CN110777149A

CN110777149A - Pine wood nematode tra-1 gene and application thereof in development interference

Info

Publication number: CN110777149A
Application number: CN201910976104.9A
Authority: CN
Inventors: 刘振宇; 王念昭; 李江梅
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2019-10-15
Filing date: 2019-10-15
Publication date: 2020-02-11

Abstract

The invention relates to the technical field of nematode disease control, in particular to a tra-1 gene of pine wood nematodes and a patent application for preventing and treating the pine wood nematode disease by utilizing the gene to interfere the development of the pine wood nematodes. The pine wood nematode tra-1 gene cDNA sequence has a full length of 3231bp, contains 8 exons and 7 introns, and the initiation codon and the termination codon of the cDNA sequence are ATG and TGA respectively. The CDS sequence of the pine wood nematode TRA-1 gene formed by the exon is 2283bp in length, and the coded TRA-1 protein comprises 760 amino acids. The application clones the tra-1 gene of the pine wood nematode for the first time, analyzes the function of the gene and considers that the gene is closely related to the growth and development of the pine wood nematode, particularly sex determination; the dsRNA is adopted to carry out development interference on the pine wood nematodes, which can cause abnormal development of the pine wood nematodes, cause the pine wood nematodes to be obviously masculinized, and reduce the population fertility, and can be used for carrying out development interference so as to control the pine wood nematodes.

Description

Pine wood nematode tra-1 gene and application thereof in development interference

Technical Field

The invention relates to the technical field of nematode disease control, in particular to a tra-1 gene of pine wood nematodes and a patent application for preventing and treating the pine wood nematode disease by utilizing the gene to interfere the development of the pine wood nematodes.

Background

Pine wilt disease, also known as pine wilt disease, is a devastating epidemic disease of pine. The needle leaves of the susceptible pine tree are faded and yellowed firstly, and then withered to be reddish brown, and finally the whole pine tree is dead. After the pine tree is infected with the disease, the pine tree can die in the fastest one month time, and a pine forest can be destroyed quickly, so that a large-area forest destruction malignant disaster is formed. The damage severity of the pine wilt disease and the control difficulty thereof are regarded as the quarantine objects by countries in succession. The disease is found on Pinus thunbergii of Nanjing Zhongshan Ling in 1982 for the first time. The bursaphelenchus xylophilus causes serious influence in China, causes ecological disasters which are difficult to restrain, causes huge damage to tourist resources and numerous scenic spots and historic sites, and causes serious economic loss and immeasurable ecological loss.

Pine wood nematode has a life history divided into three stages, namely, egg, larva and adult, wherein the larva is divided into three stages, namely, second-instar larva, third-instar larva and fourth-instar larva.

The invention aims to solve the problem of controlling the pine wood nematode by using the gene tra-1 related to the development of the pine wood nematode to interfere the gene of the pine wood nematode.

The related documents report that: the tra-1 gene is the major gene for the shift in the model organism caenorhabditis elegans controlling phenotype. Mainly participates in biological processes such as RNA polymerase II regulation transcription, nematode development, cell differentiation, spermatogenesis, sex differentiation, gonad development, female germ line sex determination, female body sex determination, nerve cell apoptosis and the like. the tra-1 gene produces two mRNAs by differential mRNA splicing: TRA-1A and TRA-1B. Wherein the level of TRA-1A in the nuclei of the intestinal tissue and the germline of the hermaphrodite is significantly higher than that of the androgens during the critical phase of sex determination of the caenorhabditis elegans, i.e. during the differentiation of the gonads. Whether the tra-1 gene exists in the pine wood nematode or not, what function exists, whether the interference on the reproduction and development of the pine wood nematode can be generated or not is not reported at present.

Disclosure of Invention

The present invention aims to solve the above problems and provide an experimental scheme for obtaining a gene tra-1 related to development of bursaphelenchus xylophilus and performing gene interference by using the tra-1 to interfere with normal development of the bursaphelenchus xylophilus.

The invention relates to a pine wood nematode tra-1 gene and a method and a technical scheme thereof applied to development interference, which comprises the following steps:

(1) designing primers for cloning tra-1 genes of the pine wood nematodes;

(2) the procedure and the step of cloning tra-1 gene of the pine wood nematode;

(3) designing a pine wood nematode tra-1 gene interference dsRNA template primer;

(4) the pine wood nematode tra-1 gene interference technology is applied;

(5) and (3) inspecting the tra-1 gene interference effect of the pine wood nematode.

The step (1) is specifically as follows: the specific sequence of the primer sequence primer for PCR amplification of the pine wood nematode tra-1 gene is as follows:

tra-1-F：5’-ATGGCGGAGGGAGAGAGGAGCAA-3’

tra-1-R：5’-TCATGCATTCTCGAGTCTGAAATAC-3’

the step (2) is specifically that RNA of the pine wood nematode is extracted, cDNA is obtained through reverse transcription, a PCR reaction system is constructed, tra-1 gene PCR amplification is carried out, recombinant plasmid is constructed by utilizing a PCR amplification product and a plasmid vector, DH5 α competent cells are transformed, the recombinant plasmid is evenly coated on an LB culture medium plate which is specially processed for culture, a white single colony is selected and inoculated into an LB liquid culture medium containing ampicillin for culture, quantitative bacterial liquid is absorbed for PCR detection of the bacterial liquid, PCR amplification products are absorbed for agarose gel electrophoresis, if a target band appears, the PCR amplification product is sent for sequencing, the bacterial liquid and the LB liquid culture medium containing ampicillin are fully mixed and then are cultured on a shaking table, and the plasmid is extracted.

The step (3) is specifically as follows: strongyloides strand tra-1 gene dsRNA template primer sequence

BXY_dsRNA_T7F:TAATACGACTCACTATAGGGA TCCCCCTTTTCGCTCCGT BXY_dsRNA_T7R:TAATACGACTCACTATAGGGA CCCCTTGCCCACCTCCTG。

The step (4) is specifically as follows: constructing a tran-1 gene dsRNA dip-dyeing system of the second-instar larvae of the pine wood nematodes, culturing at 25 ℃ and 120rpm/min for 24h under shaking.

The step (5) is specifically as follows: after the dip dyeing is finished, selecting a certain amount of second instar larvae, inoculating the second instar larvae on a botrytis cinerea plate, culturing for 3-4d, and checking male-female ratio and fertility.

The experimental scheme for the gene interference of the pine wood nematode growth and development related gene tra-1 specifically comprises the following steps:

(1) designing primers for cloning tra-1 genes of the pine wood nematodes: the cDNA of the pine wood nematode is taken as a template, and a primer sequence of the tra-1 gene clone of the pine wood nematode is designed, which specifically comprises the following steps:

tra-1-F：5’-ATGGCGGAGGGAGAGAGGAGCAA-3’

tra-1-R：5’-TCATGCATTCTCGAGTCTGAAATAC-3’；

(2) the process and the step of pine wood nematode tra-1 gene cloning include that pine wood nematode RNA is extracted by a TRIZOL method, pine wood nematode cDNA is obtained through reverse transcription, after the quality is qualified, cDNA is used as a template, cloning primers and other components required by PCR amplification are added, a PCR reaction program is designed and operated on a PCR instrument, after a PCR amplification product is obtained, the PCR amplification product is incubated in a water bath kettle at 16 ℃ for 4 hours or overnight culture in a refrigerator at 4 ℃ so as to be connected with an expression carrier, then the PCR amplification product is transformed into escherichia coli DH5 α competent cells, a proper amount of transformed bacterial liquid is taken and coated on LB solid culture medium which is processed by 8 mu L20% (w/v) IPTG and 40 mu L20 mg/mL X-Gal and contains 100 mu L/mL Amp, inverted culture is carried out for 18-24 hours at 37 ℃, a white single bacterial colony is taken to be cultured in 5mL LB liquid culture medium which contains 50mg/mL Amp, then a proper amount is taken as a template to carry out PCR reaction, after the reaction system and the program are finished, 10 mu L of the gel electrophoresis is taken to detect whether a corresponding agarose strip of PCR product, and a PCR amplification product is detected;

(3) designing a tra-1 gene interference primer of the pine wood nematode:

according to the successfully cloned pine wood nematode tra-1 gene, a primer sequence of double-stranded dsRNA for the interference of the pine wood nematode tra-1 gene is designed, which specifically comprises the following steps:

BXY_dsRNA_T7F:TAATACGACTCACTATAGGGA TCCCCCTTTTCGCTCCGT

BXY_dsRNA_T7R:TAATACGACTCACTATAGGGA CCCCTTGCCCACCTCCTG；

(4) the application of the tra-1 gene interference technology of the pine wood nematode comprises the following steps: constructing an RNA interference dip-dyeing system by using the components of double-stranded dsRNA of the tra-1 gene of the pine wood nematode, an M9 buffer solution, 2-instar larvae of the pine wood nematode and the like, and performing shake culture at 25 ℃ and 120rpm for 24 h;

(5) inspecting the tra-1 gene interference effect of the pine wood nematode: selecting a proper amount of 2-instar pine wood nematode larvae after dip dyeing, cleaning with sterile water for 2-3 times, culturing on 5-7d of good-growth botrytis cinerea, filtering the pine wood nematodes by a Bellman funnel method, and detecting the sex ratio and the fertility of the pine wood nematodes by a common optical microscope.

The invention has the beneficial effects that: the tra-1 gene sequence is obtained, which plays an important role in revealing the development of the pine wood nematode.

The gene interference of the invention lays a good foundation for interfering the development of the pine wood nematodes and further being used for preventing and controlling the pine wood nematode diseases.

Drawings

FIG. 1 is a PCR amplification detection electrophoresis diagram of tra-1 gene of Bursaphelenchus xylophilus; wherein M represents the standard molecular weight of nucleic acid, and the 1-7 holes are a tra-1PCR electrophoresis result chart; FIG. 2 is an electrophoretogram of tra-1dsRNA detection of Bursaphelenchus xylophilus; wherein M represents the standard molecular weight of nucleic acid, and 1-4 is a graph of the electrophoresis result of tra-1 dsRNA;

FIG. 3 is a photograph of dysplasia of female adult pine wood nematode F0 after tra-1 RNA interference;

FIG. 4 shows the hermaphroditism ratio of the tra-1 RNA-interfered and blank control F0 adult bursaphelenchus xylophilus.

Detailed Description

For better understanding of the present invention, the technical solution of the present invention will be described in detail with specific examples, but the present invention is not limited thereto.

Example 1: cloning of Gene sequence of tra-1 Gene of Bursaphelenchus xylophilus

Collection of Bursaphelenchus xylophilus

Preparing a fresh botrytis cinerea culture dish for inoculation and culture for 5d and a pine wood nematode flat plate for growth for 5d, placing the fresh botrytis cinerea culture dish and the pine wood nematode flat plate on a super clean bench for over half an hour of ultraviolet sterilization, inoculating 1X 1cm nematodes, culturing at a constant temperature of 25 ℃ for 5d, filtering for 4 hours by a Bellman funnel method, collecting bottom nematode liquid, centrifuging, rinsing with sterile water for 2-3 times, rinsing with RNase-free water for 2-3 times, and removing supernatant for later use.

Extraction of pine wood nematode total RNA (Trizol method)

And quickly freezing the cleaned nematodes in liquid nitrogen. 200. mu.L of Trizol was added dropwise using a pipette gun, and the mixture was ground for 30 seconds using an electric tissue grinder. Then, 800 mu L of Trizol is quickly dripped, and the solution is placed in an environment at 25 ℃ for 10min after being completely and uniformly mixed. And (3) transferring 200 mu L of chloroform solution to a centrifuge tube by using a pipette gun, precooling the centrifuge tube at 4 ℃, adding the chloroform solution into the solution obtained in the previous step, carrying out vortex oscillation for 40 s, uniformly mixing the chloroform solution and the solution, and placing the mixture on an ice block for 15min for layering. Centrifuging at 4 deg.C at 12000r/min for 15 min. Slowly sucking the upper water phase, transferring to a new RNase-free 1.5mL centrifuge tube, adding 550 μ L of pre-cooled isopropanol, turning the centrifuge tube upside down to mix well, standing at room temperature for 10min, centrifuging at 12000rpm at 4 deg.C for 10min, and removing the supernatant. Adding 1mL of 75% RNase-free ethanol solution after precooling to wash the precipitate, centrifuging at 7500r/min at 4 ℃ for 5min, and repeating for 2 times. Removing supernatant with pipette, air drying alcohol at room temperature, opening the centrifuge tube cover, and standing for about 10 min. Add 20. mu.L of DEPC-treated water to dissolve the RNA, mix gently, and flash-dissociate for 5 s. Standing at room temperature for 15min, and placing in a refrigerator at 4 deg.C. RNA extraction quality detection, and purity and concentration determination.

Preparation of pine wood nematode total cDNA

The reaction conditions for removing genomic DNA were as follows:

TABLE 1 genomic DNA removal reaction System

And taking the reaction tube with the genome removed out of the PCR amplification instrument, sequentially adding reaction liquid, and uniformly mixing by using a liquid transfer gun. The reverse transcription reaction is carried out in a PCR instrument, and the reaction system comprises:

TABLE 2 reverse transcription reaction System

After the reaction, the cDNA solution was stored at 4 ℃. (Long-term storage at-20 ℃ C.)

Referring to the existing bursaphelenchus xylophilus whole genome database and transcriptome database, primers of a tra-1 gene coding region of the bursaphelenchus xylophilus are designed through Primer Premier 5.0 software, and specific sequences of the primers are as follows:

tra-1-F：5’-ATGGCGGAGGGAGAGAGGAGCAA-3’；

tra-1-R：5’-TCATGCATTCTCGAGTCTGAAATAC-3’。

PCR amplification of tra-1 gene of pine wood nematode

Performing tra-1(BXY _1647700) PCR amplification, wherein the PCR reaction system comprises:

TABLE 3 pine wood nematode tra-1PCR reaction System

And (3) PCR reaction conditions:

TABLE 4 pine wood nematode tra-1PCR reaction conditions

The PCR amplification product is temporarily placed in a refrigerator at 4 ℃ for standby, and is waited for electrophoresis.

Performing gel electrophoresis detection on the PCR amplification product to amplify a specific band of about 2300bp, which is consistent with the expected band size of 2283bp (the electrophoresis detection of the PCR amplification product is shown in FIG. 1).

Ligation of tra-1 Gene amplification products to cloning vectors

The gel recovery kit is selected for the experiment to collect target fragments of the tra-1 gene of the bursaphelenchus xylophilus and is carried out at room temperature.

An "A" tail is added to the 3' end of the tra-1DNA target fragment.

TABLE 5 reaction System

Placing the mixture in a constant temperature water bath kettle to react for 20 minutes at 72 ℃. And then standing for 1-2 minutes in ice.

Using a pipette gun, 8. mu.L of an IPTG solution having a concentration of 20% (w/v) and 40. mu.L of an X-Gal solution having a concentration of 20mg/mL were pipetted, and then the pipetted solutions were uniformly spread on LB solid medium containing 100. mu.L/mL of Amp to prepare the following DNA solutions in a microcentrifuge tube in a total amount of 5. mu.L. (dissolution of reagents in ice);

TABLE 6 DNA solution System

Adding 5 mu L (equivalent) of Solution I, incubating in a 16 ℃ water bath for 4h or overnight in a 4 ℃ refrigerator, adding the total amount (10 mu L) of the mixture into just melted 100 mu L of escherichia coli DH5 α competent cells, uniformly mixing, placing in an ice box for ice bath for 30min, placing in a 42 ℃ water bath for heat shock for 45s, then rapidly placing in an ice bath for 2min, adding 890 mu L of LB liquid culture medium into a centrifuge tube, placing in a shaking table for shaking recovery at 37 ℃ and 150rpm for culture for 60min, using a high-speed refrigerated centrifuge for 5000r/min, centrifuging for 2min, removing supernatant, reserving 100 mu L of culture Solution for heavy suspension precipitation, evenly coating the 100 mu L of concentrated culture Solution subjected to heavy suspension precipitation on the LB culture medium plate obtained in the step B, placing in an environment at 25 ℃ or so, and after the bacteria Solution is completely absorbed, placing in a culture dish in an inverted culture box for culture for 12-16 h, thus obtaining recombinant single-subunit bacterial colonies.

PCR detection of bacterial liquid

Picking the white single colony on the culture medium in the step [0027] and inoculating the white single colony in 5mL LB liquid culture medium containing 50mg/mL Amp; shaking and shaking the bacteria at the speed of 200rpm at the temperature of 37 ℃ for about 8 hours; then taking a proper amount of bacterial liquid as a template to carry out PCR reaction, wherein the reaction system and the procedure are the same as the previous one; after the reaction, 10. mu.L of the PCR product was subjected to agarose gel electrophoresis to detect whether there was a band of the corresponding size. The electrophoresis result shows that a 2300bp specific band is consistent with the expected band size of 2283 bp.

(11) Sequencing of target bands

After the PCR detection of the bacterial liquid is correct, the bacterial liquid is sequenced by Beijing Huada gene.

The sequencing result shows that the inventor obtains a nucleotide sequence with the length of 2283bp, namely a cDNA sequence of the tra-1 gene of the bursaphelenchus xylophilus.

Example 2: based on the results of example 1, a dsRNA template of a tra-1 gene was prepared using a cDNA sequence of the tra-1 gene

Design of primer for dsRNA template of tra-1 gene

According to the sequence of the cloned pine wood nematode tra-1 gene, two pairs of specific primers with T7 promoter are designed and synthesized by using Primer Premier 5.0 software. Primers were designed as shown in table 7:

TABLE 7 Bursaphelenchus xylophilus tra-1 gene dsRNA template primer sequences

Synthesis of tran-1 gene dsRNA template of pine wood nematode

The tra-1cDNA sequence template recovered in example 1 was subjected to PCR amplification using the primers obtained in step [0032] as amplification primers. Wherein BXY _1647700T7F and BXY _1647700T7R are amplified to obtain a tra-1 gene dsRNA template, and the reaction system is as follows:

TABLE 8 pine wood nematode tra-1dsRNA template PCR reaction system

The reaction procedure was as follows:

TABLE 9 pine wood nematode tra-1dsRNA template preparation PCR reaction program

Recovery of TRA-1 gene dsRNA template glue

And (3) recovering the dsRNA template of the tra-1 gene in the PCR product obtained in the step [0033 ]. The concentration and purity of the DNA fragment were checked by a nucleic acid instrument, and the specific product was recovered by 1% agarose electrophoresis.

Synthesizing a tran-1 gene dsRNA of the pine wood nematode:

TABLE 10 pine wood nematode tra-1 gene dsRNA template synthesis reaction system

Sucking up and down, mixing evenly, centrifuging briefly, and carrying out water bath tra-1(6h) in a constant-temperature water bath kettle at 37 ℃. Bathing at 75 deg.C for 5 min. The dsRNA was synthesized by standing at room temperature.

TABLE 11 pine wood nematode tra-1dsRNA template genome removal reaction system

After gentle mixing by pipetting up and down and brief centrifugation, the DNA and ssRNA were removed by incubation at 37 ℃ for 1 h.

tra-1 gene dsRNA purification

The reaction system was formulated on ice: 100. mu.L of dsRNA (previous step), 100. mu.L of 10 XBinding buffer, 300. mu.L of nucleic-Free Water, and 500. mu.L of 100% ethanol were sequentially added to a 1.5mL centrifuge tube. Sucking up and down, beating and mixing evenly. Suspending the mixed solution in a filter element of a collecting pipe, centrifuging at 13000rpm for 2min, and discarding the waste liquid. Adding 500 mu L of WashBuffer in a suspending way to clean the filter element, removing waste liquid after centrifugation, and repeating once. And (4) centrifuging for 5min in an empty tube after the waste liquid is removed, and removing the residual waste liquid. Transferring the adsorption column into a new collection tube, suspending and adding 50-100 μ L of the eluent preheated at 95 deg.C, standing at room temperature for 2min, and centrifuging at 13000rpm for 2 min. The resulting purified dsRNA was stored in a-20 ℃ freezer.

Example 3: based on the results of example 2, developmental interference Using dsRNA of tra-1 Gene

Filtering the plate for culturing 5-7d of Bursaphelenchus xylophilus for 4-6h in an incubator at 25 deg.C by Bellman funnel method, collecting nematode liquid about 4cm from the bottom of rubber tube of funnel, picking 2-year larvae of Bursaphelenchus xylophilus under microscope, and washing with sterile water for 2-3 times;

dsRNA treatment group: 120 mu L of dsRNA solution (with the final concentration of 1.0ug/uL), 260 mu L of M9 buffer solution, constant volume of 500 mu L and nematode concentration of 4 strips/mu L; taking a dip-dyeing system with the same volume of DEPC treated water instead of the dsRNA solution as a control group, and repeating the test for 3 times;

incubated at 25 ℃ for 24h with shaking at 120rpm in a shaker.

After detecting the development interference of the pine wood nematode through the dsRNA of the gene, the growth and development of the pine wood nematode and the development of offspring are inhibited.

Based on the above results, after developmental interference using dsRNA of the tra-1 gene of bursaphelenchus xylophilus, the growth and development thereof and the development of offspring were inhibited.

After dsRNA interference of the tra-1 gene on second-instar larvae of the pine wood nematode, the female-male ratio of the developed contemporary (F0 generation) adult is 1.669, which is obviously smaller than that of the blank control F0 adult (2.258), and the female-male ratio of the dsRNA treatment group and the blank control group is obviously different at the level of P & gt 0.05.

the tra-1dsRNA can influence the development of male and female systems of the pine wood nematode individuals, so that the pine wood nematode individuals develop in a masculinizing way, and the male and female ratio in the pine wood nematode population is reduced.

Finally, it should be noted that the above-mentioned embodiments are only preferred examples of the present invention, and the present invention is not limited thereto, and although the present invention has been described in detail with reference to the embodiments, it will be apparent to those skilled in the art that modifications and equivalents can be made in the technical solutions described in the above-mentioned embodiments, or some technical features can be replaced. Any modification, equivalent replacement, or amendment made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Shandong university of agriculture

<120> pine wood nematode tra-1 gene and application thereof in development interference

<130>none

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>3231

<212>DNA

<213>Bursaphelenchus xylophilus

<400>1

<210>2

<211>2283

<212>DNA

<213>Bursaphelenchus xylophilus

<400>2

<210>3

<211>760

<212>PRT

<213>Bursaphelenchus xylophilus

<400>3

Met Ala Glu Gly Glu Arg Ser Asn Asp Arg Asp Tyr Arg Asp Gln Gln

1 5 10 15

Ile Val Val Val Gln Ser Asp Ser Asp Asp Glu Ser Ile Asp Val Glu

20 25 30

His Trp Ser Asp Asp Asp Ile Ser Asn Asp Leu Val Glu Glu Ile Ser

35 40 45

Val Gly Val Ser Lys Glu Val Arg Glu Ser Ser Ala Ser Thr Pro Ile

50 55 60

Ser Lys Asn Glu Ser Val Ser Ser Gly Arg Gly Ser Arg Ala Thr Lys

65 70 75 80

Glu Glu Arg Ser Asn Ser Arg Ser Leu Ala Thr Gln Thr Gly Leu Ala

85 90 95

Ser Gly Lys Leu Ser Pro Gly Gln Leu Lys Arg Thr Pro Asp Ser Leu

100 105 110

Gln Ser Leu Asn Gly Leu Ser Pro Lys Ser Ser Ile Ala Ser Leu Asn

115 120 125

Val Val Asp Phe Ala Asn Asn Phe His Ala Asn Leu Asn Cys Asn Asp

130 135 140

Asp Gly Ser Thr Thr Asp Ser Gly Val Ser Ser Ala Pro Ser Ser Ser

145 150 155 160

Ser Arg Val Ser GlyLys Arg Thr Ala Gln Lys Asp Ser Gln Ile Trp

165 170 175

Met Asp Tyr Leu Ser Lys Ala Ile Arg Trp Pro Phe Pro Val Asn Gln

180 185 190

Gln Val Leu Met Met Ile Ala Asn Gln Ser Gly Ala Ser Ser Ser Gln

195 200 205

Phe Pro Gln Phe Met Pro Ser His Pro Gln Met Pro Ser Gln Ser Thr

210 215 220

Pro Ser Thr Gly Phe Gln Pro Val Pro Pro Val Ile Gln Asn Phe Gln

225 230 235 240

Thr His Pro Ala Ser Phe Gly Thr Glu Ala Ser Ser Ser Asn Glu Lys

245 250 255

Pro Lys Lys Pro Lys Ser Asp Ser Ser Ser Gly Ser Ser Thr Leu Pro

260 265 270

Gly Cys Glu Ala Phe Thr Ser Thr Ser Met Asn Phe Pro Ser Gly Thr

275 280 285

Phe Gly Gly Thr Pro Gln Met Gln Pro Pro Tyr Val Ser Asn Ala Gln

290 295 300

Met Pro Pro Arg Ile Asp Asn Ala Lys Pro Gly Met Phe Pro Asn Trp

305 310 315 320

Ser Lys Pro Pro Ala Asn GlnAla Leu Val Pro Pro Arg His Ser Ala

325 330 335

Asp Thr Phe Ser Ala Asn Met Pro Gln Tyr His Gln Asn Ala Phe Leu

340 345 350

Val Pro Pro Phe Arg Ser Val Pro Pro Gln Gln Met Asn Ser Asp Val

355 360 365

Glu Met Ile Cys Glu Trp Lys Asp Pro Lys Ser Gln Ile Leu Cys Ala

370 375 380

Lys Glu Phe Arg Ser Gln Gln Ala Leu Val Asp His Leu Gly Glu His

385 390 395 400

Leu His Asn Gln Glu Gln Tyr Trp Cys Arg Trp Asn Gly Cys Asp Arg

405 410 415

Asp Arg Ala Phe Ser Ala Leu Tyr Met Leu Val Leu His Met Arg Lys

420 425 430

His Thr Gly Glu Lys Pro Asn Gln Cys Gln Phe Cys Pro Lys Ala Tyr

435 440 445

Ser Arg Leu Glu Asn Leu Lys Thr His Leu Arg Thr His Thr Gly Glu

450 455 460

Arg Pro Tyr Lys Cys Asp Phe Glu Gly Cys Thr Lys Ala Phe Ser Asn

465 470 475 480

Ala Ser Asp Arg Ala Lys His Leu AsnArg Thr His Ser Asn Lys Lys

485 490 495

Pro Tyr Ala Cys Pro Val Glu Asn Cys Phe Lys Ser Tyr Thr Asp Pro

500 505 510

Ser Ser Leu Arg Lys His Ile Lys Thr Val His Gly Glu Glu Ala Tyr

515 520 525

Glu Val Ala Lys Lys Asn Lys Gln Gln Asn Gly Arg Gly Gly Asn Tyr

530 535 540

Gly Phe Ile Pro Gln Asn Glu Leu Pro Leu Lys Gln Glu Val Gly Lys

545 550 555 560

Gly Ser Asn Gly Ser Val Ser Pro Ser Asp Met Ile Asn Leu Asn Gly

565 570 575

Asp Met Lys Asp Glu Ile Lys Glu Asn Lys Ala His Glu Asn Thr Pro

580 585 590

His Tyr Ala Asp Ile Ile Lys Gln Phe Thr Ala Arg Lys Ser Ser Gly

595 600 605

Ile Asn Asn Phe Ser Gly Gln Gln Asn His Pro Gly Gln Ser Ile Pro

610 615 620

Thr Tyr Tyr Asn Thr Ser Val Ala Thr Gly Tyr Cys Asn Leu Glu Asn

625 630 635 640

Gly Ala Leu Cys Leu Lys Ala Thr Val Pro GluPhe Glu Glu Phe Thr

645 650 655

Arg Ala Phe Cys Gly Leu Asn Ile Gly Lys Pro His Gly Glu Gly Arg

660 665 670

Arg Ser Leu Gly Thr Asp Cys His Arg Gly Glu Thr Ser His Lys Ser

675 680 685

Ser Thr Gln Arg Asn Thr Lys Val Pro Asn Asn Val Ile Gly Phe Ile

690 695 700

Gly Val Val Ser Glu Glu Glu Glu Asp Leu Tyr Asp Asp Ser Ser Ala

705 710 715 720

Arg Ser Asn Cys Pro Asn Lys His Pro Gln Asn Ser Leu Ser Asn Ser

725 730 735

Asn Ser Ser Ile Asp Gly Ala Leu Ser Val Leu Val Glu Asn Val Asn

740 745 750

Lys Tyr Phe Arg Leu Glu Asn Ala

755 760

Claims

1. The tra-1 gene of the bursaphelenchus xylophilus is characterized in that the complete cDNA sequence of the gene has the length of 3231bp, comprises 8 introns and 7 exons, the start codon and the stop codon of the cDNA sequence are ATG and TGA respectively, and the base sequence is shown as SEQ ID NO.1 and specifically comprises the following components:

ATGGCGGAGGGAGAGAGGAGCAACGACCGTGATTACCGAGACCAACAAATTGTGGTAGTTCAATCTGATTCTGATGACGAATCAATTGATGTAGAGCACTGGAGCGATGATGACATTTCCAATGATTTGGTTGAAGAAATATCAGTTGGGGTTTCAAAGGAAGTCCGGGAGTCAAGTGCTAGCACTCCCATCTCCAAAAATGAATCCGTCTCCTCAGGAAGGGGTTCAAGAGCAACGAAAGAAGAGCGATCCAATTCAAGGTCTCTAGCCACCCAAACGGGGCTAGCCTCAGGCAAACTTTCGCCTGGCCAATTAAAAAGAACGCCCGACTCTTTACAATCCCTAAATGGACTTTCTCCGAAATCGTCGATCGCTTCTTTGAATGTTGTCGATTTTGCCAATAATTTCCATGCAAATCTGAATTGTAATGATGACGGTTCAACGACAGATTCCGGTGTATCTAGCGCCCCATCTTCCAGTAGCCGAGTCTCCGGAAAGAGAACAGCACAAAAAGATTCCCAAATTTGGATGGATTACCTGTCCAAGGCAATTCGCTGGCCGTTTCCTGTTAATCAGCAGGTGTTAATGATGATAGCAAATCAAAGTGGGGCTTCATCGTCGCAGTTTCCACAGTATGTGTTTTAAGAATGCTATCTTTTTAATATACATCCTTCAGGTTTATGCCATCCCATCCCCAAATGCCGAGCCAGAGCACCCCATCTACAGGATTCCAGCCTGTTCCACCGGTTATCCAGAACTTCCAAACGCATCCGGCATCCTTTGGAACAGAAGCATCGTCGTCCAATGAGAAGCCCAAGAAGCCTAAAAGCGATTCGTCATCGGGGTCTTGTATGTTTTGGAATCTATGATACTAATTCATTAACTATTTGTGAGTAATTTTAATATTTTTAGCGACCCTGCCTGGTTGTGAGGCCTTTACCAGTACTTCCATGAACTTCCCTAGTGGGACCTTTGGCGGAACCCCCCAAATGCAACCGCCGTATGTTTCCAACGCCCAGATGCCACCTAGAATTGACAATGCCAAGCCCGGAATGTTTCCCAATTGGTCGAAACCCCCGGCAAATCAAGCATTGGTCCCGCCTAGACATAGCGCTGACACGTAAGTAGAAATAATATATCTGAATATTATTGAAAAAGGCGCTACGACTTTTCAGTCTAATTGTTTCTATTAACTAAGTCTTCTCCAAGCCTTCCCAATGCATACAGTGTTTTCATGCCCTAGCAAAAGCTTAGGGCTTGAAATCAGCGGATATTTTCATCATAATGTATAAGAGTGAAGACGCAGGGTTTCCAAAAAAGACGAAATTTTTATGTCTTTACATTTTTTTGGAAAAAATAAGTTTTGTAAAATTTTCGATTTCGGGGATTCAGAACGATTTCTTATTCCCAATTCTTGATTTTGGGAAGTTGAAACGAGGTTTCGCTAATCGATTTGTGCTGGTGAGTAGAAAGCCGTTTTGACTTCCCAGCCATCGGAGGCACGCTTGAACCAGCATTTCCTACTTGAGAAGAATTTATTTTTCCCACGTTCGTGCAATATGGGGACAGCTTGGAACTTGCTCAAACTGTCCGTGACGCCTAGGTTAACCGTTTTTCTTTTTGGATAGCTCATCAAATTTTGTAATCTTGTGATGCCTGGGTCTGTGGAGGGTGGTTTTTGGACCGCAGGTACCCGTGAAAAAGATCTTATATACATCTTATATACTTATTACACTTAATAATTCTATCTGTAGATTCAGTGCGAATATGCCACAATATCACCAAAATGCATTTTTGGTTCCCCCTTTTCGCTCCGTGCCGCCCCAACAAATGAATTCTGATGTGGAAATGATCTGCGAATGGAAAGACCCCAAAAGTCAGATACTTTGTGCAAAGGAATTTAGAAGTCAGCAAGCTCTGGTTGACCATCTAGGTGAACACCTCCACAATCAAGAACAATATTGGTGTAGATGGAACGGATGCGATCGGGACAGGGCCTTTTCAGCACTGTATATGCTGGTTTTGCATATGAGGAAACATACCGGCGAAAAACCTAATCAATGCCAAGTAAGTTGACATTACAACCCATTTTATAAGTGTTACATGCCTTGGTGATAAATATTATTTCAGTTCTGCCCGAAGGCATATTCTCGTTTGGAGAATCTGAAGACGCATCTGAGAACTCATACTGGAGAAAGGCCTTATAAATGTGATTTTGAGGGATGTACGAAGGCCTTTAGCAATGCTTCCGACCGGGCCAAACATCTCAACCGAACCCATTCCAATAAAGTAATTAGTTTTCTGTTGAATCTAATCTTACCGTAATCTCTGCAGAAACCATATGCATGTCCTGTTGAGAATTGTTTCAAAAGTTACACTGATCCCAGCTCACTCAGAAAACACATCAAAACAGTTCATGGAGAAGAAGCATACGAAGTGGCTAAGAAAAATAAGCAACAGAATGGGAGAGGAGGGAATTATGGATTCATTCCTCAGAACGAATTACCCTTGAAACAGGAGGTGGGCAAGGGGAGCAACGGAAGTGTCTCTCCTTCTGATATGATCAATCTAAATGGGGATATGAAGGATGAAATAAAGGAAAACAAAGCTCATGGTAAGTGAAATTTTAATTGAAAAATAATTTTGTTTGGCATCATACAAGAAAGATAATTTCAGAAAATACACCGCATTACGCGGACATCATCAAACAATTCACTGCGCGCAAGTCCTCCGGCATTAATAACTTTTCTGGGCAACAAAACCATCCCGGTCAAAGTATTCCCACTTATTATAACACGTCTGTGGCCACAGGTTACTGTAATCTGGAGAATGGAGCTCTTTGTTTGAAAGCAACGGTTCCTGAATTTGAGGAATTCACTCGAGCTTTCTGCGGTCTCAATATTGGAAAGCCTCATGGAGAAGGTAGAAGATCGCTGGGCACAGATTGTCATCGGGGGGAAACTAGCCACAAATCATCGACCCAACGCAACACCAAAGTGCCTAACAATGTCATAGGTAAATATGAATTAAGAAACAAGCATATTATTTTTAGGGTTTATTGGAGTAGTCTCCGAGGAAGAAGAAGATCTTTATGACGATTCTTCTGCCAGATCGAATTGTCCAAACAAACATCCACAGAACTCTTTAAGCAACTCAAATTCAAGTATTGACGGTGCTCTTTCAGTACTAGTCGAAAACGTGAACAAGTATTTCAGACTCGAGAATGCATGA。

2. the pine wood nematode tra-1 gene cDNA sequence of claim 1, which comprises 8 exons to form a CDS sequence with the length of 2283bp of the pine wood nematode tra-1 gene, and the base sequence is shown as SEQ ID NO.2, and the CDS sequence is as follows:

ATGGCGGAGGGAGAGAGGAGCAACGACCGTGATTACCGAGACCAACAAATTGTGGTAGTTCAATCTGATTCTGATGACGAATCAATTGATGTAGAGCACTGGAGCGATGATGACATTTCCAATGATTTGGTTGAAGAAATATCAGTTGGGGTTTCAAAGGAAGTCCGGGAGTCAAGTGCTAGCACTCCCATCTCCAAAAATGAATCCGTCTCCTCAGGAAGGGGTTCAAGAGCAACGAAAGAAGAGCGATCCAATTCAAGGTCTCTAGCCACCCAAACGGGGCTAGCCTCAGGCAAACTTTCGCCTGGCCAATTAAAAAGAACGCCCGACTCTTTACAATCCCTAAATGGACTTTCTCCGAAATCGTCGATCGCTTCTTTGAATGTTGTCGATTTTGCCAATAATTTCCATGCAAATCTGAATTGTAATGATGACGGTTCAACGACAGATTCCGGTGTATCTAGCGCCCCATCTTCCAGTAGCCGAGTCTCCGGAAAGAGAACAGCACAAAAAGATTCCCAAATTTGGATGGATTACCTGTCCAAGGCAATTCGCTGGCCGTTTCCTGTTAATCAGCAGGTGTTAATGATGATAGCAAATCAAAGTGGGGCTTCATCGTCGCAGTTTCCACAGTTTATGCCATCCCATCCCCAAATGCCGAGCCAGAGCACCCCATCTACAGGATTCCAGCCTGTTCCACCGGTTATCCAGAACTTCCAAACGCATCCGGCATCCTTTGGAACAGAAGCATCGTCGTCCAATGAGAAGCCCAAGAAGCCTAAAAGCGATTCGTCATCGGGGTCTTCGACCCTGCCTGGTTGTGAGGCCTTTACCAGTACTTCCATGAACTTCCCTAGTGGGACCTTTGGCGGAACCCCCCAAATGCAACCGCCGTATGTTTCCAACGCCCAGATGCCACCTAGAATTGACAATGCCAAGCCCGGAATGTTTCCCAATTGGTCGAAACCCCCGGCAAATCAAGCATTGGTCCCGCCTAGACATAGCGCTGACACATTCAGT

GCGAATATGCCACAATATCACCAAAATGCATTTTTGGTTCCCCCTTTTCGCTCCGTGCCGCCCCAACAAATGAATTCTGATGTGGAAATGATCTGCGAATGGAAAGACCCCAAAAGTCAGATACTTTGTGCAAAGGAATTTAGAAGTCAGCAAGCTCTGGTTGACCATCTAGGTGAACACCTCCACAATCAAGAACAATATTGGTGTAGATGGAACGGATGCGATCGGGACAGGGCCTTTTCAGCACTGTATATGCTGGTTTTGCATATGAGGAAACATACCGGCGAAAAACCTAATCAATGCCAATTCTGCCCGAAGGCATATTCTCGTTTGGAGAATCTGAAGACGCATCTGAGAACTCATACTGGAGAAAGGCCTTATAAATGTGATTTTGAGGGATGTACGAAGGCCTTTAGCAATGCTTCCGACCGGGCCAAACATCTCAACCGAACCCATTCCAATAAAAAACCATATGCATGTCCTGTTGAGAATTGTTTCAAAAGTTACACTGATCCCAGCTCACTCAGAAAACACATCAAAACAGTTCATGGAGAAGAAGCATACGAAGTGGCTAAGAAAAATAAGCAACAGAATGGGAGAGGAGGGAATTATGGATTCATTCCTCAGAACGAATTACCCTTGAAACAGGAGGTGGGCAAGGGGAGCAACGGAAGTGTCTCTCCTTCTGATATGATCAATCTAAATGGGGATATGAAGGATGAAATAAAGGAAAACAAAGCTCATGAAAATACACCGCATTACGCGGACATCATCAAACAATTCACTGCGCGCAAGTCCTCCGGCATTAATAACTTTTCTGGGCAACAAAACCATCCCGGTCAAAGTATTCCCACTTATTATAACACGTCTGTGGCCACAGGTTACTGTAATCTGGAGAATGGAGCTCTTTGTTTGAAAGCAACGGTTCCTGAATTTGAGGAATTCACTCGAGCTTTCTGCGGTCTCAATATTGGAAAGCCTCATGGAGAAGGTAGAAGATCGCTGGGCACAGATTGTCATCGGGGGGAAACTAGCCACAAATCATCGACCCAACGCAACACCAAAGTGCCTAACAATGTCATAGGGTTTATTGGAGTAGTCTCCGAGGAAGAAGAAGATCTTTATGACGATTCTTCTGCCAGATCGAATTGTCCAAACAAACATCCACAGAACTCTTTAAGCAACTCAAATTCAAGTATTGACGGTGCTCTTTCAGTACTA

GTCGAAAACGTGAACAAGTATTTCAGACTCGAGAATGCATGA。

3. the cloning primer sequence for PCR amplification of a Trac-1 gene cDNA of Bursaphelenchus xylophilus according to claim 1, which is characterized by comprising the following specific steps:

tra-1-F：5’-ATGGCGGAGGGAGAGAGGAGCAA-3’；

tra-1-R：5’-TCATGCATTCTCGAGTCTGAAATAC-3’。

4. the process and steps of cloning of the bursaphelenchus xylophilus tra-1 gene of claim 1, comprising the steps of:

(1) extraction of DNA from pine wood nematode

(2) Amplification of the tra-1 Gene

Performing PCR amplification by using the DNA of the pine wood nematode obtained in the step (1) as a template and using the cloning primer sequence of claim 4;

(3) ligation of tra-1 Gene amplification products to cloning vectors

Connecting the PCR amplification product obtained in the step (2) to a pMD18-T vector;

(4) the ligation product was transformed into E.coli DH5 α competent cells;

uniformly mixing the connecting reactant obtained in the step (3) with E.coli DH5 α competent cells to prepare a transformed bacterium liquid, and performing inverted culture on a selective culture medium;

(5) PCR detection of bacterial liquid

Picking the white single colony on the culture medium in the step (4) for liquid culture; then taking a proper amount of bacterial liquid as a template to carry out PCR reaction, wherein the reaction system and the procedure are the same as the previous one; after the reaction is finished, taking the PCR product of the bacterial liquid to carry out agarose gel electrophoresis so as to detect whether a band with a corresponding size exists;

(6) sequence determination

And (5) after detecting the fragments with the size of the target band by PCR gel electrophoresis of the bacterial liquid, conveying the PCR product of the bacterial liquid to a sample for detection.

5. The use of the bursaphelenchus xylophilus tra-1 gene of claim 2 in a bursaphelenchus xylophilus, wherein the gene is used to interfere with the development of the bursaphelenchus xylophilus.

6. The use of the bursaphelenchus xylophilus tra-1 gene of claim 6 in bursaphelenchus xylophilus, wherein the gene is used to design a synthetic dsRNA that interferes with the development of the bursaphelenchus xylophilus.

7. The use of the bursaphelenchus xylophilus tra-1 gene of claim 6, wherein the primer sequence of the dsRNA, when interfering with the development of the bursaphelenchus xylophilus, is designed to be:

BXY_dsRNA_T7F：5’-TAATACGACTCACTATAGGGA TCCCCCTTTTCGCTCCGT

BXY_dsRNA_T7R：5’-TAATACGACTCACTATAGGGA CCCCTTGCCCACCTCCTG。

8. the application of the pine wood nematode tra-1 gene in the pine wood nematodes of claim 6, wherein the gene is used for designing and synthesizing double-stranded dsRNA, 2-instar larvae of the pine wood nematodes are selected, a dip-dye system is constructed, and the solution is subjected to shake culture at 25 ℃ and 120rpm for 24 hours, so that the development of the pine wood nematodes is interfered.

9. The use of the pine wood nematode tra-1 gene of claim 6 in pine wood nematodes, wherein after the interference of the double-stranded dsRNA designed and synthesized by the gene in larvae of the 2 nd instar of the pine wood nematode, the growth and development of the larvae and the development of offspring of the pine wood nematode are inhibited, so that the pine wood nematode is in a partially androgenic development and the population fertility of the pine wood nematode is reduced.