CN110760609A

CN110760609A - ISSR-SCAR primer, kit, identification method and application for identifying Isodon lophanthoides

Info

Publication number: CN110760609A
Application number: CN201911212321.7A
Authority: CN
Inventors: 刘军民; 詹若挺; 孟爽爽; 王德勤
Original assignee: Guangzhou University of Traditional Chinese Medicine
Current assignee: Guangzhou University of Traditional Chinese Medicine
Priority date: 2019-11-29
Filing date: 2019-11-29
Publication date: 2020-02-07
Anticipated expiration: 2039-11-29
Also published as: CN110760609B

Abstract

The invention discloses an ISSR-SCAR primer, a kit, an identification method and application for identifying rabdosia lophanthide, and relates to the technical field of molecular markers and medicinal material identification. The ISSR-SCAR primer comprises an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2. The invention uses simple repetitive sequences and extended bases as SCAR molecular markers. The ISSR-SCAR primer can specifically amplify the genome of the Rabdosia Lophanthoides, has the advantages of good specificity and stability, can quickly identify the Rabdosia Lophanthoides, and can avoid the occurrence of false positive caused by the diversity among groups.

Description

ISSR-SCAR primer, kit, identification method and application for identifying Isodon lophanthoides

Technical Field

The invention relates to the technical field of molecular markers and medicinal material identification, and particularly relates to an ISSR-SCAR primer, a kit, an identification method and application for identifying rabdosia filiformis.

Background

Rabdosia lophanthoides (Hemsl.) Hara, the school name: rabdosia lophanthoids, which are Labiatae (Labiatae) plants. The dried aerial parts (rabdosia lophanthide) are one of the special medicinal materials in Lingnan and are widely used for medicine application. Isodon lophanthoides is similar to Isodon lophanthoides (Rabdosia strachyyi) and its variant, Rabdosia lophanthoides (Rabdosia lophathoideswar. graciliflora) in plant morphological characteristics, and they are not easily distinguished by plant trait characteristics alone.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide an ISSR-SCAR primer, a kit, an identification method and application for identifying rabdosia lophanthide to solve the technical problems.

The invention is realized by the following steps:

an ISSR-SCAR primer for identifying Isodon lophanthoides comprises an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2.

The invention uses simple repetitive sequences as SCAR molecular markers. The ISSR-SCAR primer provided by the invention can specifically amplify the genome of Isodon lophanthoides, has the advantages of good specificity and stability, can quickly identify Isodon lophanthoides, and can avoid the occurrence of false positive caused by diversity among communities.

A method for identifying Isodon lophanthoides by using ISSR-SCAR primers comprises the step of carrying out PCR amplification by using a genome of a sample to be identified as a template and using the ISSR-SCAR primers.

In a preferred embodiment of the present invention, the method further comprises determining Rabdosia lophanthoides based on the PCR amplification product.

In a preferred embodiment of the present invention, the method further comprises sequencing the PCR amplification product to determine whether the detected sample is rabdosia striatum, if the sequencing result is shown in SEQ ID No.3, the sample to be identified is determined to be rabdosia striatum, and if the sequencing result is different from the sequence shown in SEQ ID No.3, the sample to be identified is not rabdosia striatum.

In a preferred embodiment of the present invention, the method further comprises performing electrophoresis on the PCR amplification product to determine whether the detected sample is rabdosia striata, if the electrophoresis result shows that only a single band of 321bp exists, determining that the sample to be identified is rabdosia striata, and if the electrophoresis result shows that no single band of 321bp exists, determining that the sample to be identified is not rabdosia striata.

In the preferred embodiment of the invention, the ISSR-SCAR primer is obtained by screening according to the following method: respectively amplifying a plurality of samples of known different varieties by using primers 1-13, screening out an initial primer of the specific amplified Isodon lophanthoides according to an amplification product electrophoresis chart, sequencing the specific amplified product of the initial primer, and designing an SCAR primer on the basis of the initial primer according to a sequencing result.

In a preferred embodiment of the present invention, the upstream primer sequence (5 'to 3') of the above primers 1 to 13 is identical to the downstream primer sequence (5 'to 3'), and the primer sequences are shown in sequence as SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15 and SEQ ID NO. 16.

In a preferred embodiment of the present invention, the screening of the ISSR-SCAR primers further comprises performing specificity verification on the designed SCAR primers to screen out ISSR-SCAR primers with poor specificity.

In the preferred embodiment of the present invention, the annealing temperature of the PCR amplification is 61-62.5 ℃;

preferably, the annealing temperature for PCR amplification is 62.2 ℃. Specific amplification of a target band can be realized at the annealing temperature, so that species identification of the rabdosia striifolia can be realized.

In the preferred embodiment of the present invention, the concentration of the forward primer and the reverse primer for PCR amplification is 0.6. mu. mol. L^-1。

The addition of the primers within the above concentration range is advantageous for efficient PCR amplification.

An application of ISSR-SCAR primer in identification of Isodon lophanthoides species.

A kit for identifying Isodon lophanthoides comprises the ISSR-SCAR primer. The kit also includes an amplification mix. The kit can realize the rapid identification of the Rabdosia lophanthide.

An application of a kit in identification of Isodon lophanthoides.

The invention has the following beneficial effects:

the invention provides an ISSR-SCAR primer, a kit, an identification method and application for identifying rabdosia filiformis, wherein a simple repetitive sequence and an extended basic group are used as SCAR molecular markers. The ISSR-SCAR primer can specifically amplify the genome of the Rabdosia Lophanthoides, has the advantages of good specificity and stability, can quickly identify the Rabdosia Lophanthoides, and can avoid the occurrence of false positive caused by the diversity among groups. The identification method is simple and convenient, and can be used for rapid identification of Isodon lophanthoides in market and production.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a graph showing the results of PCR amplification of 12 samples using primer 2(UBC 810);

FIG. 2 shows amplification charts of 12 samples of 12 primers (A. about.L: primers UBC807, UBC811, UBC812, UBC815, UBC821, UBC823, UBC836, UBC840, UBC842, UBC846, UBC847, UBC864) numbered 1 to 4: rabdosia longifolia; number 5 ~ 8: rabdosia lophanthoides (Hemsl.) Hara; number 9 ~ 12: fine flower scented tea vegetables; the marker is the same and sequentially comprises 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom;

FIG. 3 is a graph showing the results of PCR amplification of 12 samples using ISSR-SCAR primers.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

The embodiment provides a method for screening ISSR-SCAR primers, which specifically comprises the following steps:

first, the genome of a known sample is extracted.

The samples are selected from plants of wild and cultivated populations in different environments, the collection information of the linearstripe rabdosia herb germplasm resources is shown in table 1, the samples in the table 1 are identified as linearstripe rabdosia herb, isodon paniculatus and isodon longitubifolius by professor Liu military citizen of Guangzhou Chinese medicinal university, and the linearstripe rabdosia herb, the isodon paniculata herb and the isodon longitubiflora herb are all planted in a precious mountain linearstripe rabdosia germplasm resource garden of Guangzhou Chinese medicinal. The sample specimen is stored in the traditional Chinese medicine resource teaching and research room of Guangzhou university of traditional Chinese medicine.

TABLE 1 Collection of germplasm resources of Rabdosia serra (Maxim.) Hara of different communities

Samples with numbers P30 and P31 were selected from Table 1 as the extraction targets of the longleaf rabdosia species genome, samples with numbers P9 and P10 were selected as the extraction targets of the stringy rabdosia species genome, and samples with numbers P13 and P24 were selected as the extraction targets of the stringy rabdosia species genome. The genomes of 2 plants were extracted for each number and split into Ep tubes.

The extraction method of the plant genome DNA refers to a method of a DNA extraction kit, and comprises the following specific extraction steps:

(1) the metal bath was opened and adjusted to 55 ℃.

(2) Sterilized 2ml centrifuge tubes were added 400. mu.L of buffer LP1 and placed on a 55 ℃ metal bath.

(3) Placing plant tender leaves into a sterilized mortar, adding liquid nitrogen to grind the tender leaves into fine powder, quickly transferring the fine powder into a centrifugal tube added with 400 mu L of LP1 buffer solution when the liquid nitrogen is quickly volatilized to dry, covering a tube cover after the liquid nitrogen in the centrifugal tube is volatilized, and placing the centrifugal tube on a metal bath at 55 ℃.

(4) After all samples were milled, 6 μ L of rnase a was added to the centrifuge tube of step (3), vortexed and mixed, and left at room temperature for 10 min.

(5) And (4) placing the centrifuge tube in the step (4) on a metal bath at 55 ℃ for 20min, and mixing the centrifuge tube and the metal bath in a reversed manner every 10 min.

(6) 130 μ L of LP2 buffer was added to the centrifuge tube of step (5), vortexed and mixed, and centrifuged at 12000rpm for 5 min.

(7) Transfer about 400. mu.L of the centrifuged supernatant from step (6) to a centrifuge tube containing 600. mu.L of LP3 and mix well.

(8) And (4) adding the mixed solution obtained in the step (7) into a CB3 adsorption column, standing for 5min, centrifuging for 30s, and pouring off the waste liquid.

(9) Adding 600 μ L of rinsing liquid PW into adsorption column CB3, standing for 5min, centrifuging for 30s, pouring off waste liquid, and putting adsorption column CB3 into the collection tube again.

(10) Step 9 was repeated twice.

(11) After rinsing, CB3 was put into a collection tube and centrifuged at 12000rpm for 5min, and the waste liquid was discarded. Placing CB3 in a sterilized new collection tube, opening the tube cover, and volatilizing residual rinsing liquid at 37 ℃ for 10 min.

(12) The eluate TE was preheated in a metal bath at 65 ℃.

(13) And (4) suspending 40 mu L of eluent on the middle adsorption film of the adsorption column CB3 in the step (11), standing for 5min, and centrifuging at 12000rpm for 2 min. Then, 30 μ L of eluent is suspended and dropped between the adsorption membranes, and the mixture is placed for 5min and centrifuged at 12000rpm for 2 min.

(14) Transferring the DNA solution eluted in the step (13) into a sterilized PCR tube, and storing at 4 ℃.

(15) The concentration and purity of the extracted genomic DNA were determined in a microspectrophotometer, the quality was determined by electrophoresis on 1% agarose gel, and the genomic DNA was diluted uniformly to 10 ng. mu.L with TE, the eluent from the DNA extraction kit^-1And storing in a refrigerator at-20 ℃ for later use.

Secondly, the 13 pairs of primers in table 2 were used to amplify the genomic DNAs of isodon lophanthoides, isodon lophanthoides and isodon longitubiflora, respectively, for a total of 12 sample genomic DNAs.

Table 213 primer sequences

The PCR amplification system was 25. mu.l, mix 12.5. mu.l, DNA 1. mu.l, and both the forward and reverse primers were 1.5. mu.l. The amplification reaction program comprises pre-denaturation at 94 ℃ for 7min, denaturation at 94 ℃ for 2min, annealing at 62.2 ℃ for 45s, extension at 72 ℃ for 2min, 30 cycles, and final extension at 72 ℃ for 10 min.

Wherein, the PCR amplification result of the primer 2(UBC-810) is shown in figure 1, 1-4 in figure 1 are Isodon longituba (1 and 2 are P30, 3 and 4 are P31); 5-8 is Isodon lophanthoides (5 and 6 are P9, 7 and 8 are P10); 9-12 are Ficus tinctorius (9 and 10 are P24, 11 and 12 are P13). As can be seen from FIG. 1, in the region of 250-500bp, the primer 2 has amplification specificity to Isodon japonicus, but has no amplification specificity to Isodon longituba and Isodon japonicus.

The results of PCR amplification using primer 1(UBC-807), primer 3(UBC-811), primer 4(UBC812), primer 5(UBC815), primer 6(UBC821), primer 7(UBC823), primer 8(UBC836), primer 9(UBC840), primer 10(UBC842), primer 11(UBC846), primer 12(UBC847) and primer 13(UBC864) are shown in FIG. 2, and the amplification results correspond to Panel A, Panel B, Panel C, Panel D, Panel E, Panel F, Panel G, Panel H, Panel I, Panel J, Panel K and Panel L in FIG. 2 in the order of the primers, and the samples corresponding to the sample numbers in FIG. 2 are the same: 1-4 are Isodon longituba (1 and 2 are P30, 3 and 4 are P31); 5-8 is Isodon lophanthoides (5 and 6 are P9, 7 and 8 are P10); 9-12 are Ficus tinctorius (9 and 10 are P24, 11 and 12 are P13). As can be seen from FIGS. 1 and 2, except that the primer 2 had amplification specificity to Isodon lophanthoides, but had no amplification specificity to Isodon longituba and Isodon japonicus, the remaining primers were not able to specifically amplify only Isodon lophanthoides. Therefore, primer 2 and its amplification product were selected for further study.

Again, the fragments with specific amplified bands in the region of 250-500bp in FIG. 1 were recovered by gel cutting. And (3) recovering the target fragment by using a large amount of agarose gel DNA recovery kit, wherein the gel recovery steps are as follows:

(1) cutting off a single-purpose DNA strip (cutting off redundant parts as much as possible) on an ultraviolet transilluminator by using a clean scalpel, putting the cut single-purpose DNA strip into a 1.5ml sterilized centrifuge tube, weighing, adding 2-3 times of sol solution PN, and putting the gel on a 55 ℃ metal bath until the gel is completely dissolved.

(2) Column balancing: add 500. mu.L of equilibration solution BL to the adsorption column CA3, centrifuge at 12000rpm for 1min, discard the waste, replace the adsorption column back in the collection tube.

(3) And after the glue blocks are completely dissolved, taking out the centrifugal tube, and cooling to room temperature.

(4) Column mounting: the solution cooled to room temperature was added to CA3, left at room temperature for 5min, centrifuged at 12000rpm for 30s, and the waste solution was decanted.

(5) Adding 600 μ L of rinsing solution PW into adsorption column CA3, standing at room temperature for 5min, centrifuging at 12000rpm for 30s, pouring off waste liquid, and repeating once.

(6) After rinsing, centrifuge tube was centrifuged at 12000rpm for 10min to remove the rinse. And then placing the adsorption column CA3 at room temperature for 10-20 min, and completely volatilizing the rinsing liquid.

(7) The adsorption column CA3 is placed into a clean centrifuge tube, 30 μ L of 65 ℃ eluent TE is suspended and dropped into the middle position of the adsorption film, the mixture is placed for 5min at room temperature, and then centrifuged for 2min at 12000rpm to collect DNA solution. The eluted DNA was transferred to a PCR tube and stored at-20 ℃.

Thirdly, the recovered target fragment is connected with the carrier according to the instruction of pClone007 Vector Kit (TSV-007), and the specific operation is as follows:

(1) and (4) connecting.

Placing a sterilized 0.2ml centrifuge tube on a plate, sucking 1 muL of pClone007 Vector to the bottom of the centrifuge tube, replacing a gun head to suck 1 muL of 10 XTopo Mix, adding the mixture into the Vector, lightly blowing and beating the mixture by using the gun head for 2-3 times, adding 8 muL of recovered DNA fragment, and connecting the mixture at room temperature for 5 min.

(2) And (4) transformation.

Adding the 10 mu L of the connection system into 100 mu L of DH5 α competent cells, placing the cells on ice for 30min, carrying out water bath heat shock for 90s at 42 ℃, quickly transferring the cells into an ice bath, carrying out ice bath for 5min, adding 400 mu LLB liquid culture medium into a centrifuge tube on a super clean bench, covering the cells, shaking the cells evenly, recovering the cells at the speed of 150rpm for 1h at 37 ℃, carrying out low-speed centrifugation for 10s, obtaining 300 mu L of supernatant, completely smearing the remaining 200 mu L on an Amp-resistant LB plate on the super clean bench, and culturing the cells in an incubator at 37 ℃ for 16-18 h.

Finally, on a clean bench, 10 single colonies were randomly picked from Amp + containing plates with a sterilized tip, inoculated onto LB (Amp +) liquid medium, shaken for 16h, and 1. mu.L of the bacterial solution was subjected to PCR amplification (using vector universal primers M13F/M13R). And (3) detecting whether the band of the amplification product is a target band or not on 1.0% agarose gel, and sequencing 20 mu L of bacterial liquid to Beijing Optimalaceae New industry biotechnology Limited. The sequencing result is shown in SEQ ID NO.3, and the length is 321 bp.

And designing ISSR-SCAR primers by using Primer5.0 according to the sequencing result, designing gradient annealing temperature according to the Tm value of a primer synthesis report list, and taking the highest temperature of a target band as the annealing temperature.

Based on the

original primer

2, 5 to 12 bases were extended inward, and 1 pair of primers (see Table 3) was designed according to the principle of primer design. The bolded sequence is the newly designed primer sequence.

Table 31 primer sequences and annealing temperatures.

It was verified whether the designed ISSR-SCAR primers retained band specificity in 12 samples. And (3) amplifying the 12 samples by using the primers in the table 3, if the result is positive, continuously taking samples of other colonies for continuous verification, and avoiding the result of false positive due to diversity among the colonies. As shown in FIG. 3, it can be seen from FIG. 3 that the designed ISSR-SCAR primers are successfully converted into specific markers, and Isodon japonicus can be specifically identified. 1-4 in FIG. 3 are Isodon longituba; 5-8 is Rabdosia lophanthoides; 9-12 is a floral tea.

When the ISSR-SCAR marker provided by the invention is used for identifying varieties of samples, only the existence of strips and the sizes of fragments after the samples are amplified need to be judged, and the method is simple and rapid. Has wide production and application value.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Guangzhou college of traditional Chinese medicine (Guangzhou institute of traditional Chinese medicine)

<120> ISSR-SCAR primer, kit, identification method and application for identifying Isodon lophanthoides

<160>16

<170>PatentIn version 3.5

<210>1

<211>24

<212>DNA

<213> Artificial sequence

<400>1

gagagagaga gagagatggc agct 24

<210>2

<211>28

<212>DNA

<213> Artificial sequence

<400>2

gagagagaga gagagatcat gtacgtac 28

<210>3

<211>321

<212>DNA

<213> Artificial sequence

<400>3

gagagagaga gagagatggc agctaaaatg caaaggagaa tggcactgcg cagaaagctt 60

cacatcttga gaactctaac caaatcaaaa tctgtaatga gcctctgaaa actttatttt 120

tattattatt attaccatat ataggcttaa atatttattg gatttgattt tgcatgtttt 180

tgaaggtgaa aagaagttct ataatcatgg atgcttttct ttacatctac aagttgaagc 240

tccaagttga agccatcaaa aaagaatacc aataccttat caatcatatccaagtacgta 300

catgatctct ctctctctct c 321

<210>4

<211>17

<212>DNA

<213> Artificial sequence

<400>4

agagagagag agagagt 17

<210>5

<211>17

<212>DNA

<213> Artificial sequence

<400>5

gagagagaga gagagat 17

<210>6

<211>17

<212>DNA

<213> Artificial sequence

<400>6

gagagagaga gagagac 17

<210>7

<211>17

<212>DNA

<213> Artificial sequence

<400>7

gagagagaga gagagaa 17

<210>8

<211>17

<212>DNA

<213> Artificial sequence

<400>8

ctctctctct ctctctg 17

<210>9

<211>17

<212>DNA

<213> Artificial sequence

<400>9

gtgtgtgtgt gtgtgtt 17

<210>10

<211>17

<212>DNA

<213> Artificial sequence

<400>10

tctctctctc tctctcc 17

<210>11

<211>18

<212>DNA

<213> Artificial sequence

<400>11

agagagagag agagagya 18

<210>12

<211>18

<212>DNA

<213> Artificial sequence

<400>12

gagagagaga gagagayt 18

<210>13

<211>18

<212>DNA

<213> Artificial sequence

<400>13

gagagagaga gagagayg 18

<210>14

<211>18

<212>DNA

<213> Artificial sequence

<400>14

cacacacaca cacacart 18

<210>15

<211>18

<212>DNA

<213> Artificial sequence

<400>15

cacacacaca cacacarc 18

<210>16

<211>18

<212>DNA

<213> Artificial sequence

<400>16

atgatgatga tgatgatg 18

Claims

1. An ISSR-SCAR primer for identifying Isodon lophanthoides is characterized by comprising an upstream primer and a downstream primer, wherein the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2.

2. A method for identifying Isodon lophanthoides by using the ISSR-SCAR primers of claim 1, comprising performing PCR amplification using ISSR-SCAR primers using a genome of a sample to be identified as a template.

3. The method of claim 2, further comprising determining whether the sample detected is rabdosia striifolia based on the PCR amplification product.

4. The method according to claim 3, further comprising sequencing the PCR amplification product to determine whether the sample to be detected is Isodon lophanthoides, wherein if the sequencing result is shown in SEQ ID No.3, the sample to be identified is judged to be Isodon lophanthoides, and if the sequencing result is different from the sequence shown in SEQ ID No.3, the sample to be identified is not judged to be Isodon lophanthoides.

5. The method as claimed in claim 3, further comprising performing electrophoresis on the PCR amplification product to determine whether the detected sample is Rabdosia trichocarpa, wherein if the electrophoresis result shows that only a single band of 321bp exists, the sample to be identified is judged to be Rabdosia trichocarpa, and if the electrophoresis result shows that no single band of 321bp exists, the sample to be identified is judged not to be Rabdosia trichocarpa.

6. The method of claim 2, wherein the annealing temperature of the PCR amplification is 61-62.5 ℃;

preferably, the annealing temperature for the PCR amplification is 62.2 ℃.

7. The method of claim 2, wherein the concentration of the forward primer and the concentration of the reverse primer are both 0.6 μmol-L in the PCR amplification^-1。

8. Use of an ISSR-SCAR primer according to claim 1 in the identification of Isodon lophanthoides species.

9. A kit for identifying rabdosia lophanthide, characterized in that it comprises the ISSR-scarr primer of claim 1.

10. Use of the kit of claim 9 for identifying Rabdosia lophanthoides.