved in 90mL deionized water and 100mL was obtained after complete dissolution

5 xnativepurifcation buffer (natural purification buffer):

200mL of the solution was prepared by weighing 180mL of sterile deionized water, dissolving 7g of NaH2PO4 and 29.2g of NaCl completely, adjusting the pH to 8.0 with NaOH, adding water to 200mL, and storing at room temperature.

3 mifiazoledrph 6.0 (imidazole):

a100 mL solution was prepared by adding 85mL of sterile deionized water, 20.6g of Imidazole, 8.77mL of StockSolutionA (stock solution A) (10X) and 1.23mL of StockSolutionB (stock solution B) (10X), mixing, adjusting pH to 6.0 with HCl or NaOH, and adding water to 100 mL. Storing at room temperature.

1 XNativePurificationBuffer: (1X natural purification buffer):

100ML of1XNativepurification buffer (100 ML1X Natural purification buffer) is prepared by mixing 80ML of sterile distilled water 20mLof5XNativepurification buffer (20 ML of5 XNature purification buffer), adjusting pH to 8.0 with NaOH or HCl

BindingBuffer: (binding buffer)

Namely 1XNativepurification buffer1X (natural purification buffer)

WashBuffer: washing buffer

50mlof1XNativepurification buffer50 ml (1 Xnatural purification buffer), 335. mu. lof3MImidazole, pH6.0, 335. mu. m3 (imidazole), pH6.0, mix, NaOH or HCl, pH8.0

ElutionBuffer (elution buffer):

13.75mLof1XNativepurification buffer, 1.25mLof3 MImidazoles (imidazole), pH6.0, mix, NaOH or HCl adjusted to pH 8.0.

Cell lysis:

transferring a certain volume of bacterial culture solution into a 50mL centrifuge tube at 5000rpm, centrifuging for 5min to collect cells, discarding the supernatant, adding XmLBindingbuffer (binding buffer), and resuspending the cells;

inserting a 50ml centrifuge tube into a beaker filled with ice, performing sound crushing under the condition of 450w, performing ultrasonic treatment for 1s, stopping the operation for 3s for 15min, repeating the operation once, and taking 40 mu L of lysate for later use (marked as sample 1) after the crushing is finished;

centrifuging the crushed bacterial liquid at 12,000 rpm for 30min, transferring the supernatant into a new 50ml centrifuge tube, and taking 40 mu L of supernatant (sample 2) and a small amount of precipitation (sample 3) for later use;

samples 1, 2 and 3 were analyzed by SDS-PAGE and the remainder was stored at-20 ℃.

And (3) purification:

slowly inverting the Ni-NTAAgarose (agarose) in the bottle for 10 times;

3mL of resin is sucked and added into a 10mL purification column, and the resin is naturally precipitated for 5-10 minutes;

washing the column with sterile distilled water for 3-5 column volumes;

binding buffer (binding buffer) binding buffer column washing 3-5 column volumes;

loading a sample solution with the target protein amount of less than 70mg (storing the flow-through solution in a refrigerator at 4 ℃, sampling, running and analyzing);

WashBuffer (wash buffer) wash column 3-5 column volumes (effluent stored in 4 ℃ refrigerator, sample run gel analysis);

ElutionBuffer (elution buffer) elutes the protein of interest;

from the beginning of elution, one tube is added every 0.5mL until no protein is eluted;

0.5M NaOH column 3-5 column volumes;

washing the column with sterile distilled water for 3-5 column volumes;

washing the column with 20% ethanol for 3 column volumes, soaking the filler with ethanol 2cm higher than the filler and 20%, and storing at 2-8 deg.C.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

Claims

1. A reinforced adjuvant is characterized by comprising mineral oil 3:1 lanolin (v/m), 0.01% skl (m/v), 1mg/ml inactivated BCG, 50 microgram/ml IL32 gamma active protein and 12% Tween 80.

2. The enhanced adjuvant of claim 1 wherein said IL32 γ further comprises 6 different isforms of IL32Beta, IL32Delta, IL32Alpha, and the like, and the amino acid sequence is: 31Ala-234 Arg.