CN110777153A - Populus deltoides androgenesis gene MmS and application thereof - Google Patents

Abstract

The invention discloses a populus deltoids male promoting gene MmS and application thereof, and belongs to the technical field of plant genetic engineering. The male specific androgenesis promoting gene MmS of populus deltoides disclosed by the invention does not encode protein, but adsorbs miRNA as miRNA sponge, and the concentration of adsorbed free miRNA is reduced, so that the expression level of a downstream target gene is up-regulated. MmS gene exists in the male poplar as hemizygous seed, only on Y chromatid, and X chromatid does not contain the gene. The androgenic gene makes the male flower of male poplar grow, while the female poplar does not contain the gene, so that the male flower organ of the female poplar does not grow. A great amount of pollen can be generated after the male poplar reaches the sexual maturity age, so that the serious environmental pollution is caused, MmS gene is knocked out from the male poplar, a new poplar strain which does not generate pollen can be cultivated, the gene can also be introduced into a plant, the development of male flowers is promoted, and the gene has important application value in poplar breeding.

Description

Populus deltoides androgenesis gene MmS and application thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a populus deltoids androgenetic gene MmS and application thereof.

Background

The vegetative chromosome origin hypothesis states that sex chromosomes originate from an autosomal chromosome. The evolution of sex chromosomes begins with the occurrence of a male or female sterile mutation on one chromosome of the pair of autosomes. The vegetative chromosome origin hypothesis states that sex chromosomes originate from an autosomal chromosome. The sex chromosome evolves from the generation of a male or female sterile mutation on one chromosome of the pair of autosomes, the recombination of the mutation part is inhibited due to some unknown reason, and the non-recombination region gradually expands to finally form the heterotypic sex chromosome. The heterogynic plants are evolutionarily appeared in a shorter time than the closely related homogynic plants, which have evolved from the homogynic plants. Theoretically, the evolution of plants from hermaphrodite to hermaphrodite involves two genes with opposite functions, namely a female suppression gene and an androgenesis promotion gene, which act on the development of female flowers or male flowers independently.

In recent years, research on cloning of plant-specific genes has been advanced, for example, in the 2014 SCIENCE journal, sex-determining gene OGI of persimmon is published, the gene OGI is a Y-specific hemizygous element and encodes an miRNA, the regulated target gene is a MeGI gene located on an autosome, and the MeGI gene encodes a transcription factor which has a homeotropic domain and regulates anther fertility. Thus female sex of persimmons occurs due to the inhibition of the target gene MeGI located on the autosome by miRNA encoded by the OGI gene located on the Y chromosome. However, only one sex-regulating gene is found in persimmons, and the authors of the paper believe that there may be another sex-determining gene in persimmons that is not found. In addition, in 2017 and 2018 published researches on sex differentiation of asparagus and kiwi, two sex-determining candidate genes are respectively found, and the results of gene function researches show that the two sex-determining candidate genes are independent and opposite in function and respectively act on the development of female or male floral organs. Asparagus and Chinese gooseberry are both pseudo-male and female, i.e. female flower and male flower have normal structure of the floral organs of opposite sex respectively, but two sex-determining genes cause the floral organs of opposite sex to be aborted respectively, resulting in male and female differentiation. The sex differentiation of the two plants was not significantly different at the early stage of flower development, and the sex difference between male and female was found at the later stage of flower development.

Poplar is a typical hermaphrodite plant, and neither male nor female flowers develop in floral organs of opposite sex. Dynamic observation of the development process of the flower buds of the poplar shows that although the poplar blooms in early spring, microscopic observation of paraffin sections shows that the flower bud differentiation of the poplar is completed in the 6 months of the last year. Thus, the poplar sex-determining gene functions early in flower development, determining the formation of female and male flower primordia, respectively. The cytological observation and research carried out in the past shows that the poplar genome has no sex chromosome with obvious morphological difference, and the sex chromosome is still in the early stage of evolution. Although the sex-type two-sex of poplar is mainly shown in the morphological difference of flower organs, a lot of researches show that the female and male strains of poplar have significant difference in environmental adaptability, growth speed and biomass yield traits. Sex has significant influence on growth traits, and male plants are generally superior to female plants. After sexual maturity, female plants can generate a large amount of flying flocs, which causes serious air pollution, and has triggered more and more social concerns. And after the male poplar plants reach the sexual maturity age, a large amount of pollen is generated, so that the serious environmental pollution is caused. Therefore, in the case of afforestation or greening using poplar, the important influence of sex should be sufficiently considered, but the sex-determining gene of poplar has not been cloned and determined.

The poplar is widely distributed, grows rapidly, is tall and straight, has wide application range, is an important artificial forest planting tree species, and the wood is mainly used for industrial materials and becomes an important processing raw material in the industries of plywood, fiberboard, papermaking and the like. China is the world with the largest poplar cultivation area, and the area of poplar artificial forests reaches 853 ten thousand hectares (the eighth national forest resource clearing result). As the juvenile period of the poplar is very long and reaches 6-7 years, the molecular basis for sex regulation is clarified, the method has important application value for early sex identification and molecular breeding of the poplar and is beneficial to development and utilization of poplar resources with different sexes.

Disclosure of Invention

In view of the above problems in the prior art, the technical problem to be solved by the present invention is to provide a populus deltoids androgenetic gene MmS. The invention also aims to provide an application method of the populus tremuloides androgenesis gene MmS.

In order to solve the technical problems, the technical scheme adopted by the invention is as follows:

an androgenic gene MmS of populus deltoides has a nucleotide sequence shown in SEQ ID NO. 1.

The carrier, the recombinant bacterium or the host cell containing the stamina promoting gene MmS of the populus deltoides.

Preferably, the vector is pCambia2301-35S-plus-Mms overexpression vector.

The male promoting gene MmS of populus tremuloides is applied to the early sex identification of populus tremules and the molecular breeding of populus tremules.

Preferably, the application of the androgenic gene MmS of the populus tremuloides in molecular breeding of the populus tremuloides comprises the following steps:

1) preparing a poplar MmS gene knockout vector;

2) knocking out an androgenesis gene MmS in a male poplar plant;

3) and cultivating and screening to obtain the poplar plant with male flowers which do not develop or produce pollen.

The application of the androgenic gene MmS of the populus tremuloides in promoting the development of male flowers of plants comprises the following steps:

1) constructing a poplar MmS gene vector;

2) transforming the constructed poplar MmS gene vector into a plant or a plant cell;

3) and culturing and screening to obtain plants with increased stamens or enhanced stamens development.

Has the advantages that: compared with the prior art, the invention has the advantages that:

the invention discloses a male specific androgenesis promoting gene MmS of populus deltoides, which is not used for coding protein, but used as miRNA sponge for absorbing miRNA, and the concentration of the absorbed free miRNA is reduced, so that the expression level of a downstream target gene is up-regulated. MmS gene exists in the male poplar as hemizygous seed, only on Y chromatid, and X chromatid does not contain the gene. The androgenic gene makes the male flower of male poplar grow, while the female poplar does not contain the gene, so that the male flower organ of the female poplar does not grow. A large amount of pollen can be generated after the male poplar reaches the sexual maturity age, so that serious environmental pollution is caused, MmS gene is knocked out from the male poplar, a new poplar strain without pollen can be cultivated, the environmental problem caused by pollen pollution can be solved, and the juvenile period of the poplar reaches 6-7 years, so that the gene has important application value in the early sex identification and poplar breeding of the poplar; meanwhile, the gene can also be introduced into a plant to promote the development of male flowers, and is another important way for applying the gene.

Drawings

FIG. 1 is a schematic diagram of a chromosome fragment specific to male poplar; the circular fragment on SDR-Y shows a specific fragment on Y chromatid, the fragment contains FERR-R, MmS gene and a transposon sequence;

FIG. 2 is a diagram of the differentiation process of male and female flower buds of poplar; 2A shows the morphological changes of the female and male flower buds at the corresponding period; 2B, displaying longitudinal section microscopic observation of the paraffin sections of the female and male flower buds at the corresponding period; the lower right arrow indicates the anthers of the male flowers, the remaining arrows indicate the floret primordium of the female, male flower buds;

FIG. 3 is a schematic diagram showing the dynamic transcriptional expression of poplar male specific MmS gene; stage S5 shows the comparison of expression levels of MmS gene in flower buds with and without scales removed;

FIG. 4 is a diagram showing the function of a poplar male specific MmS gene as miRNA sponge adsorbing miRNA; the MmS gene is displayed at the upper part of the figure, the MmS gene transcription is displayed at the middle part of the figure, the action site of MmS gene transcript is displayed at the lower part of the figure, and the action site 2 adsorbs miR172 a;

FIG. 5 is a molecular control model diagram of poplar male specific MmS gene; 5A shows that the male strain of poplar contains MmS gene, while the female strain does not contain MmS gene; 5B shows the difference in the adsorption of miRNAs in the male and female poplar strains; 5C shows that the expression level of the corresponding target gene is reduced in the female compared with the male due to the difference of the miRNAs adsorption effect in the female and male poplar.

FIG. 6 is a diagram showing the result of functional verification of the transgenic poplar MmS gene in Arabidopsis thaliana;

Detailed Description

The invention is further described with reference to specific examples.

Example 1

(1) Obtaining male specific MmS gene of populus tremuloides

And (3) carrying out poplar sex determination gene mapping by using the populus tremuloides holomorphic mapping population, wherein the sex determination gene is mapped to the tail end of the nineteenth chromosome. Sex linkage analysis finds that the poplar sex determination gene is heterozygous for males, which indicates that the populus tremuloides sex is an XY determination system. According to the genome sequence of male populus tremuloides, an SSR marker is designed in a sex determination region, then local region fine mapping is carried out on the sex determination gene region, haplotype construction is carried out on the sex determination gene region, and a Y specific hemizygous fragment is arranged on a Y staining monomer of the populus tremuloides. And carrying out whole genome re-sequencing by utilizing the collected natural population germplasm materials of the populus tremuloides. Using the resequencing data, we performed correlation analysis of whole genome Read coverage with sex genes. The results show that no female-specific hemizygous fragment is present in the female strain, whereas the Y-specific hemizygous fragment detected by the haplotype construction is conserved at the population level, i.e., all male individuals contain this Y-specific hemizygous fragment. Two non-coding genes were obtained from this fragment by sequence annotation, one of which was 2468bp in length and was designated MmS, and the specific sequence was shown in SEQ ID NO.1 (FIG. 1).

(2) Dynamic transcription expression analysis of poplar male specific MmS gene

Gene annotation revealed that the MmS gene does not encode a protein, and its transcript does not contain a polyA tail. Therefore, the lncRNA-Seq technique is used to detect the expression level of the gene. In order to measure the expression of MmS genes in male and female poplar strains, female and male flower buds of populus tremuloides are sampled from 6 months in 2018 until 1 month in 2019, and 9 sampling time points are set, namely S1 (No. 6/3 in 2018), S2 (No. 18 in 6 months in 2018), S3 (No. 3 in 7 months in 2018), S4 (No. 18 in 7 months in 2018), S5 (No. 3 in 8 months in 2018), S6 (No. 18 in 8 months in 2018), S7 (No. 3 in 9 months in 2018), S8 (No. 1 in 12 months in 2018) and S9 (No. 15 in 1 months in 2019). The morphological change of flower bud development is shown in figure 2A, and microscopic observation of paraffin section shows that the male flower bud can be distinguished in No. 3 of 6 months. In the above collected samples, the proportion of floral organs to the whole flower buds before 7 months and 18 months is very low, and the flower buds are not peeled off. The sample after 8 months 3 was peeled off at the time of sampling. To compare the control samples peeled and non-peeled, the flower buds peeled and non-peeled at the time point of S5 were used as controls, respectively. After RNA is extracted from the collected sample, gDNA is removed by adopting a one-step method and cDNA reverse transcription synthesis is carried out. Quantitative primers were designed for the gene of interest MmS. The reference gene is PtUBQ. The real-time quantitative PCR experiment program is as follows: prepare 20. mu.L reaction system including 100ng cDNA, 4pmol upstream and downstream primers, 10. mu.L AceQqPCR SYBR Green Master Mix, sterile ultrapure water to make up to 20. mu.L. The reaction step, first 95 ℃ denaturation for 3 minutes, then 40 reaction cycles including 95 ℃ denaturation for 15 seconds, 60 ℃ annealing for 15 seconds, 72 ℃ extension for 30 seconds. Calculation of Gene expression Using 2- ^ΔCTMethod, i.e. Δ CT ═ CT _{Target gene}-CT _{Internal reference gene}. And (3) detecting whether the expression difference between the male sample and the female sample is significant at the same sampling point by using a T test method. The results of the assay showed that the MmS gene was constitutively expressed in a male-specific manner (FIG. 3).

(3) Function and molecular regulation mode of poplar male specific MmS gene

lncRNA sequencing shows that MmS gene is expressed in leaf and flower bud in different development stages, but transcript is not translated into protein, MmS gene transcript sequence analysis shows that the 3526 gene transcript contains a plurality of sites which are highly matched with different miRNAs, and MmS gene transcript can play a biological function by adsorbing matched miRNAs. Setting the number of mismatch bases of the acting sequence at most to 5, we found a total of 8 sites on MmS gene transcripts to which different miRNAs adsorbed. FIG. 4 shows MmS gene transcripts detected by lncRNA sequencing and their action sites adsorbing different miRNAs, wherein the adsorption of miR172a by action site 2 is shown in FIG. 4, and the sequences of other action sites and adsorbed miRNAs are shown in Table 1.

TABLE 1 MmS Gene transcripts and their sites of action for adsorbing different miRNAs

8 action sites on MmS gene transcripts adsorb 7 miRNAs together, and miRNAs adsorbed on the sites 3 and 4 are the same and adsorb miR156 k. In the miRNAs adsorbed by MmS gene transcripts, miR156, miR159, miR172 and miR319 are all proved to participate in flower development regulation in other plants, and the MmS gene transcript regulates the levels of miR156, miR159, miR172 and miR319 through adsorption, which indicates that MmS gene has a regulation effect on poplar flower development. The site of action also shows the presence of some specific miRNAs related to the regulation of floral development in poplar. Fig. 5 shows the molecular regulatory pattern of the MmS gene as a miRNAs sponge: MmS the transcription of gene generates RNA chain with multiple action sites, and the small brushes with different colors in the figure represent miRNAs with high matching degree with the action sites, and the action sites can generate adsorption effect on corresponding miRNA. Due to the adsorption of MmS gene transcript to miRNAs acting with it, the concentration of adsorbed free miRNA was reduced, thus inhibiting the action of these miRNAs on their target genes, up-regulating the corresponding target gene expression, which should be androgenic since MmS gene is male specific constitutive expression.

(4) Genetic transformation verification of poplar male specific MmS gene function

Taking male plant flower buds of populus deltoides as materials, extracting genomic DNA by utilizing a plant genome extraction kit (Qiagen, Valencia, CA, USA), carrying out PCR (polymerase chain reaction) by using a primer F _ Mms-in-fu-F/R and high-fidelity pfu enzyme after determining the quality of the genomic DNA by agarose gel electrophoresis, wherein the PCR reaction conditions are as follows: the first round of reaction is at 94 ℃ for 2 min; then, 35 times of circulation are carried out, each time at 94 ℃ for 1 min; 1min at 55 ℃; 3min at 72 ℃; after the circulation was completed, the extension was carried out at 72 ℃ for 5 min. And purifying and sequencing the PCR product to obtain a target sequence Mms. Mms was inserted between KpnI and BamHI downstream of 35S promoter in pCambia2301-35S-plus binary vector using recombinase to form pCambia2301-35S-plus-Mms overexpression vector. The over-expression vector pCambia2301-35S-plus-Mms was transformed into Agrobacterium GV3101 by freeze-thaw method. Arabidopsis thaliana (Clo-0) transformation Using the inflorescence dip method (Clough and Bent, 1998), transgenic plants of the T1 generation were obtained by kanamycin (50mg/ML) selection, the kanamycin resistance gene being homozygous for T ₃The plants of the generations were subjected to the relevant phenotypic analysis (with the contemporary wild type as reference). As a result, the populus MmS gene is over-expressed in Arabidopsis, stamen development of floral organs is significantly influenced, the Arabidopsis wild-type floral organ is a four-strong stamen, namely the floral organ has 6 stamens, 4 of the stamens are longer, the other 2 of the stamens are shorter, the transformed plant generally presents six-strong stamens, in addition, the phenotype that the stamens are increased by 7 or even 8 stamens is also observed, and the phenotype that some stamens are forked or develop two anthers is also observed (figure 6). The result of genetic transformation confirmed that MmS gene is an androgenic gene. After the male poplar plants reach the sexual maturity age, a large amount of pollen is generated, and pollen floating causes various environmental problems such as allergy and the like. Therefore, MmS gene is knocked out from the poplar male plant, and the poplar plant with undeveloped stamens or no flying powder can be obtained; the MmS gene can also be introduced into a plant with weak stamen development to promote the overexpression of the gene, so that the stamen development is enhanced, and pollination and beneficial fructification are promoted, thereby being another beneficial application mode of the gene. Therefore, the poplar MmS gene has important breeding application value.

Sequence listing

<110> Nanjing university of forestry

<120> populus deltoids androgenesis gene MmS and application thereof

<130>100

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>2468

<212>DNA

<213>Populus deltoides

<400>1

ctacttgttg gtaactttca tgcaacaata tttgtattgc ccgtaggcaatgttcacata 60

gcaatatttc ttgttgtaac ccatttttgg gtccccacaa ataaaataaa ataaaaaggg 120

aacactgttc atctctctct ctctccacac actgcctaaa gccccacgcc ccttaaaaca 180

tggaacagtg gccgaaccta aagccccacg ccccttgtct ggccgaccaa ccgtcgcgtg 240

ccctgctctc catgcacaac agcaggccgc tcccctgctc cccacgcgca acagcagccc 300

gcgcccctct agcctataaa tactgctctc aataccagca gcaggggagg ggggatggga 360

aggacgagag gtagagtttt gaacgataga gagggatctt ttgaaactaa aaggggaggg 420

aagttttgaa acaaagaaag ctactgtgag agggtaggaa gagaggaaat gagataggaa 480

aagaagggga gaaaaacaca aaagaaggaa cgaaagcagg aacgaaagca ggggaacctt 540

tgaaaagttg aacgagagaa gagtgaacgg agagaagaga aggaaaggat ttctgaaata 600

aagggaggga aatacaaaca caccatcacc tgcttctccc tccagtcgct gcaccattgg 660

aagaaaaggc ggcacctact cctctgcacg gggaagaaga aggagtaaac agttgttgtc 720

ctcaagcttc ccagccactg tcatcttcct cccacccgtt gctgcgccat ttgaagaagg 780

gcaacgacct gcaactctac tcaaacgaag aaagcagcag caagacactt tcagacacca 840

aggagagctc atcatcttca tcccagccat tccctaccac ctgcacctcc atgaagctgc 900

tatagagagg gaagaacagc gttgatagag ggaacaaagg aaaccaagag aagaagcaac 960

gcctctgcag aagggaagaa aaaacagctg ccatcaccgg cttcctctcc accaccaaca 1020

gcacctccac aaagccgctg cagagaagga agaacaaggt tgacagaggg aacaaaggaa 1080

acaggggaga acaaagctga agaaaaaaca acagagagga ggaagagcag ccgcagcaac 1140

gccaccgcca aaccggccac cagcaccacc gtcagcccat ctatccaagc tcatcatctc 1200

aggtaaacct tcctgttatc accgtttagg ggtcatcttc ttgcatgcag aacatgcaca 1260

gtgcacgttc tgcaagcaag aaaataatta gccggtaccc cggttactat gcgtgtacag 1320

taacccgatg tacagtaacc ccggttactg ttgtgttggg ctggaacccc agcccagccc 1380

ctgtggctgg actgagtcca gccctgtaga aagtaggccc gttttatttc aggccgattt 1440

cggcccagtc tccttttggg ccgggtccgg tctagtaaaa aaaattttta aattccaaaa 1500

aaaaaacttt tcaaaaatct gtgattttcc gcaattttgt tactgcattt tgatcaatat 1560

cggtttgtat ttttatactg taaagataca aatccgatat taaaataccc ggtttttgtc 1620

aagtttcaaa aaaaaatgtt ttgttttcat gcatacggcc tagtctctcc aatatatata 1680

tatatataaa tattataaca tcatattttc acacaacaaa ggaaatttca aaataatata 1740

tgtattagca tgcattttgg ctttaataac cagtttattc aagccatgag aactaggcca 1800

atatttcaaa aattctaaaa aaaatctttt tgtcttcttt tagtatcttg gattacgaat 1860

ttatacgtaa aacgtattcc taatattaaa aatatgattt ttttacatag acgttagaac 1920

ggttaggttt tacccgataa gataaggacc tccttattta ggaggacttt tcttgaacca 1980

tagacggacc aacaactaga aatacaataa caccttagct ttttatcaga caatcaaaca 2040

atgcagctta ccttaggtaa ggcgtatttg aggtgctaat acatttcctt tacgcaacca 2100

gtccccgtgc ccgatctcta agaccagtta gggttcctag tgaccaaaat actaggtggc 2160

gactcccatt ccattttcca ccgacaagag acaaagaatt ccttgtctcc ccatatgtgc 2220

cagatagata ccatacacac ttcctagatt taaagtggga tatctgccgc gacgccgcac 2280

acgtgcgaca tttctcatga tacacagtag tacaaaatac gcataatgtc tatcatataa 2340

ctagcatgac aagaatttaa acaatttgaa gaagcaaggg ggcaaccctt accttgaact 2400

cctgttgtac ttgcacgcga gaagtcgggt cccactttgt atacttctct tacattccag 2460

tagaacat 2468

<210>2

<211>21

<212>RNA

<213>Populus deltoides

<400>2

gucguaagac gucucucuaa u 21

<210>3

<211>21

<212>RNA

<213>Populus deltoides

<400>3

uucccuucug cagaggcguu g 21

<210>4

<211>21

<212>RNA

<213>Populus deltoides

<400>4

ccgaagacga agaaguaaac c 21

<210>5

<211>22

<212>RNA

<213>Populus deltoides

<400>5

ugcugcugcu uucuucguuu ga 22

<210>6

<211>20

<212>RNA

<213>Populus deltoides

<400>6

cacgagggag agaagacagu 20

<210>7

<211>20

<212>RNA

<213>Populus deltoides

<400>7

ccuuuccuuc ucuucucucc 20

<210>8

<211>20

<212>RNA

<213>Populus deltoides

<400>8

ucguuccuuc uuuuguguuu 20

<210>9

<211>20

<212>RNA

<213>Populus deltoides

<400>9

cccucgaggg aagucagguu 20

<210>10

<211>20

<212>RNA

<213>Populus deltoides

<400>10

aguagcuuuc uuuguuucaa 20

<210>11

<211>21

<212>RNA

<213>Populus deltoides

<400>11

aucucgaggg aaguuagguu u 21

<210>12

<211>21

<212>RNA

<213>Populus deltoides

<400>12

aguagcuuuc uuuguuucaa a 21

<210>13

<211>21

<212>RNA

<213>Populus deltoides

<400>13

accguacguc ccucgguccg u 21

<210>14

<211>21

<212>RNA

<213>Populus deltoides

<400>14

uugcgcgugg ggagcagggg a 21

<210>15

<211>21

<212>RNA

<213>Populus deltoides

<400>15

uacgucguag uaguucuaag a 21

<210>16

<211>20

<212>RNA

<213>Populus deltoides

<400>16

uagcagcuuc augaggugca 20

Claims (6)

1. An androgenic gene MmS of populus deltoides has a nucleotide sequence shown in SEQ ID NO. 1.

2. A vector, recombinant bacterium or host cell comprising the populus tremuloides androgenic gene MmS of claim 1.

3. The vector of the stamina-promoting gene MmS of Populus deltoides as claimed in claim 2, wherein the vector is pCambia2301-35S-plus-Mms overexpression vector.

4. The populus tremuloides male promoting gene MmS as claimed in claim 1, used for early sexual identification of populus tremula and molecular breeding of populus tremula.

5. The use of the androgenic gene MmS of populus tremuloides as claimed in claim 4 in molecular breeding of poplars, comprising the steps of:

1) preparing a poplar MmS gene knockout vector;

2) knocking out an androgenesis gene MmS in a male poplar plant;

3) and cultivating and screening to obtain the poplar plant with male flowers which do not develop or produce pollen.

6. The use of the androgenic gene MmS of populus tremuloides as claimed in claim 1 for promoting the development of male flowers in plants, comprising the steps of:

1) constructing a poplar MmS gene vector;

2) transforming the constructed poplar MmS gene vector into a plant or a plant cell;

3) and culturing and screening to obtain plants with increased stamens or enhanced stamens development.

Images