CN110760598B - Primer group for Yunnan golden monkey molecular biology research and application method thereof - Google Patents
Primer group for Yunnan golden monkey molecular biology research and application method thereof Download PDFInfo
- Publication number
- CN110760598B CN110760598B CN201911168704.9A CN201911168704A CN110760598B CN 110760598 B CN110760598 B CN 110760598B CN 201911168704 A CN201911168704 A CN 201911168704A CN 110760598 B CN110760598 B CN 110760598B
- Authority
- CN
- China
- Prior art keywords
- primer
- primer pair
- dna
- sample
- golden monkey
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer group for the molecular biology research of a Yunnan golden monkey and an application method thereof. The primer group comprises a primer pair A; the primer pair A is D-lopF: TGGCCGTGAGGTAAGAACC and D-lopR: CCACAAATCCAAACAACAGAGTA is added. The invention has the beneficial effects that the harmless sampling species identification method disclosed by the invention is specially established for the Yunnan golden monkey, has better operability and reliability, and the designed special primer pair A has 100% identification success rate. The primer pair A related to the invention: the sequencing peak patterns of D-lopF and D-lopR have clear wave peaks and wave troughs, uniform distance between peaks and interference of miscellaneous peaks, no phenomena of the prior COI universal primer and the primer GH (GL) published in the article that the sequencing peak patterns have miscellaneous peak double peaks and the like, and the effect is very obvious.
Description
Technical Field
The invention belongs to the field of species identification of molecular biology and genetics, and aims to provide a primer with high amplification success rate, which is used for species identification of a Yunnan golden monkey fecal sample, and an amplification product of the primer can be used for researches such as genetic diversity analysis and germplasm resource bank establishment of the Yunnan golden monkey.
Background
The world wide golden monkey (academic name: Rhinopecthecus bieti) belongs to Primates (Primates) wart subfamily (Colobinae), Asian wart and supine nose monkey, is a special Primates species in China, is listed as an Endangered (EN) animal red name list by the International Union of Natural protection (IUCN), and is also a grade I important protection wild animal in China. At present, the Yunnan golden monkey is only distributed in a narrow region between the lanuguan and the Jinshajiang at the junction of Yunnan and Tibetan provinces, and the quantity is only 3000 and 4000. As one of the world treasures peculiar to China, the golden monkey has extremely important research value.
The method for researching the golden monkey comprises the following steps: because the number of the existing world-wide golden monkey is small, the world-wide golden monkey is a typical tree-inhabiting animal, the sexual alertness and the migration speed are high, and the genetic protection related research is difficult to be carried out through a conventional tissue sample, the research of population quantity investigation, genetic diversity evaluation and the like by adopting a non-destructive sampling method is an effective means.
In molecular ecology studies, the methods of obtaining test materials generally include three types: namely, noxious sampling, non-noxious sampling and non-noxious sampling. Nociceptive sampling is the obtaining of fresh muscle tissue by killing the animal. This sampling method may be feasible for non-rare animals, but is neither scientific nor practical for protecting genetically studied objects, namely rare animals endangered animals, and has been abandoned by many researchers. Non-invasive sampling is the collection of hair or feather analysis samples by capturing the animal and drawing blood, which, although not leading to death of the animal, is typically more or less harmful to the animal. Due to the defects of the traditional sampling methods, the traditional sampling methods cannot be widely applied to the protective genetics of a plurality of rare or endangered animals, so the research significance and the practical application value of non-invasive sampling are more and more valued. Non-invasive sampling DNA samples in samples can be obtained even in cases where the animal is not seen with the naked eye by collecting different forms of samples, including hair, feces, urine feathers, and the like.
The excrement sampling method has the characteristics that: the fecal sampling method belongs to non-invasive sampling, and as the surface of the feces usually contains desquamated animal digestive tract cells, DNA of the animal can be extracted from the feces, and the feces are relatively easy to collect, the fecal sample has been widely applied to the research of rare endangered wild animals. However, due to the randomness and uncertainty of stool sampling, the apparent morphology of stool alone is not sufficient to identify its source, so that we need to incorporate means of molecular biology to identify the species from which it is derived.
Species identification principle and method: the DNA barcode molecular identification method is a molecular biology technology for identifying species by utilizing a section of recognized and relatively short DNA sequence in a genome, and is an effective supplement of the traditional morphological identification method. Since the DNA sequences of different species are composed of four bases, adenine (A), guanine (G), cytosine (C) and thymine (T), arranged in different sequences, analysis of a specific DNA fragment sequence can distinguish different species. The genes of interest commonly used for species identification are Cytochrome Oxidase I (COI) on mitochondrial DNA, followed by COII, COIII, Cytb, etc. Among them, the mitochondrial DNA control region (D-loop) is the region with the highest rate of variation in mitochondria, and has been widely used in species identification of rare or endangered animals, development and establishment of species germplasm resource bases, genetic diversity and other researches.
A phenyl lograph and amplification structure of the Yunnan-snub-nonsed monkey (Rhizopus bieti) fed from mitochondrial control region DNA sequence analysis article proposes a pair of primers GH (5'-AACTGGCATTCTATTTAAACTAC-3') and GL (5'-ATTGATTTCACGGAGGATGGT-3') for the research on amplification and genetic diversity of D-loop fragment of the mitochondrion control region of the Physcia yunnanensis, wherein the length of the target fragment of the primers is about 400 bp. Although the primer pair GH and GL disclosed in the article can expand the DNA fragment of the Yunnan golden monkey, the failure rate is extremely high. By using the primer pair to perform amplification sequencing on 2874 samples, 1287 samples are successfully sequenced, the sequencing product is about 400bp, the success rate is only 44.7%, and the rest 1587 samples have different degrees of double peaks, mixed peaks and failures, so that the final sequencing failure is caused. Therefore, although there is an approximate molecular biology research method as a textbook, the poor quality of the primer pair will result in a large number of positive samples not being effectively expanded, and it is very easy to cause a significant deviation in the statistics of the number of samples.
Disclosure of Invention
The invention aims to solve the defects of the problems and provides a primer group for the molecular biology research of the Yunnan golden monkey and an application method thereof.
The invention is realized by adopting the following technical scheme.
A primer group for the research of the molecular biology of the Yunnan golden monkey, the primer group comprises a primer pair A; the primer pair A is D-lopF: TGGCCGTGAGGTAAGAACC and D-lopR: CCACAAATCCAAACAACAGAGTA is added.
The application of the primer group is used for species identification of the Yunnan golden monkey, genetic diversity research of the Yunnan golden monkey or establishment of a germplasm resource bank of the Yunnan golden monkey; and the like in various molecular biology studies.
The primer group is applied to species identification of the golden monkey, and the method comprises the following steps: 1) downloading a plurality of cynomolgus monkey mitochondrial sequences in an NCBI data database, and finding out homologous sequences after Alignment; 2) designing a plurality of pairs of primers by using primer design software based on the homologous sequences; 3) collecting a fecal sample; 4) extracting DNA of a fecal sample by a kit method and detecting the quality of the DNA; 5) amplifying the extracted DNA by using a primer pair A; the DNA amplification parameters were: a25. mu.l PCR system was used, consisting of: 100ng-200ng DNA sample, 12.5. mu. L I-5TM2 × High Fidelity Master mix, front and rear primers each 1. mu.l 10. mu. mol/L, adding sterile water to make up to 25. mu.l total volume; the PCR conditions were: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 1 min, annealing at 62 ℃ for 1 min, extension at 72 ℃ for 1 min, and 40 cycles of reaction; stretching for 7 minutes at 72 ℃; 6) sequencing the amplification result, comparing the amplification sequencing success rates of different primers, and splicing and manually correcting the sequencing result; 7) performing blast species identification according to the sequencing result, and determining the species source of the sample.
Further, step 3) of the present invention is to collect a stool sample, which has the following contents: 1) collecting the surface area of the excrement to the maximum extent by adopting a forceps inclined scraping mode; 2) the fecal sample has smooth surface, fresh green color and cubic shape.
Further, the step 4) of the invention adopts a kit method to extract the DNA of the fecal sample, and has the following contents: the feces were pelleted by centrifugation at full speed, and the sample was centrifuged again if fecal pellets were still visible in the supernatant during centrifugation.
Further, the primer group also comprises a primer pair B; the primer pair B is D-loop-L6: TCGCGTGCAGACCAGAG and D-loop-H6: CCACAAATCCAAACAACAGAG or the primer set further comprises primer pair C; the primer pair C is D-loop-L7: GCAGACCAGAGATAAAAGATACCA and D-loop-H7: CCATACTCCACAAATCCAAACAAC, respectively; selecting one of the primer pair B and the primer pair C to be combined with the primer pair A for use or jointly using the primer pair A, the primer pair B and the primer pair C.
Further, the primer group is used in the sequence that the primer pair A is used firstly; next, primer pair B and/or primer pair C are used.
Further, the DNA amplification parameters of the primer pair B and the primer pair C are the same as those of the primer pair A.
Furthermore, the method is used for identifying the species of the Yunnan golden monkey, and the method only comprises the comparison of electrophoresis detection photos after DNA expansion and does not comprise the comparison of sequencing results. The sequencing peak images of the primer pair B and the primer pair C have a hetero-peak double peak phenomenon, so that homology comparison cannot be guaranteed to be more than 97%, but the primer pair B and the primer pair C are not useless, and only numerous experiments show that the hetero-bands of the electrophoresis detection photo after the DNA of the cynomolgus monkey feces is expanded by using the primer pair B and the primer pair C have stable consistency.
After the primer pair A has high pertinence (the homology ratio is more than 97 percent), the electrophoresis detection photo of the DNA extension of the primer pair B and the primer pair C is used for auxiliary detection, and 100 percent of detected fecal DNA belongs to the golden monkey. 2874 samples amplified by using the primers D-lopF and D-lopR of the invention are all successfully sequenced, the sequencing quality is very obvious, and the success rate reaches 100%.
The invention has the beneficial effects that 1) the harmless sampling species identification method disclosed by the invention is specially established for the Yunnan golden monkey, has better operability and reliability, and the designed special primer pair A has 100% identification success rate; 2) in order to ensure the accuracy of identification, a primer pair B and a primer pair C which are additionally designed are used as auxiliary primer pairs of the special primer pair A, so that the identification can be ensured to be absolutely correct; 3) the auxiliary primer pair does not need to carry out the final sequencing link, and the auxiliary identification work can be completed only by comparing electrophoresis detection photos after DNA expansion; 4) the primer pair A related to the invention: the sequencing peak patterns of D-lopF and D-lopR have clear wave peaks and wave troughs, the distance between the peaks is uniform, the interference of a foreign peak is avoided, the phenomena that the sequencing peak patterns of the traditional COI universal primer and the published primer GH (GL) have a foreign peak and double peaks and the like are avoided, and the effect is very obvious; 5) the DNA amplification parameters of the invention are very suitable for the primer pair A, and extremely high amplification results are achieved; 6) in the stage of primer design, the optimal primer Tm value is finally formed by manually adjusting the bases of the primer pair, namely the bases of the primer pair A, the primer pair B and the primer pair C are simultaneously adjusted, and the DNA amplification test of the three primer pairs can be completed in one PCR reaction, so that the time cost and the scientific research cost are greatly reduced.
The invention is further explained below with reference to the drawings and the detailed description.
Drawings
FIG. 1 is a drawing of 1% agarose gel electrophoresis test of the DNA of the Yunnan golden monkey fecal sample extracted by the present invention.
FIG. 2 is a 1% agarose gel electrophoresis test chart of the PCR product of the primer D-lopF and (D-lopR) of the present invention.
FIG. 3 is a diagram showing the 1% agarose gel electrophoresis of the PCR product of the primer D-loop-L6(D-loop-H6) of the present invention.
FIG. 4 shows the detection of the PCR product of the primer D-loop-L7(D-loop-H7) by 1% agarose gel electrophoresis.
FIG. 5 is a prior art 1% agarose gel electrophoresis test of conventional COI universal primer PCR products.
FIG. 6 detection of the prior art primer GH (GL) PCR product by 1% agarose gel electrophoresis.
FIG. 7 is a (magnified, partial) sequencing peak of the PCR product of primer pair A of the present invention.
FIG. 8 is a (magnified, partial) plot of the sequencing peaks of the PCR products of the prior art primers GH (GL).
FIG. 9 is a (magnified, partial) sequencing peak of the PCR product of primer pair B of the present invention.
FIG. 10 is a (enlarged, partial) sequencing peak of the PCR product of primer pair C of the present invention.
FIG. 11 is a BLAST result chart on NCBI of the sequencing result after amplification of primer pair A of the present invention.
Detailed Description
For further disclosure, but not limitation, the present invention is described in further detail below with reference to examples. The kits, chemicals and solvents used in the examples were all commercially available.
1. Primer method for amplifying mitochondrion control area (D-loop) of Yunnan golden monkey
(1) A number of cynomolgus mitochondrial sequences (HM125579, JQ821837, AY998827-AY998830, AY545053) have been downloaded in the NCBI data base and homologous sequences have been found by Alignment.
(2) Designing primers by using Primer5.0 software based on homologous sequences, selecting proper primers by artificially adjusting increase and decrease of bases, and finally successfully designing and synthesizing multiple pairs of primers. The primer names and primer sequences are as follows:
2. method for sample collection
The collected sample of the Yunnan golden monkey feces has smooth, fresh green and cubic appearance, which indicates better quality and higher freshness.
In the field, fresh Yunnan golden monkey excrement is selected as a collection object, and if the excrement is long in time or washed by rainwater and the like, collection is not recommended. When in collection, the excrement sample is placed on a PE glove, and then the part of the surface of the excrement is clamped by a clean forceps and placed in a sample tube which is pre-added with 100% alcohol in advance, the amount of the excrement sample contained in each tube is about 1 cubic centimeter, and each excrement sample is collected in 2 tubes in parallel and stored. In the collection process, the area contaminated by leaves or soil is avoided as much as possible, and the surface area of the excrement is collected to the maximum extent in a mode of obliquely scraping by using forceps (because the surface of the excrement is directly contacted with the intestinal canal wall, the most of the cynomolgus monkey cell groups can be obtained on the collection surface). And after the collection is finished, recording the collection information of the sample, including the longitude and latitude, the altitude, the collection date, the collection place name and the like of the sampling point.
3. Method for extracting DNA in fecal sample
The Kit for extracting DNA of the Yunnan golden monkey fecal sample is QIAamp DNA Stool Mini Kit (QIAGEN, 51604, Germany), and the extraction steps are as follows:
(1) 180 and 220 mg of feces were weighed and placed on ice in a 2ml centrifuge tube.
(2) 1ml of Buffer Inhibit EX Buffer was added to the sample and vortexed intermittently for 1-2min until the sample was completely homogenized.
(3) Centrifuge at full speed for 1.5min to pellet the feces (not to transfer any solid material. if particles are still visible in the supernatant, the sample is centrifuged again)
(4) Add 25. mu.l proteinase k to a new 2ml microcentrifuge tube.
(5) From step 4.3, 600. mu.l of the supernatant was pipetted into a 2ml centrifuge tube containing proteinase K.
(6) Incubate at 70 ℃ for 10min, mix 1-2 times halfway by inversion. The droplets on the tube caps were collected by brief centrifugation.
(7) Add 600. mu.l ethanol to the lysate and vortex and mix well. The droplets on the tube caps were collected by brief centrifugation.
(8) 600. mu.l of the solution obtained in the previous step was added to an adsorption column (the column was loaded into a 2ml collection tube). Centrifuge at 14000rpm (13400 Xg) at full speed for 1.5min, discard the waste, place the adsorption column into a new collection tube.
(9) Carefully open the column cover, add another 600. mu.l of lysate, centrifuge at 14000rpm (13400 Xg) at full speed for 1.5min, discard the waste, place the adsorption column in a new collection tube.
(10) Step 9 was repeated to load a third 600. mu.l aliquot of lysate onto the column.
(11) Carefully add 500. mu.l Buffer AW1 to the column. The centrifuge tube was closed and centrifuged at 14,000 rpm (13, 400 Xg) for 1.5 min. The centrifuge tube was removed and placed in a new 2ml collection tube. The old collection tube and the liquid therein are discarded.
(12) Carefully add 500. mu.l Buffer AW2 to the column. The centrifuge tube caps were closed and centrifuged at full speed 14,000 rpm (13, 400 Xg) for 3 min. The centrifuge tubes were removed and placed in new 2ml collection tubes (provided with kit). The old collection tube and liquid therein are discarded.
(13) The centrifuge tube was removed, placed in a new 2ml collection tube and centrifuged at full speed 14,000 rpm (13, 400 Xg) for 2 min. This step is used to eliminate the effect of residual Buffer AW 2.
(14) The column was transferred to a new 1.5ml centrifuge tube, sterile water was carefully added, allowed to stand at room temperature for 2min, and centrifuged at full speed 14,000 rpm (13, 400 Xg) for 2min to elute the DNA.
(15) PCR vials were prepared, 4ul of which was aspirated for agarose gel electrophoresis detection and quantification, and DNA samples in 1.5ml centrifuge tubes were quickly placed in a-20 ℃ freezer.
4. And extracting sample DNA, and quantifying the sample DNA by using a Nanodrop quantifier, wherein the quantitative result shows that the nucleic acid concentration of the DNA sample is 30-400 ng/mu l, the OD260/280 is about 1.7-2.2, the OD260/230 is about 1.5-2.0, and the detection result of 1% agarose gel electrophoresis shows that the target band is clear and bright, which indicates that the DNA with better quality is extracted.
5. Method for comparing amplification effect of primers
The DNA of the golden monkey is amplified by using the traditional COI universal primer, the published primer GH (GL) and the primer provided by the invention respectively. This section is the contrast success rate.
The present invention employs a 25. mu.l PCR system, which comprises: 100ng-200ng of DNA sample, 12.5. mu.l of I-5TM2 × High Fidelity Master mix, 1. mu.l each of the primers (10. mu. mol/L), sterile water to make up to a total volume of 25. mu.l.
By carrying out gradient PCR experiments on the annealing temperature, the PCR amplification effect with 62 ℃ as the annealing temperature is optimal, and the finally used PCR conditions are as follows: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 1 min, annealing at 62 ℃ for 1 min, extension at 72 ℃ for 1 min, and 40 cycles of reaction; extension was carried out for 7 minutes at 72 ℃. After the amplification product was obtained, the size, brightness and purity of the product were checked by electrophoresis on 1% agarose gel.
The target band with the size of about 850 +/-15 bp is detected, and the sample to be detected can be preliminarily determined to be the Yunnan golden monkey (shown in figure 2).
6. Sequencing the amplification result, and splicing and manually correcting the sequencing result.
Sequencing the amplification result by a Sanger sequencing method by using an Applied Biosystems Inc.3730 full-automatic DNA sequencer, and splicing and manually correcting the sequencing result; primers and ambiguous fragments were removed.
7. Performing blast species identification according to the D-loop sequencing result, and determining that the sample is from the Yunnan golden monkey. And finding out a reference sequence of the Yunnan golden monkey in a database by using BLAST in GenBank for comparison, and determining that the species of the sample and the species of the known sequence are the same when the homology of the comparison result and the known sequence in the database is more than 97 percent according to the existing research.
The above description is only an embodiment of the present invention, and the common general knowledge of the known specific structures and characteristics in the schemes is not described in detail herein. It should be noted that the above-mentioned embodiments do not limit the present invention in any way, and all technical solutions obtained by means of equivalent substitution or equivalent transformation for those skilled in the art are within the protection scope of the present invention. The scope of the claims of the present application shall be determined by the contents of the claims, and the description of the embodiments and the like in the specification shall be used to explain the contents of the claims.
<110> yunnan university
<120> primer group for molecular biology research of Yunnan golden monkey and application method thereof
<160>6
<210>1
<211>19
<212>DNA
<213> Artificial sequence
<400>1
TGGCCGTGAGGTAAGAACC
<210>2
<211>23
<212>DNA
<213> Artificial sequence
<400>2
CCACAAATCCAAACAACAGAGTA
<210>3
<211>17
<212>DNA
<213> Artificial sequence
<400>3
TCGCGTGCAGACCAGAG
<210>4
<211>21
<212>DNA
<213> Artificial sequence
<400>4
CCACAAATCCAAACAACAGAG
<210>5
<211>24
<212>DNA
<213> Artificial sequence
<400>5
GCAGACCAGAGATAAAAGATACCA
<210>6
<211>24
<212>DNA
<213> Artificial sequence
<400>6
CCATACTCCACAAATCCAAACAAC
Claims (9)
1. A primer group for the research of the molecular biology of the golden monkey is characterized in that the primer group comprises a primer pair A; the primer pair A is D-lopF: TGGCCGTGAGGTAAGAACC and D-lopR: CCACAAATCCAAACAACAGAGTA are provided.
2. The use of the primer set of claim 1, wherein the primer set is used for species identification of Yunnan golden monkey or genetic diversity research of Yunnan golden monkey or establishment of germplasm resource bank of Yunnan golden monkey.
3. The primer set application of claim 2, which is used for species identification of the golden monkey and comprises the following steps: 1) downloading a plurality of Yunnan golden monkey mitochondrial sequences in an NCBI database, and finding out homologous sequences after Alignment; 2) designing a plurality of pairs of primers by using primer design software based on the homologous sequences; 3) collecting a fecal sample; 4) extracting DNA of a fecal sample by a kit method and detecting the quality of the DNA; 5) amplifying the extracted DNA by using a primer pair A; the DNA amplification parameters were: a25 mu l PCR system is adopted, and the composition comprises: 100ng-200ng DNA sample, 12.5 mu L I-5TM2 x High Fidelity Master mix, 1 mu L of each primer and 10 mu mol/L of each primer, and adding sterile water to make up to the total volume of 25 mu L; the PCR conditions were: pre-denaturation at 95 ℃ for 2 min; denaturation at 94 ℃ for 1 min, annealing at 62 ℃ for 1 min, extension at 72 ℃ for 1 min, and 40 cycles of reaction; stretching for 7 minutes at 72 ℃; 6) sequencing the amplification result, comparing the amplification sequencing success rates of different primers, and splicing and manually correcting the sequencing result; 7) performing blast species identification according to the sequencing result, and determining the species source of the sample.
4. The use of claim 3, wherein step 3) is performed by collecting a stool sample having the following: 1) collecting the surface area of the excrement to the maximum extent by adopting a forceps inclined scraping mode; 2) the fecal sample has smooth surface, fresh green color and cubic shape.
5. The use according to claim 3, wherein the step 4) is a kit method for extracting DNA from a fecal sample, and comprises the following steps: the feces were pelleted by centrifugation at full speed, and the sample was centrifuged again if fecal pellets were still visible in the supernatant during centrifugation.
6. The primer set of claim 1, further comprising a primer pair B, wherein the primer pair B is D-loop-L6: TCGCGTGCAGACCAGAG and D-loop-H6: CCACAAATCCAAACAACAGAG, respectively; or the primer group also comprises a primer pair C, wherein the primer pair C is D-loop-L7: GCAGACCAGAGATAAAAGATACCA and D-loop-H7: CCATACTCCACAAATCCAAACAAC, respectively; selecting one of the primer pair B and the primer pair C to be combined with the primer pair A for use or jointly using the primer pair A, the primer pair B and the primer pair C.
7. The primer set according to claim 6, wherein the primer set is used in the order of using primer pair A first; next, primer pair B and/or primer pair C are used.
8. The primer set of claim 6 or 7, wherein the DNA amplification parameters of primer pair B and primer pair C are the same as the DNA amplification parameters of primer pair A.
9. The use of the primer set of claim 6, wherein the method steps of the species identification of the cynomolgus monkey comprise only the comparison of electrophoresis detection photographs after DNA amplification and do not comprise the comparison of sequencing results.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911168704.9A CN110760598B (en) | 2019-11-25 | 2019-11-25 | Primer group for Yunnan golden monkey molecular biology research and application method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911168704.9A CN110760598B (en) | 2019-11-25 | 2019-11-25 | Primer group for Yunnan golden monkey molecular biology research and application method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110760598A CN110760598A (en) | 2020-02-07 |
| CN110760598B true CN110760598B (en) | 2022-06-10 |
Family
ID=69339535
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911168704.9A Active CN110760598B (en) | 2019-11-25 | 2019-11-25 | Primer group for Yunnan golden monkey molecular biology research and application method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110760598B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1231596C (en) * | 2001-12-27 | 2005-12-14 | 赵兴波 | Method for making animal genetic information identification by utilizing mt DNA fingerprint |
| CN107475408A (en) * | 2017-09-19 | 2017-12-15 | 中国科学院水生生物研究所 | A kind of Culter fishes D loop areas complete sequence sequencing primer special and application |
| CN107858439A (en) * | 2017-11-03 | 2018-03-30 | 四川省医学科学院·四川省人民医院实验动物研究所 | A kind of specific primer in macaca thibetana mitochondria D loop areas and detection method and application |
-
2019
- 2019-11-25 CN CN201911168704.9A patent/CN110760598B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110760598A (en) | 2020-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Castella et al. | Forensic evaluation of the QIAshredder/QIAamp DNA extraction procedure | |
| CN106434949A (en) | Acipenser dabryanus microsatellite marker as well as screening method and application of acipenser dabryanus microsatellite molecular marker | |
| CN109750093B (en) | Method for identifying or assisting in identifying liquorice | |
| CN102876777B (en) | The special primer of brown croaker EST microsatellite marker and screening method | |
| CN113789394A (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN110484629B (en) | Microsatellite marker related to growth traits of portunus trituberculatus, primers and application thereof | |
| CN107365839B (en) | Primer for identifying deer animals and application thereof | |
| CN107365840B (en) | Cervidae animal rapid identification kit based on DNA bar code and application thereof | |
| CN110760598B (en) | Primer group for Yunnan golden monkey molecular biology research and application method thereof | |
| CN112029868B (en) | Microsatellite marker of portunus trituberculatus and application of microsatellite marker in growth trait association analysis | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN109735644B (en) | Primer pair for identifying or assisting in identifying liquorice and application thereof | |
| CN109022610B (en) | Molecular specificity marker primer of anoectochilus formosanus and identification method thereof | |
| CN114015785B (en) | Microsatellite marker of original seed of blue crab in Bohai sea, primer and application thereof | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN111500732A (en) | Application of microorganism as diagnostic marker of endometrial cancer and kit | |
| CN110616270A (en) | COI gene sequence-based molecular identification method of beta and beta | |
| CN105177142A (en) | Hippocampus erectus microsatellite markers and screening method thereof | |
| CN111269997B (en) | Primer group for simultaneously detecting three microsporidia and application thereof | |
| CN107058509A (en) | Kit and its detection method for detecting SLC2A9 gene SNP site rs3775948 genotype | |
| CN116144784A (en) | Molecular marker technology for distinguishing wild abalone population from bottom sowing population based on SSR | |
| CN112575117B (en) | SSR molecular marker primers of non-heading Chinese cabbage and red-flowering Chinese cabbage and application thereof | |
| CN113981112B (en) | InDel marker C3082 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| Mortenson et al. | Parelaphostrongylus odocoilei in Columbian black-tailed deer from Oregon | |
| CN109735643B (en) | Primer pair for identifying or assisting in identifying astragalus membranaceus and application of primer pair |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |