CN110747211A

CN110747211A - CRISPR-based method for changing expression of gene product and application thereof

Info

Publication number: CN110747211A
Application number: CN201911050131.XA
Authority: CN
Inventors: 崔俊生; 王本旭; 刘树涛
Original assignee: Beijing Xingyuan Heji Life Medicine Technology Co Ltd
Current assignee: Beijing Xingyuan Heji Life Medicine Technology Co Ltd
Priority date: 2019-10-31
Filing date: 2019-10-31
Publication date: 2020-02-04

Abstract

The invention relates to the field of biological medicine, in particular to a method for changing gene product expression based on CRISPR and application thereof. The method comprises providing a non-naturally occurring nuclease system comprising one or more vectors comprising i) a nucleic acid sequence encoding a nuclease system guide RNA or a precursor thereof selected from at least one of SEQ ID NOs 1-9, and optionally ii) a nucleotide sequence encoding a genome-targeted nuclease; the guide RNA targets a target DNA, and the nuclease cleaves the target DNA to alter expression of a gene product. The method can simultaneously change the expression of gene products of three genes of IL1R11, TNFR1 and TNFR 2.

Description

CRISPR-based method for changing expression of gene product and application thereof

Technical Field

The invention relates to the field of biological medicine, in particular to a method for changing gene product expression based on CRISPR and application thereof.

Background

In recent years, the gene editing technology has breakthrough development, and particularly, the third generation gene editing technology CRISPR has obvious advantages, such as simple construction, high efficiency, simple and convenient operation and the like. CRISPR systems generally comprise the following parts: (1) a PAM site, which is located downstream of the target sequence and has only a few nt (e.g., spCAS 9/NGG; sacAS9/NNGRRT), and the target sequence is selected according to the PAM site; (2) target sequences, sequences that recognize and bind to the cleavage site, typically around 20 nt; (3) a piece of palindromic RNA sequence following the target sequence is ligated to the TracRNA; (4) cas9 endonuclease, with independent enzymatic activity. Cas9 contains 2 unique active sites, amino-terminal RuvC and HNH in the middle of the protein. The HNH active site in Cas9 cleaves the complementary DNA strand of the gRNA, and the RuvC active site cleaves the non-complementary strand. Nickase (Nickase) is a mutant of Cas9 protein, and RuvC or HNH sharp sites of the Nickase are inactivated, so that the Nickase can only cut one DNA strand of a target sequence, and a DNA single-strand nick is formed. CRISPR generally works by the sgRNA, tracrRNA and Cas9 forming a complex that recognizes and binds to the sequence complementary to the crRNA, then unwinding the DNA double strand to form an R-loop, hybridizing the crRNA to the complementary strand, leaving the other strand in a free single-stranded state, then cleaving either or both strands of the DNA by the active site in Cas9, and finally introducing a DNA Double Strand Break (DSB) or Single Strand Break (SSB). There are two repair methods for DSB: one is non-homologous end joining (NHEJ) and one is Homologous Recombination (HR), which favours homologous recombination fragments in the presence of the latter. There are two repair modes for SSB: one is repair by homologous recombination in the presence of a homologous recombination fragment, using the complementary strand that has not been broken as a template. By utilizing the principle, the specific gene can be subjected to mutation knockout or fixed point editing, and compared with random integration generally adopted at present, the safety risk of fixed point gene editing is more controllable.

IL-1 β is a causative agent of many rheumatic arthritis and is therefore also a member of the IL-1 family of greatest interest.

IL-1 family members include IL-1 α, IL-1 β, IL-1Ra, IL-18, IL-33, IL-36 α, IL-36 β, IL-36 gamma, IL-36Ra, IL-37, IL-38, wherein IL-1 α, IL-1 β, IL-18, IL-33, IL-36 α, IL-36 β, IL-36 gamma are pro-inflammatory factors, and IL-1Ra, IL-36Ra, IL-37, IL-38 are anti-inflammatory factors.

IL-1 β binds to the IL-1R1 receptor first, resulting in a change in the structure of IL-1R1, and then the IL-1 β/IL-1R1 complex binds to IL-1R3, forming an IL-1 β/IL-1R1/IL-1R3 aggregate, activating the NF-. kappa.B pathway, IL-1R1 binds to different ligands and undergoes different allosteric phenomena, after the anti-inflammatory factor IL-1Ra binds to IL-1R1, IL-1R1 is likewise allosteric, but after the allosteric IL-1R1 no longer binds to IL-1R3, inhibiting the NF-. kappa.B pathway IL-1 β can also bind to IL-1R2, but this receptor lacks an intracellular domain and is unable to produce any signaling.

IL-1 β is secreted mainly by cells of myeloid origin like monocytes and macrophages, but T, B cells do not secrete IL-1 β IL-1 β 0 is not secreted by the original macrophages, but once macrophages are stimulated by a TLR (Toll-like receptor) ligand, or IL-1 α, or IL-1 β, macrophages express secreted IL-1 β in large amounts, in the early phase of KOA, predominantly synovial intimal hyperplasia is observed, in which predominantly macrophages accumulate, and macrophages are the predominant cells secreted by IL-1 β. with the progress of KOA, B-type synovial cells on the synovial intima gradually become fibroblasts due to the stimulation of an inflammatory environment, and thereafter secrete IL-1 β predominantly by these fibroblasts. Studies have found that, in the presence of IL-1 β antagonists, synovial cells cultured in vitro, chondrocytes, and small knee joint synovial fluids in vivo, the expression of IL-1 β is markedly reduced, and that, after gene technology silencing IL-1R-1 on cartilage cultured in vitro, IL-1R 5392 is also markedly enhanced in the articular membrane repair capacity after local injection of IL-1- β.

Since the discovery of TNF- α in 1975, researchers have had extensive knowledge of its properties and mechanism of action TNF- α plays an important role in the immune-modulating response of the body.

TNF superfamily members are 19 TNF which is secreted mainly by monocytes or macrophages, and other cells like T cells, B cells, host cells, NK cells, neutrophils, fibroblasts and osteoblasts can secrete TNF- α with only a small amount.

TNFR family members include 29, among which the TNF- α related receptors TNFR1 and TNFR2 are expressed by all tissue cells, TNFR1 and TNFR2 is predominantly expressed on the cell membrane of immune, neuronal, epithelial cells, both of which are similar to the TNF-binding extracellular domain, except for their intracellular domains TNFR1, which has a death domain (TRADD), TNFR2, which has no TRADD in its intracellular domain, but a domain that recruits two

TRAFs

1 and 2, TNFR1 and 2, which activate the NF- κ B pathway, and TNFR1, which activates the process of cell death by TRADD.

The early and middle stage joint synovial fluid contains a large amount of sTNF- α, the NF-kB channel is activated by TNFR, so that the expression of proinflammatory molecules of chondrocytes, synoviocytes and synovial fibroblasts is promoted to be up-regulated, the degradation process of ECM is accelerated, and the damage degree of cartilage tissues is increased.

IL-1 β, TNF- α may have negative effects in the treatment of certain diseases such as rheumatoid arthritis and knee osteoarthritis, and thus in some cases there is a need for effective inhibition of the physiological effects of IL-1 β and/or TNF- α.

Disclosure of Invention

The present invention relates to a method of altering expression of a gene product comprising providing a non-naturally occurring nuclease system comprising one or more vectors comprising:

i) 1-9, and optionally ii) a nucleotide sequence encoding a genome-targeted nuclease;

the gRNA targets a target DNA, and the nuclease cleaves the target DNA to alter expression of a gene product.

The invention also relates to a method of making a modified cell comprising using a method as described above to alter the expression of a gene product selected from at least one of IL1R1, TNFR1 and TNFR 2.

The invention also relates to vectors as referred to in the above method, to transcripts and/or proteins related to said vectors, and to modified cells prepared as described above.

The invention also relates to a pharmaceutical composition comprising at least one of a vector as described above, a transcript and/or protein as described above and a cell as described above, and a pharmaceutically acceptable carrier.

Compared with the prior art, the invention has the beneficial effects that:

(1) can simultaneously change the expression of gene products of three genes of IL1R1, TNFR1 and TNFR2, and can also respectively and effectively edit the three genes.

(2) The knockout efficiency is high.

(3) Off-target effects were not significant and treated cells were still able to survive and differentiate normally.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 is a graph of antibiotic pressure screening MSC trends in one embodiment of the invention;

FIG. 2 is an electrophoresis chart of the T7E1 gene mutation detection kit according to one embodiment of the present invention;

FIG. 3 shows an embodiment of the present invention in which MSC/IL1R1^-Cellular TGF- β expression profiles;

FIG. 4 is an embodiment of MSC/TNFR1^-Cellular IL-8 expression profiles;

FIG. 5 is an embodiment of MSC/TNFR2^-Cellular IGF-1 expression profiles;

FIG. 6 shows an embodiment of the present invention in which MSC/IL1R1^-/TNFR1^-/TNFR2^-Differentiation into adipocytes, osteoblast maps;

FIG. 7 shows an embodiment of the present invention in which the PCR method is used to detect MSC/IL1R1^-/TNFR1^-/TNFR2^-mRNA expression profile for differentiation to adipocyte marker LPL and to osteoblast marker OPN.

Detailed Description

Reference will now be made in detail to embodiments of the invention, one or more examples of which are described below. Each example is provided by way of explanation, not limitation, of the invention. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the scope or spirit of the invention. For instance, features illustrated or described as part of one embodiment, can be used on another embodiment to yield a still further embodiment.

It is therefore intended that the present invention cover the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents. Other objects, features and aspects of the present invention are disclosed in or are apparent from the following detailed description. It is to be understood by one of ordinary skill in the art that the present discussion is a description of exemplary embodiments only, and is not intended as limiting the broader aspects of the present invention.

The present invention provides a method of altering expression of a gene product comprising providing a non-naturally occurring nuclease system comprising one or more vectors comprising:

Both components i) and ii) may be located on the support, it being also possible for ii) to be located on a different support.

The target sequences corresponding to the nucleotide sequences shown by SEQ ID NO. 1-9 have good specificity, are not easy to miss targets and have high gene editing (such as knockout) efficiency.

The invention adopts a gene editing system based on a CRISPR system, can efficiently edit one or more genes of IL1R1, TNFR1 or TNFR2 in host cells, thereby effectively inhibiting the action of cytokines such as IL-1 β and/or TNF- α and the like and the signal path thereof, not only being used for treating autoimmune diseases (particularly arthritis diseases), but also being capable of building a research platform of the autoimmune diseases and promoting the research of the pathogenesis of the diseases.

In certain embodiments, the precursor to the gRNA may be provided by a DNA molecule or an expression vector comprising a nucleic acid encoding the gRNA.

In some embodiments, the altering the expression of the gene product is specifically downregulating the expression of the target gene.

In some embodiments, the nuclease includes, without limitation, Cas1, Cas1B, Cas2, Cas3, Csy3, Cse 3, Csc 3, Csa 3, Csn 3, Csm3, Cmr3, Csb3, Csx 36x 3, Csx3, CsaX 3, csaf 3, Csc 3, Csx3, csxc 3, Csx3, csxc 363672, csxc. These enzymes are well known to those skilled in the art.

In some embodiments, the nuclease is Cas.

In some embodiments, the nuclease is Cas 9.

In some embodiments, the Cas9 is from streptococcus pyogenes or streptococcus pneumoniae.

In some embodiments, conventional virus-based systems may include retroviral, lentiviral, adenoviral, adeno-associated, and herpes simplex virus vectors for gene transfer; such viruses are typically replication-defective; preferably a lentivirus.

In some embodiments, the vector is LentiCRISPR v 2.

In some embodiments, the method is performed extracellularly or intracellularly.

According to a further aspect of the invention, the invention also relates to a method of making a modified cell comprising using a method as described above to alter the expression of a gene product selected from at least one of IL1R1, TNFR1 and TNFR 2.

In some embodiments, the cell is a eukaryotic cell.

In some embodiments, the cell is a non-human mammalian cell.

In some embodiments, the cells include, without limitation, cattle, horses, dairy cows, pigs, sheep, goats, rats, mice, dogs, cats, rabbits, camels, donkeys, deer, mink, chickens, ducks, geese, turkeys, bangs, and the like.

In some embodiments, the cell is a human cell.

In some embodiments, the cell is a non-human germ cell, fertilized egg, or single-cell embryo.

In some embodiments, the transfected cells are taken from a subject.

In some embodiments, the cell is derived from a cell taken from the subject, e.g., a cell line. Various cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, C8161, CCRF-CEM, MOLT, mIMCD-3, NHDF, HeLa-S3, Huh1, Huh4, Huh7, HUVEC, HASMCC, HEKn, HEKa, MiaPaCell, Panel, PC-3, TF1, CTLL-2, C1R, Rat6, CV1, RPTE, A10, T24, J24, A375, ARH-77, Calu 24, SW480, SW620, SKOV 24, SK-UT, CaCo 24, P388D 24, SEM-K24, WEHI-231, HB 24, TIB 24, Jurkat, J24, Bcl-1, BC-3, IC 24, DLD 24, Raw264.7, NRK, NRK-52, MRK-C72, MRCOS-72, mouse COS-3, mouse stem/mouse stem cells, mouse stem cells; mouse fibroblasts, 293-T, 3T3, 721, 9L, A2780, A2780ADR, A2780cis, A172, A20, A253, A431, A-549, ALC, B16, B35, BCP-1 cells, BEAS-2B, bEnd.3, BHK-21, BR 293, BxPC3, C3H-10T1/2, C1/36, Cal-27, CHO, CHO-7, CHO-IR, CHO-K1, CHO-K1, CHO-T, CHO Dhfr-/-, COR-L1, COR-L1/CPR, COR-L1/5010, COR-L1/R1, COS-7, COV-434, LT1, CT 1, D1, EMDH 72, CAHB-L1, EMHB-1, HCHB-, jurkat, JY cells, K562 cells, Ku812, KCL22, KG1, KYO1, LNCap, Ma-MeI 1-48, MC-38, MCF-7, MCF-10A, MDA-MB-231, MDA-MB-468, MDA-MB-435, MDCK II, MDCK II, MOR/0.2R, MONO-MAC6, MTD-1A, MyEnd, NCI-H69/CPR, NCI-H69/LX10, NCI-H69/LX20, NCI-H69/LX4, NIH-3T3, NALM-1, NW-145, OPCN/OPCT cell lines, Peer, PNT-1A/PNT 2, RenCa, RIN-5F, RMA/RMM, Saos-2 cells, Skf-9, Skf-9338, KCL-22, KG-7, VeraP-373U-3, BCU-3, MCU-7, MCF-6, MCD-7, MCD-6, and VerI-H-7, x63, YAC-1, YAR and transgenic varieties thereof. Cell lines can be obtained from a variety of sources known to those skilled in the art, such as a depository.

In some embodiments, the cell is selected from at least one of a pluripotent stem cell, a totipotent stem cell, and a unipotent stem cell.

In some embodiments, the pluripotent stem cells are selected from mesenchymal stem cells.

In some embodiments, the mesenchymal stem cell is selected from at least one of a bone marrow mesenchymal stem cell, an adipose mesenchymal stem cell, an umbilical cord blood mesenchymal stem cell, a placenta mesenchymal stem cell, and a liver mesenchymal stem cell.

In some embodiments, the method is performed in vivo or in vitro.

In some embodiments, the Cas protein is codon optimized for more efficient expression in the cell.

Codon optimization can be manipulated according to the codon preference of the host, which is easy for the skilled person.

According to a further aspect, the invention also relates to a vector as defined in the above method, and to the transcripts and/or proteins obtained from said vector.

Wherein the transcript is typically RNA.

In some embodiments, the vectors, transcripts, and/or vectors of the invention include regulatory elements commonly used in genetic engineering, such as enhancers, promoters, Internal Ribosome Entry Sites (IRES), and other expression control elements (e.g., transcription termination signals, or polyadenylation signals and poly-U sequences, etc.).

In some embodiments, the vectors, transcripts, and/or vectors of the invention may further comprise fragments of genes used for screening (e.g., antibiotic resistance genes), nucleic acids for producing fluorescent proteins, and the like. The fluorescent protein can be selected from green fluorescent protein, blue fluorescent protein, yellow fluorescent protein, orange fluorescent protein or red fluorescent protein. The green fluorescent protein can adopt common GFP, and can also adopt modified GFP genes, such as enhanced GFP gene EGFP and the like; the blue fluorescent protein can be selected from EBFP, Azuritc, TagBFP and the like; the yellow fluorescent protein can be selected from EYFP, Ypct, PhiYFP and the like; the orange fluorescent protein can be selected from mKO, mOrange, mBanana and the like; the red fluorescent protein can be selected from TagRFP, mRuby, mCherry and mKatc.

According to a further aspect of the invention, the invention also relates to a modified cell prepared by a method as described above.

According to a further aspect of the invention, the invention also relates to a pharmaceutical composition comprising at least one of a vector as described above, a transcript and/or protein as described above and a cell as described above, and a pharmaceutically acceptable carrier.

The vectors described herein are often used in the art of recombinant nucleic acids in the form of plasmids.

The pharmaceutical composition can be used for treating immune diseases, and is particularly suitable for treating rheumatoid arthritis and knee osteoarthritis.

Thus, in particular, the present invention also relates to a method for treating rheumatoid arthritis and knee osteoarthritis in a subject in need thereof, the method comprising:

a) providing the pharmaceutical composition;

b) administering a therapeutically effective amount of the pharmaceutical composition to the affected area of the subject.

In the present invention, the terms "subject", "patient", and the like are used in common as needed. The subject may be a mammal, preferably a human. In some embodiments, the cells comprised in the pharmaceutical composition are transfected when they are naturally present in the subject.

In some embodiments, the treatment may be administered topically to the affected area (particularly the hand and foot joints and their surroundings), or by implantation, or by injection, or the like.

In some aspects, the presently disclosed subject matter provides methods comprising delivering one or more polynucleic acids, e.g., one or more of the vectors described herein, one or more transcripts thereof, and/or one or more proteins transcribed therefrom, to a host cell. In some aspects, the presently disclosed subject matter also provides cells produced by these methods, and organisms comprising or produced by these cells. The above products may constitute pharmaceutical compositions according to the invention. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids in mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding CRISPR system components to cells in culture or in a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the vectors described herein), naked nucleic acid, and nucleic acid complexed with a delivery vehicle (e.g., liposomes). Viral vector delivery systems include DNA and RNA viruses that have an appended or integrated genome after delivery to a cell.

Methods for non-viral delivery of nucleic acids include lipofection, nuclear transfection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations or lipids nucleic acid conjugates, naked DNA, artificial viral particles and agent-enhanced uptake of DNA.

Methods of viral delivery of nucleic acids can be administered directly to the subject or can be used to treat cells in vitro, and modified cells can optionally be administered to the subject. Transfection with vectors allows integration into the host genome, often resulting in long-term expression of the inserted transgene. In addition, high transduction efficiencies have been observed in many different cell types and target tissues.

Embodiments of the present invention will be described in detail with reference to examples.

Examples

Screening of CRISPR-Cas knockout IL1R1 and TNFR genes

1. gRNA design and preparation

(1) The IL1R1 gRNA sequence (the targeting site is located in the 4 th exon of IL1R 1).

gRNA sequence 1(SEQ ID NO:1)

GAGGCTTGTTCTGTAGATAC

gRNA sequence 2(SEQ ID NO:2)

CTCTTTGTGTTGATGAATCC

gRNA sequence 3(SEQ ID NO:3)

TCATTTGGGTTAAGAGGACA

(2) TNFR1 gRNA sequence (the targeting site of SEQ ID NO:4 is located at exon 1 of TNFR 1; the targeting site of SEQ ID NO:5 is located at exon 6 of TNFR 1; and the targeting site of SEQ ID NO:6 is located at exon 10 of TNFR 1).

gRNA sequence 4(SEQ ID NO:4)

GCAGGTCAGGCACGGTGGAG

gRNA sequence 5(SEQ ID NO:5)

GGCACAACTTCGTGCACTCC

gRNA sequence 6(SEQ ID NO:6)

ACCACGGCGTACAGCGTCGC

(3) TNFR2 gRNA sequence (targeting site located at exon 2 of TNFR 2).

gRNAsequence 7(SEQ ID NO:7)

GGCATTTACACCCTACGCCC

gRNA sequence 8(SEQ ID NO:8)

TCTGAGCCGGCATGTGCTCC

gRNAsequence 9(SEQ ID NO:9)

GGTCATAGTATTCTCTGAGC

(2) The sense strand and the antisense strand of the target sequence with sticky ends were synthesized separately (cacc added to the 5 '-end of the sense strand, caccc added to the 5' -end of the sense strand if the 1 st nucleotide at the 5 '-end of the sense strand is not guanine G; aaac added to the 5' -end of the antisense strand, and C added to the 3 '-end of the antisense strand if the 1 st nucleotide at the 5' -end of the sense strand is not guanine G).

(3) The sense strand and the antisense strand are mixed in equimolar amounts, treated at 100 ℃, then naturally cooled to room temperature for annealing treatment, and a double-stranded gRNA with a sticky end is synthesized.

2. Lentiviral vector preparation

(1) LentiCRISPR v2 was amplified and extracted, and plasmid concentration was determined.

(2) The LentiCRISPR v2 is cut by restriction enzyme BsmBI, and the reaction is terminated by adding loading buffer after 1h of enzyme cutting at 37 ℃.

(3) The linearized vector fragments were recovered by agarose gel electrophoresis and the concentration of the recovered product was determined and stored at-20 ℃ for future use.

3. Ligation transformation

(1) And (3) carrying out ligation reaction on the linearized LentiCRISPR v2 vector recovered from the gel cutting and the annealed gRNA double strand.

(2) And (3) transforming DH5 α by a connecting product heat shock method, adding a sterile LB culture medium (without antibiotics) into each centrifuge tube after transformation, uniformly mixing, and placing in a constant temperature shaking table for shaking culture and recovery.

(3) Recovered DH5 α bacteria were spread on LB solid plates (Amp)⁺) And inversely placing the mixture in a constant-temperature incubator at 37 ℃ for static culture for 12-16 h.

(4) Single colonies from the above plates were inoculated into LB liquid culture (Amp)⁺) Medium-scale culture.

(5) The above-described bacterial solutions were sequenced separately using human-u6 sequencing primer 5'-ATGGACTATCATATGCTTACCGTA-3'.

(6) And extracting plasmids from the bacterial liquid with correct sequencing, determining the concentration of the plasmids, and storing for later use.

4. Packaging lentiviruses

(1) A1.5 ml sterile EP tube was taken and 1.5. mu.g of the packaging plasmid and 250. mu.l of serum-free medium were added. Gently mix well and incubate for 5min at room temperature.

(2) A1.5 ml sterile EP tube was taken and 9. mu.l of liposome 2000 was dissolved in 250. mu.l of serum-free medium. Gently mix well and incubate for 5min at room temperature.

(3) The DNA solution and the liposome solution were gently mixed. Incubate at room temperature for 20 min.

(4) The 293T cells were trypsinized and counted. The cells were resuspended in serum-containing medium.

(5) In six well plates 1ml of growth medium containing serum was added per well, followed by addition of the DNA-liposome complex.

(6) 1ml of resuspended 293T cells (1X 10)⁶Individual cells/ml) were added to the plate. 37 ℃ and 5% CO₂Incubate overnight in the incubator.

(7) The medium containing the DNA-liposome complexes was removed and replaced with DMEM complete medium (containing sodium pyruvate and optional amino acids).

(8) And harvesting the supernatant containing the virus 48-72 h after transfection. Centrifuging at 3000rpm for 20min to remove precipitate.

(9) The virus titer was determined. The virus titer reaches 10⁸The above

(10) And freezing and storing the virus supernatant at-80 ℃.

5. Puromycin optimum pressure concentration screening

(1) Taking 96-well plate, MSC at 2X 10⁴Spreading in 24-well plate at 37 deg.C and 5% CO₂And (4) passing through the liquid.

(2) Puromycin was diluted with complete medium to the MSC culture wells at concentrations of 0, 0.1, 0.25, 0.75, 1, 1.5, 2, 5, 10 μ g/ml to 3 wells in parallel. 37 ℃ and 5% CO₂And (4) passing through the liquid.

(3) Cell status and death were observed daily.

(4) The minimum puromycin concentration for complete to dead mass of MSCs was determined.

The results of the experiment are shown in FIG. 1.

6. Lentiviral-infected MSC

(1) 18-24 hours before lentivirus transfection, MSC is added at 1 × 10⁵The/well was plated in 24-well plates. The number of cells in lentivirus transfection was 2X 10⁵About hole.

(2) The next day, the original medium was replaced with 2ml of fresh medium containing 6. mu.g/ml polybrene, and an appropriate amount of virus suspension was added. Incubation was performed at 37 ℃.

(3) After 4 hours 2ml fresh medium was added to dilute the polybrene.

(4) And (3) repeating the steps (2) and (3) to carry out secondary lentivirus infection.

(5) Repeating the steps (2) and (3) for the third lentivirus infection.

(6) The culture was continued for 24 hours, and the virus-containing medium was replaced with fresh medium.

(7) MSC culture was continued.

7. T7E1 gene mutation detection

(1) PCR amplification

IL1R1 target surrounding sequence.

aagaatatgaaagtgttactcagacttatttgtttcatagctctactgatttcttctctggaggctgataaatgcaaggaacgtgaagaaaaaataattttagtgtcatctgcaaatgaaattgatgttcgtccctgtcctcttaacccaaatgaacacaaaggcactataacttggtataaagatgacagcaagacacctgtatctacagaacaagcctccaggattcatcaacacaaagagaaactttggtttgttcctgctaaggtggaggattcaggacattactattgcgtggtaagaaattcatcttactgcctcagaattaaaataagtgcaaaatttgtggagaatgagcctaacttatgttataatgcacaagccatatttaagcagaaactacccgttgcaggagacggaggacttgtgtgcccttatatggagttttttaaaaatgaaaataatgagttacctaaattacagtggtataa

TNFR1 target-surrounding sequence.

actgtcccaactttgcggctccccgcagagaggtggcaccaccctatcagggggctgaccccatccttgcgacagccctcgcctccgaccccatccccaacccccttcagaagtgggaggacagcgcccacaagccacagagcctagacactgatgaccccgcgacgctgtacgccgtggtggagaacgtgcccccgttgcgctggaaggaattcgtgcggcgcctagggctgagcgaccacgagatcgatcggctggagctgcagaacgggcgctgcctgcgcgaggcgcaatacagcatgctggcgacctggaggcggcgcacgccgcggcgcgaggccacgctggagctgctgggacgcgtgctccgcgacatggacctgctgggctgcctggaggacatcgaggaggcgctttgcggccccgccgccctcccgcccgcgcccagtcttctcagatgaggctgcgcccctgcgggcagctctaaggaccgtcctgcga

TNFR2 target-surrounding sequence.

tgcggctccccgcagagaggtggcaccaccctatcagggggctgaccccatccttgcgacagccctcgcctccgaccccatccccaacccccttcagaagtgggaggacagcgcccacaagccacagagcctagacactgatgaccccgcgacgctgtacgccgtggtggagaacgtgcccccgttgcgctggaaggaattcgtgcggcgcctagggctgagcgaccacgagatcgatcggctggagctgcagaacgggcgctgcctgcgcgaggcgcaatacagcatgctggcgacctggaggcggcgcacgccgcggcgcgaggccacgctggagctgctgggacgcgtgctccgcgacatggacctgctgggctgcctggaggacatcgaggaggcgctttgcggccccgccgccctcccgcccgcgcccagtcttctcagatgaggctgc

(2) The PCR products of the MSCs modified by gene editing and the PCR products of the MSCs not modified by gene editing were annealed (95 ℃ C., 5min, natural cooling to room temperature) as follows.

(3) The three treatments were performed with 0.5. mu. l T7E1 enzyme added for 30min at 37 ℃.

(4) 2% agarose gel electrophoresis identification analysis.

The results of the experiment are shown in FIG. 2.

8. MSC Gene expression product analysis

(1) MSC/IL1R1 modified by gene editing^-、MSC/TNFR1^--、MSC/TNFR2^-、MSC/IL1R1^-/TNFR1^-、MSC/IL1R1^-/TNFR2^-、MSC/IL1R1^-/TNFR1^-/TNFR2^-And unedited modified MSCs at 1X 10⁵Spreading in 24-well plate at 37 deg.C and 5% CO₂And (4) incubating.

(2) When the fusion degree is 80%, appropriate amounts of IL-1 β and TNF- α are added respectively, and the culture is continued for 4 h.

(3) Cells were collected and total RNA was extracted.

(4) Adding PCR amplification primers:

TGF-βforward:5'-TGGAAACCCACAACGAAATC-3'

TGF-βreverse:5'-CTAAGGCGAAAGCCCTCAAT-3'

RT-PCR amplification product containing TGF- β gene fragment

tggaaacccacaacgaaatctatgacaagttcaagcagagtacacacagcatatatatgttcttcaacacatcagagctccgagaagcggtacctgaacccgtgttgctctcccgggcagagctgcgtctgctgaggctcaagttaaaagtggagcagcacgtggagctgtaccagaaatacagcaacaattcctggcgatacctcagcaaccggctgctggcacccagcgactcgccagagtggttatcttttgatgtcaccggagttgtgcggcagtggttgagccgtggaggggaaattgagggctttcgccttag

IL-8forward:5'-AGTGCTAAAGAACTTAGATG-3'

IL-8reverse:5'-TATGAATTATCAGCCCTCTT-3'

IL-8 gene fragment contained in RT-PCR amplification product

agtgctaaagaacttagatgtcagtgcataaagacatactccaaacctttccaccccaaatttatcaaagaactgagag tgattgagagtggaccacactgcgccaacacagaaattattgtaaagctttctgatggaagagagctctgtctggaccccaaggaaaactgggtgcagagggttgtggagaagtttttgaagagggctgagaattcata

IGF-1forward:5'-TGGTGGATGCTCTTCAGTTCG-3'

IGF-1reverse:5'-TTAGATCACAGCTCCGGAAGC-3'

RT-PCR amplification product containing IGF-1 gene segment

tggtggatgctcttcagttcgtgtgtggagacaggggcttttatttcaacaagcccacagggtatggctccagcagtcggagggcgcctcagacaggcatcgtggatgagtgctgcttccggagctgtgatctaa

The experimental results are shown in fig. 3, 4 and 5, respectively.

9. Gene modification MSC differentiation experiment

1) Differentiation of genetically modified MSCs into adipocytes

A. MSC cells were routinely revived. Counting cells, adjusting the cell concentration to 6X 10⁵/ml。

B. Umbilical cord MSCs resuspended in DMEM-H complete medium at 6X 10⁴Perwell was seeded in 24-well plates at 1mL per well.

C. Put 5% CO₂And culturing in an incubator at 37 ℃ under saturated humidity.

D. When the cells are 100% confluent, the medium is carefully aspirated away, and then 0.5-1 mL of fat-induced medium is added per well. The day of application of this medium was recorded as the first day of adipose differentiation.

E. Fresh adipose induction or maintenance medium was replaced according to the following differentiation schedule. (Care must be taken to change the solution each time, because the fat cells in the monolayer are easily shed)

F. After inducing differentiation for 21 days, the medium was carefully aspirated, cells were fixed with 4% paraformaldehyde, and incubated at room temperature for 30-40 minutes.

G. Carefully discard the fixative and wash three times with 1 × PBS for 5-10 minutes each time.

H. Washed twice with double distilled water.

I. 0.5ml to 1ml of oil red O was added, the cells were covered and incubated at room temperature for 50 minutes.

J. The oil red O was discarded and washed three times with double distilled water.

K. And adding 0.5ml of hematoxylin for counterstaining for 5-15 minutes.

L, washing with double distilled water for three times, and performing microscopic examination.

M, unfixed, stained cells were used to detect the expression of lipid-associated protease (LPL) mRNA by PCR.

The results of the experiment are shown in FIG. 6.

2) Differentiation of genetically modified MSCs into osteoblasts

A. Tretinoin (vitronectin) and type I collagen (collagen I) were diluted with 1 XPBS, respectively, to a final concentration of 12. mu.g/mL.

B. A24-well plate was incubated overnight at room temperature with 0.5mL of a mixture of vitronectin and collagen type I (1: 1) per well.

C. The next day, aspirate and wash once with 1 × PBS until needed.

D. At 6X 10⁴Per well concentration umbilical cord MSCs were added to tretinoin and collagen type I coated 24 well plates at 1mL per well.

E. Put 5% CO₂And culturing in an incubator at 37 ℃ under saturated humidity.

F. When cells were 100% confluent, the medium was carefully aspirated off and 1mL of osteogenic induction medium was added per well. The day of application of this medium was recorded as the first day of osteogenic differentiation.

G. Fresh osteogenic induction medium was replaced every 2-3 days.

H. After inducing differentiation for 17 days, the medium was carefully aspirated, the cells were fixed with 4% paraformaldehyde, and incubated at room temperature for 30-40 minutes.

I. Carefully aspirate the fixative and wash three times with 1 × PBS for 5-10 minutes each.

J. Washed twice with double distilled water.

K. Cells were soaked in 5% silver nitrate for 2 hours.

L, ultraviolet irradiation for 1 hour.

M, washing with double distilled water for 2 minutes.

The residual silver nitrate was neutralized with N, 5% sodium thiosulfate.

And O, fully washing with water and performing microscopic examination.

P, unfixed, stained cells were tested for Osteopontin (OPN) mRNA expression by PCR.

The results of the experiment are shown in FIG. 7.

The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Beijing Xingyuan and economical medicine science and technology Limited

<120> CRISPR-based method for modifying gene product expression and application thereof

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213>artificial sequence

<400>1

gaggcttgtt ctgtagatac 20

<210>2

<211>20

<212>DNA

<213>artificial sequence

<400>2

ctctttgtgt tgatgaatcc 20

<210>3

<211>20

<212>DNA

<213>artificial sequence

<400>3

tcatttgggt taagaggaca 20

<210>4

<211>20

<212>DNA

<213>artificial sequence

<400>4

gcaggtcagg cacggtggag 20

<210>5

<211>20

<212>DNA

<213>artificial sequence

<400>5

ggcacaactt cgtgcactcc 20

<210>6

<211>20

<212>DNA

<213>artificial sequence

<400>6

accacggcgt acagcgtcgc 20

<210>7

<211>20

<212>DNA

<213>artificial sequence

<400>7

ggcatttaca ccctacgccc 20

<210>8

<211>20

<212>DNA

<213>artificial sequence

<400>8

tctgagccgg catgtgctcc 20

<210>9

<211>20

<212>DNA

<213>artificial sequence

<400>9

ggtcatagta ttctctgagc 20

Claims

1. A method of altering expression of a gene product comprising providing a non-naturally occurring nuclease system comprising one or more vectors comprising:

the guide RNA targets a target DNA, and the nuclease cleaves the target DNA to alter expression of a gene product.

2. The method of claim 1, the nuclease is Cas;

optionally, the nuclease is Cas 9.

3. The method of claim 1 or 2, wherein the vector is selected from the group consisting of retroviral, lentiviral, adenoviral, adeno-associated and herpes simplex viral vectors.

4. A method of making a modified cell comprising using the method of any one of claims 1 to 3 to alter expression of a gene product selected from at least one of IL1R1, TNFR1 and TNFR 2.

5. The method of claim 4, wherein the cell is a eukaryotic cell;

optionally, the cell is a non-human mammalian cell;

optionally, the cell is a human cell and is not a germ cell, a fertilized egg, or a single-cell embryo;

optionally, the cells are selected from at least one of pluripotent stem cells, multipotent stem cells, and unipotent stem cells;

optionally, the pluripotent stem cells are selected from mesenchymal stem cells;

optionally, the mesenchymal stem cell is selected from at least one of bone marrow mesenchymal stem cell, adipose mesenchymal stem cell, umbilical cord blood mesenchymal stem cell, placenta mesenchymal stem cell and liver mesenchymal stem cell.

6. The method of claim 4 or 5, wherein the Cas protein is codon optimized for more efficient expression in the cell.

7. A vector as defined in the process of any one of claims 1 to 6.

8. A transcript and/or a protein produced by the vector according to claim 7.

9. A modified cell prepared by the method of any one of claims 4 to 6.

10. A pharmaceutical composition comprising at least one of the vector of claim 7, the transcript and/or protein of claim 8 and the cell of claim 9, and a pharmaceutically acceptable carrier.