CN110736731B - Leukemia fusion gene detection method based on SERS (surface enhanced Raman scattering) spectrum technology - Google Patents

Abstract

The invention constructs a biosensor for specifically detecting the BCR-ABL fusion gene (b3a2), and can realize the quantitative detection of the leukemia fusion gene with ultrahigh sensitivity. The main technical idea is that the extremely high detection sensitivity of Surface Enhanced Raman Spectroscopy (SERS) is utilized, AgNPs and silver nanospheres on the SERS substrate are coupled to form a nanogap by utilizing complementary pairing of fusion gene DNA after the two-dimensional SERS substrate is assembled, the electromagnetic field in the nanogap is very strong due to mutual coupling of the two nanospheres, so that a hot spot structure with extremely strong SERS effect can be constructed, further, a marked molecular Raman signal is greatly enhanced, and finally, an SERS spectrum detection result with ultrahigh sensitivity can be obtained. The detection method can well solve the problems of low sensitivity, weak specificity and the like of the current clinical detection method, and provides a simple, quick and effective detection means for accurately diagnosing chronic myelogenous leukemia.

Description

Leukemia fusion gene detection method based on SERS (surface enhanced Raman scattering) spectrum technology

Technical Field

The invention belongs to the field of biomedical leukemia gene detection, and particularly relates to a method for realizing the ultrasensitive detection of a leukemia fusion gene (b3a2) based on an SER (serial-enhanced Raman scattering) technology.

Background

In recent years, the incidence of leukemia worldwide has increased year by year, with leukemia rates ranking eighth of all cancer rates in the united states. In China, leukemia ranks eighth in male morbidity and first in juvenile population morbidity and mortality. Currently, the medicine is classified into acute and chronic leukemia according to the degree of differentiation of leukemia cells. Chronic Myelogenous Leukemia (CML) is a form of chronic leukemia whose pathomechanism is translocation of the Philadelphi chromosome located between the long arms of human chromosomes 9 and 22. The specific molecular mechanism is that ABL gene located in the long arm of chromosome 9 of normal human body and BCR gene located in chromosome 22 of normal human body are recombined after chromosome translocation to generate BCR-ABL fusion gene. Among them, the ABL gene, also called ABL1 gene, is a protooncogene, and is fused with various genes in tumor cells, and among them, fusion with BCR gene is the most common one. The encoded tyrosine kinase protein is distributed in nucleus and cytoplasm, and the protein is closely related to cell differentiation, division, information transmission and the like. The protein coded by ABL gene has special kinase activity, and combines with external factors to induce cell to generate metabolic disorder so as to develop cancer. The BCR gene encodes a serine/threonine kinase analog. The product expressed by the fusion gene formed after the fusion of the BCR gene and the ABL gene has strong tyrosine kinase activity, the fusion gene can change the tyrosine phosphorylation degree of related proteins of cells, simultaneously, the performance of microfilament actin forming a cytoskeleton can also change, signal transmission in the cells can also be interfered, simultaneously, the apoptosis is inhibited, the cell cycle changes, the cell division becomes strong, and the survival time of the cells becomes long. The data show that more than 90% of blood cells of chronic myelogenous leukemia have the BCR-ABL fusion gene, so the BCR-ABL fusion gene can be used as a clinical diagnosis standard for the chronic myelogenous leukemia. The current clinical methods for detecting BCR-ABL fusion genes comprise chromosome detection, Fluorescence In Situ Hybridization (FISH) technology, real-time quantitative RT-PCR technology, nested RT-PCR, gene chip technology and the like, but the technical methods are limited by the reasons of low sensitivity, long time consumption, higher operation requirement, easy occurrence of false positive results and the like.

Since the advent of Surface Enhanced Raman Scattering (SERS), the SERS has attracted attention from many scientists, mainly because SERS spectra has high sensitivity and strong specificity, and has a narrow half-peak width of the peak and can provide abundant molecular fingerprint information, with low damage, short time consumption, easy operation and portability. Currently, SERS has been widely used in the fields of disease diagnosis, drug detection, food safety, material characterization, and the like. We have also recently performed a lot of research work in the diagnosis of SERS spectroscopic diseases. It is generally believed that the signal enhancement mechanism of SERS on the analyte comes from physical and chemical enhancement, and the physical enhancement contributes most. The noble metal nano material is often used as an SERS signal enhancement substrate due to the surface plasmon resonance effect, wherein the silver nano material has stronger plasmon resonance effect and is more in practical application. The position where the SERS effect is strongest was found to be located in the gap between the nanoparticles, called the "hot spot". Reasonable utilization and construction of 'hot spots' are the leading problems of the current SERS research and are the basis for promoting the application of SERS in more fields. It is generally believed that the effect of nanomaterials on the enhancement effect of SERS signals is mainly due to the following aspects: the size, the shape, the dispersity and the uniformity of the particles, the combination mode of the particles and the object to be detected and the like. Therefore, an easily prepared SERS substrate with good reproducibility, high sensitivity, strong stability and economy is always the target pursued by SERS researchers, and is also a key problem for preventing the popularization of the SERS substrate to more fields.

Disclosure of Invention

Compared with the method for clinically detecting the BCR-ABL fusion gene, SERS can just solve some problems faced by the BCR-ABL fusion gene. In the invention, silver nano particles (AgNPs) with negative electricity are synthesized, a hydroxylated silicon dioxide sheet is modified by a silane coupling agent, then a silicon wafer is put into water for protonation, and the AgNPs with negative electricity are assembled on the silicon dioxide sheet. Then, synthesizing the AgNPs with positive electricity, respectively assembling two sections of complementary sequences of the AgNPs with the BCR-ABL fusion gene on a silicon dioxide sheet SERS substrate and the AgNPs with positive electricity, and modifying a DNA fragment assembled in the AgNPs with positive electricity with Cy5 Raman labeled molecules. When a target sequence BCR-ABL fusion gene appears, the Raman labeling molecule Cy5 is exactly positioned at a 'hot spot' position formed by two silver nanospheres, BCR-ABL fusion gene (b3a2) standard samples with different concentrations are arranged, and high-sensitivity quantitative detection of the BCR-ABL fusion gene (b3a2) can be realized according to the change of the SERS spectrum intensity of the Raman labeling molecule Cy 5.

In order to achieve the purpose, the invention adopts the following technical scheme:

a method for realizing leukemia fusion gene (b3a2) detection based on SERS technology comprises the following steps:

1) preparation of SERS substrate

1-1) synthesizing AgNPs with negatively charged surfaces: using citric acid as a reducing agentSodium reduction of silver nitrate to colloidal silver: AgNO at a concentration of 1mM in a volume of 100mL₃The solution was boiled under vigorous stirring and 3mL of 1% sodium citrate was added. Keeping the liquid boiling, continuously heating and stirring for 60 minutes, and changing the color into yellow green

1-2) preparation of surface hydroxylated silica flakes: the silica sheet was cut into a size of 4mm × 4mm, and then subjected to ultrasonic treatment in acetone, ethanol, and ultrapure water for 10 minutes each. After being taken out and dried, the silicon dioxide slices are soaked in a freshly prepared piranha solution (a mixed solution of concentrated sulfuric acid and 30% hydrogen peroxide in a ratio of 7: 3) and heated to 150 ℃ for 30 minutes. After cooling, the silicon dioxide sheet is cleaned by ultrapure water, placed and dried, and the surface hydroxylation of the silicon dioxide sheet is completed.

1-3) protonation of the amino group of the silane coupling agent is completed: 150 mu L of silane coupling agent is dispersed in 150mL of ethanol, then the silica piece with the surface hydroxylated is soaked in the solution for 12h, and after being taken out, the unmodified silane coupling agent is taken out by washing with a large amount of water. And (3) airing the silicon dioxide sheet, and then soaking the silicon dioxide sheet in ultrapure water for 8 hours to complete protonation of amino groups of the silane coupling agent.

1-4) preparing a substrate: taking 370 mu L of newly synthesized silver nanoparticles obtained in the step 1), soaking the protonated silicon dioxide sheet in the silver nanoparticles for 4h, taking out the silicon dioxide sheet, and cleaning the silicon dioxide sheet with ultrapure water to obtain the SERS substrate.

2) Synthetic AgNPS with positively charged surface

Taking the concentration of 1.1 × 10^-3mol/L AgNO₃90ml of the solution was put into an Erlenmeyer flask and stirred. Respectively taking 6 × 10^{- 2}5ml of hydroxylamine hydrochloride in mol/L and 4.5ml of sodium hydroxide in 0.1mol/L are mixed and then quickly added into 90ml of AgNO₃In the solution, the solution in the Erlenmeyer flask changed from colorless to gray.

3) Assembly of SERS detection sensor

3-1) mu.L of 1. mu.M capture sequence and 20. mu.L of 1. mu.M signal sequence were taken and put into a mixed solution of 20. mu.L of TCEP (5 mM) and 50. mu.L of Tris-HCl buffer (1M, pH =7.4), respectively, to activate thiol groups. After reacting for 1 hour, soaking the silicon dioxide SERS substrate by using a capture sequence solution, mixing a signal sequence solution with a certain amount of AgNPs with positive charges, standing overnight at room temperature, respectively adding 20 mu L of 1 mu M6-sulfydryl-1-hexanol, reacting for 3 hours, and respectively washing by using a large amount of water to remove sequences which are not specifically combined, thereby finishing the modification of sulfydryl.

3-2) adding the positively charged AgNPs solution modified with the signal sequence into a silicon dioxide SERS substrate, adding target sequences with different concentrations, reacting for 4h, cleaning the silicon dioxide SERS substrate, and drying at normal temperature to prepare for the next SERS measurement.

The base sequences of the capture sequence, the signal sequence and the target sequence are as follows:

(1) capture sequence:

5’-SH-TTTTTCCCAACCCAACCCTCCTTGGAGTTCCAACGAGCGGCTTCACTCAGACCCTGAGGCTCAAAGTCAGATGCTACTGGCCGCTGAAGGGCTT-3’；

(2) signal sequence:

5’- Cy5-TTGAACTCTGCTTAAATC-SH-3’;

(3) the target sequence is:

GATTTAAGCAGAGTTCAA (fusion point) AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAGGGTTGGGTTGGGAAAAA.

The invention has the beneficial effects that: according to the invention, silicon dioxide is used as a substrate, silver nanoparticles (AgNPs) with negative charges are used as a substrate for surface enhanced Raman scattering detection, and a biosensor for specifically detecting BCR-ABL fusion genes (b3a2) is formed through subsequent treatment. And modifying the silicon dioxide sheet by using a silane coupling agent, protonating the silicon dioxide sheet, adsorbing the synthesized silver nanoparticles with negative electricity, and finally firmly assembling the silicon dioxide sheet on the silicon dioxide sheet by forming a chemical bond through silver and amino to construct a two-dimensional SERS substrate. Respectively modifying a signal chain and a capturing chain on AgNPs and SERS substrates with positive charges, adding the signal chain with Cy5 Raman labeled molecules, combining three sections of chains to form an SERS detection sensor, and realizing the quantitative detection of the BCR-ABL fusion gene (b3a2) by detecting the Raman spectrum signal of Cy 5. Meanwhile, the complementary match of the DNA can couple the AgNPs with positive electricity with the AgNPs on the SERS substrate to form a nanogap with a similar sandwich structure with Cy5 Raman labeled molecules, so that a 'hot spot' structure with a strong SERS effect is constructed, the effect of plasmon resonance is obviously enhanced, further the Raman signal of the labeled molecules in the hot spot structure is greatly enhanced, and finally a high-sensitivity SERS spectrum detection result is obtained.

Drawings

FIG. 1 is an experimental schematic diagram of detecting BCR-ABL fusion gene by SERS spectroscopy.

FIG. 2 is a UV-VIS absorption spectrum and scanning electron microscope image of AgNPs with negative and positive charges; wherein, (A) is the ultraviolet-visible absorption spectrum of the AgNPs with negative electricity and positive electricity, (B) is the transmission image of the AgNPs with negative electricity, and (C) is the TEM image of the AgNPs with positive electricity.

FIG. 3 is a scanning electron micrograph of a silica plate assembled with negatively charged AgNPs.

FIG. 4 shows the result of SERS spectrum detection of R6G solution; wherein (A) is SERS spectrum of R6G measured by dropping method and soaking method, and (B) is spectrum 611cm of R6GSERS measured by dropping method^-1Peak intensity variation, and (C) detecting R6G SERS spectrum 611cm by soaking method^-1The peak intensity changes.

FIG. 5 shows the result of SERS spectroscopy quantitative detection of BCR-ABL fusion gene (b3a 2); wherein (A) is BCR-ABL fusion gene (B3a2) SERS spectrogram with different concentrations, and (B) is Lg (C)_Target) And linear relationship between spectral peak intensities.

Detailed Description

The present invention will be further described with reference to the following detailed description and accompanying drawings.

1. Reagent

Silver nitrate (AgNO)₃) Hydroxylamine hydrochloride (HO-NH)₂HCl), sulfuric acid (H)₂SO₄) Anhydrous ethanol and hydrochloric acid (HCl) were purchased from national pharmaceutical group chemical reagents, Inc., silane coupling agent (. gamma. -aminopropyltriethoxysilane) was purchased from Shandong Youso chemical technology, Inc., trisodium citrate dihydrate (Na)₃C₆H₅O₇.2H₂O), sodium hydroxide (NaOH), 30% hydrogen peroxide (H)₂0₂) Purchased from west longu science corporation,4-aminothiophenol (4-ATP), Tris (2-carboxyethyl) phosphine (TCEP), Tris (hydroxymethyl) aminomethane (Tris) were purchased from Shanghai Aladdin Biotechnology Co., Ltd., 6-mercapto-1-hexanol (MCH) was purchased from Bailingwei Tech., Ltd., rhodamine 6G (R6G) was purchased from Sigma, silica pieces were purchased from Jiangsu flying boat glass Plastic Co., Ltd., and the DNA sequence used in this experiment was purchased from Shanghai Biotechnology Co., Ltd. All reagents were analytical grade and were not further purified.

2. Synthesis of AgNPs with negative surface

Lee and Meisel (Lee P C, Meisel D. addition and surface-enhanced Raman of dies on silver and gold gases [ J ] were used]The Journal of Physical Chemistry, 1982, 86(17): 3391-3395), etc., and The colloidal silver is synthesized by reducing silver nitrate with a reducing agent sodium citrate. The invention has the volume of 100mL and the concentration of 1mM AgNO₃The solution was boiled under vigorous stirring and 3mL of 1% sodium citrate was added. The liquid was kept boiling and stirring was continued for 60 minutes, and the color changed to yellow-green.

Preparation of SERS substrate

1) The silica sheet was cut into a size of 4mm × 4mm, and then subjected to ultrasonic treatment in acetone, ethanol, and ultrapure water for 10 minutes each. After being taken out and dried, the silicon dioxide slices are soaked in a freshly prepared piranha solution (a mixed solution of concentrated sulfuric acid and 30% hydrogen peroxide in a ratio of 7: 3) and heated to 150 ℃ for 30 minutes. After cooling, the silicon dioxide sheet is cleaned by ultrapure water, placed and dried, and the surface hydroxylation of the silicon dioxide sheet is completed.

2) 150 mu L of silane coupling agent (gamma-aminopropyltriethoxysilane) is dispersed in 150mL of absolute ethanol, then the silica piece with the surface hydroxylated is soaked in the solution for 12h, and after taking out, the unmodified silane coupling agent is taken out by washing with a large amount of water.

3) And (3) airing the silicon dioxide sheet, and then soaking the silicon dioxide sheet in ultrapure water for 8 hours to complete protonation of amino groups of the silane coupling agent. And (3) taking 370 mu L of silver nano particles newly synthesized in the step (2) with negative surfaces, soaking the protonated silicon dioxide sheet in the silver nano particles for 4h, taking out the silicon dioxide sheet and cleaning the silicon dioxide sheet by using ultrapure water.

4. AgNPS synthesis with positively charged surface

Taking the concentration of 1.1 × 10^-3mol/L AgNO₃90ml of the solution was put into an Erlenmeyer flask and stirred. Respectively taking 6 × 10^{- 2}5ml of hydroxylamine hydrochloride in mol/L and 4.5ml of sodium hydroxide in 0.1mol/L are mixed and then quickly added into 90ml of AgNO₃In the solution, the solution in the Erlenmeyer flask changed from colorless to gray.

Assembly of SERS detection sensor

1) mu.L of 1. mu.M capture sequence and 20. mu.L of 1. mu.M signal sequence were taken and put into a mixed solution of 20. mu.L of TCEP (5 mM) and 50. mu.L of Tris-HCl buffer, respectively, to activate thiol groups. After 1 hour of reaction, the silica SERS substrate was soaked with the capture sequence solution and the signal sequence solution was mixed with 500 μ L of positively charged AgNPs while standing overnight at room temperature.

2) mu.L of 1. mu.M 6-mercapto-1-hexanol was added to react for 3 hours, and then the sequences not specifically bound were washed away with a large amount of water, respectively, to complete the modification of the mercapto group. Adding a signal sequence modified positively charged AgNPs solution into a silicon dioxide SERS substrate, and adding target sequences (10) with different concentrations^-6To 10^-12Seven BCR-ABL fusion gene (b3a2) standard samples with concentration gradient) react for 4 hours, then the silicon dioxide SERS substrate is cleaned, and the Raman spectrum detection is carried out after the silicon dioxide SERS substrate is dried at normal temperature. The Raman spectrometer used was a Renishaw inVia Raman microchip (Renishaw plc, UK), the laser being a semiconductor laser with a wavelength of 785 nm.

The base sequences of the capture sequence, the signal sequence and the target sequence are as follows:

(1) capture sequence:

5’-SH-TTTTTCCCAACCCAACCCTCCTTGGAGTTCCAACGAGCGGCTTCACTCAGACCCTGAGGCTCAAAGTCAGATGCTACTGGCCGCTGAAGGGCTT-3’；

(2) signal sequence:

5’- Cy5-TTGAACTCTGCTTAAATC-SH-3’;

(3) the target sequence is:

GATTTAAGCAGAGTTCAA (fusion point) AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAGGGTTGGGTTGGGAAAAA.

The invention characterizes the synthesized AgNPs with negative charge and positive charge by ultraviolet-visible absorption spectrum and a scanning electron microscope. Fig. 2 (a) is an ultraviolet-visible absorption spectrum of negatively charged AgNPs, whose plasmon resonance peak is at 412nm, and positively charged AgNPs whose plasmon resonance peak is at 423 nm. As can be seen from the TEM image, the average particle size of the negatively charged AgNPs is 77 + -5 nm (FIG. 2B), and the average particle size of the positively charged AgNPs is 27 + -10 nm (FIG. 2C).

After the silane coupling agent is modified on the silicon dioxide sheet, an amino group is exposed outside, and after protonation treatment, the surface of the silicon dioxide sheet is positively charged, is mutually attracted with AgNPs with negative charges and finally forms a bond with the amino group, so that the assembly efficiency is improved. As can be seen from fig. 3, the negatively charged AgNPs are uniformly assembled on the silicon dioxide sheet, and the negatively charged AgNPs repel each other, so that the particles are arranged in a dispersed manner, a certain distance is maintained, the aggregation of the particles is less, and the particle assembly density on the whole silicon dioxide sheet is high.

To make the experimental data obtained in the present invention more reliable and reproducible, we compared rhodamine (R6G) SERS spectra obtained using the two methods. The prepared silicon dioxide SERS substrate is used for detection by adopting two methods of soaking and dropping 10 respectively^-6The results of SERS spectroscopy detection of the solution of R6G and R6G in mol/L are shown in FIG. 4. In fig. 4 (a), the black curve is a SERS spectrum obtained by the spot method, and the red curve is a SERS spectrum obtained by the immersion method of R6G solution, each spectrum being an average value taken from ten random points. FIG. 4 (B) is 611cm corresponding to SERS spectra of R6G solution obtained by randomly taking ten points in the spot-drop method^-1The peak intensity changes, and FIG. 4 (C) is 611cm corresponding to SERS spectra of R6G solution randomly taken ten points in the soaking method^-1Peak intensity variation of 611cm^-1The peak may be attributed to an in-plane bending vibration model of the C-C-C ring. Combining the three data plots in FIG. 4, although the intensity of the spectral peaks is stronger for the dropping method, the dropping method is more affected by the "coffee ring" effect, and the infusion method is affected by the "coffee ring" effect, as analyzed from the Relative Standard Deviation (RSD)Is smaller. Therefore, the subsequent data of the study all adopt a soaking method. Meanwhile, RSD data also prove that the SERS substrate in the research has better uniformity and reproducibility.

This study took 10^-6To 10^-12SERS spectrum quantitative detection of the BCR-ABL fusion gene (b3a2) is carried out on seven standard samples of the BCR-ABL fusion gene (b3a2) with concentration gradients, and the obtained result is shown in FIG. 5. Selecting 691cm^-1Performing linear fitting on the Cy5SERS spectral characteristic peak at the wave number position and the target chain concentration to obtain the logarithm Lg (C) of the Raman signal intensity I and the target chain concentration_-Target) The linear relationship between:

I=5.9832×10^-4Lg(C_-Target) +0.00822, the limit of detection (LOD) of this detection method was calculated to be 42.28fM, which is reported to be 10 for real-time fluorescent quantitative PCR detection^-5~10^-6M, compared with the detection limit of the method, the detection limit is improved by 8 orders of magnitude. Therefore, the method can realize the ultrasensitive SERS spectrum detection of the BCR-ABL fusion gene (b3a 2).

SEQUENCE LISTING

<110> university of Fujian profession

<120> leukemia fusion gene detection method based on SERS spectroscopy technology

<130> 3

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 94

<212> DNA

<213> Artificial sequence

<400> 1

tttttcccaa cccaaccctc cttggagttc caacgagcgg cttcactcag accctgaggc 60

tcaaagtcag atgctactgg ccgctgaagg gctt 94

<210> 2

<211> 18

<212> DNA

<213> Artificial sequence

<400> 2

ttgaactctg cttaaatc 18

<210> 3

<211> 112

<212> DNA

<213> Artificial sequence

<400> 3

gatttaagca gagttcaaaa gcccttcagc ggccagtagc atctgacttt gagcctcagg 60

gtctgagtga agccgctcgt tggaactcca aggagggttg ggttgggaaa aa 112

Claims (2)

1. A leukemia fusion gene detection method based on SERS spectroscopy is characterized by comprising the following steps:

1) preparation of SERS substrate

1-1) synthesizing AgNPs with negatively charged surfaces: reducing silver nitrate by using a reducing agent sodium citrate to synthesize colloidal silver: mixing AgNO₃Heating the solution under vigorous stirring, boiling, and adding sodium citrate; keeping the liquid boiling, continuously heating and stirring for 60 minutes, and changing the color into yellow green;

1-2) preparation of surface hydroxylated silica flakes: cutting the silicon dioxide sheet into the size of 4mm multiplied by 4mm, and then respectively carrying out ultrasonic treatment in acetone, ethanol and ultrapure water for 10 minutes; taking out and drying, soaking the silicon dioxide slices in a freshly prepared piranha solution, heating, cooling, cleaning with ultrapure water, standing and drying in the air to finish surface hydroxylation of the silicon dioxide slices;

1-3) protonation of the amino group of the silane coupling agent is completed: dispersing a silane coupling agent in ethanol, then soaking a silica sheet with a hydroxylated surface in the solution, taking out, washing with a large amount of water, taking out the unmodified silane coupling agent, airing the silica sheet, and then soaking in ultrapure water to complete protonation of an amino group of the silane coupling agent;

1-4) assembly of substrates: taking the silver nanoparticles newly synthesized in the step 1-1) and having the surfaces with negative electricity, soaking the protonated silicon dioxide sheet in the silver nanoparticles, taking out the silver nanoparticles and cleaning the silver nanoparticles with ultrapure water to obtain an SERS substrate;

2) synthetic AgNPS with positively charged surface

Taking AgNO₃Putting 90ml of the solution into a conical flask and stirring; the hydroxylamine hydrochloride and the sodium hydroxide are respectively taken and mixed and then are rapidly added into the AgNO₃In the solution, the solution in the conical flask changes from colorless to gray;

3) assembly of SERS detection sensor

3-1) respectively and specifically combining the signal sequence and the capture sequence with AgNPs and SERS substrates with positively charged surfaces as follows: respectively putting the capture sequence and the signal sequence into a mixed solution of a TCEP solution and a Tris-HCl buffer solution to activate sulfydryl; after reacting for 1 hour, soaking the silicon dioxide SERS substrate with a capture sequence solution, mixing a signal sequence solution with a certain amount of AgNPs with positive charges, standing overnight at room temperature, respectively adding 6-mercapto-1-hexanol for reaction, and respectively washing with a large amount of water to remove sequences which are not specifically combined, thereby finishing the modification of mercapto;

3-2) completing the assembly of the SERS detection sensor: adding a signal sequence modified positively charged AgNPs solution into a silicon dioxide SERS substrate, adding target sequences with different concentrations, cleaning the silicon dioxide SERS substrate after reaction, and preparing for the next SERS measurement after drying at normal temperature;

the base sequences of the capture sequence, the signal sequence and the target sequence are as follows:

capture sequence:

5’-SH-TTTTTCCCAACCCAACCCTCCTTGGAGTTCCAACGAGCGGCTTCACTCAGACCCTGAGGCTCAAAGTCAGATGCTACTGGCCGCTGAAGGGCTT-3’；

(2) signal sequence: 5 '-Cy 5-TTGAACTCTGCTTAAATC-SH-3';

(3) the target sequence is:

GATTTAAGCAGAGTTCAA and merges into point AAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAGGGTTGGGTTGGGAAAAA.

2. The method for detecting leukemia fusion gene based on SERS spectroscopy as claimed in claim 1, wherein:

1) preparation of SERS substrate

1-1) synthesizing AgNPs with negatively charged surfaces: by usingReducing silver nitrate by using sodium citrate as a raw agent to synthesize colloidal silver: AgNO at a concentration of 1mM in a volume of 100mL₃Heating the solution under vigorous stirring, boiling, and adding 3mL of 1% sodium citrate; keeping the liquid boiling, continuously heating and stirring for 60 minutes, and changing the color into yellow green;

1-2) preparation of surface hydroxylated silica flakes: cutting the silicon dioxide sheet into the size of 4mm multiplied by 4mm, and then respectively carrying out ultrasonic treatment in acetone, ethanol and ultrapure water for 10 minutes; taking out and drying, soaking the silicon dioxide slices in a freshly prepared piranha solution, and heating to 150 ℃ for 30 minutes; after cooling, washing with ultrapure water, standing and airing to finish the surface hydroxylation of the silicon dioxide sheet;

the piranha solution is a mixed solution of concentrated sulfuric acid and 30% hydrogen peroxide in a ratio of 7: 3;

1-3) protonation of the amino group of the silane coupling agent is completed: dispersing 150 mu L of silane coupling agent in 150mL of ethanol, then soaking the silica plate with the hydroxylated surface in the solution for 12h, taking out, washing with a large amount of water, and taking out the unmodified silane coupling agent; drying the silicon dioxide sheet, and soaking the silicon dioxide sheet in ultrapure water for 8 hours to complete protonation of amino groups of the silane coupling agent;

1-4) preparing a substrate: taking 370 mu L of newly synthesized silver nanoparticles obtained in the step 1), soaking the protonated silicon dioxide sheet in the silver nanoparticles for 4h, taking out the silicon dioxide sheet, and cleaning the silicon dioxide sheet with ultrapure water to obtain an SERS substrate;

2) synthetic AgNPS with positively charged surface

Taking the concentration of 1.1 × 10^-3mol/L AgNO₃Putting 90ml of the solution into a conical flask and stirring; respectively taking 6 × 10^-25ml of hydroxylamine hydrochloride in mol/L and 4.5ml of sodium hydroxide in 0.1mol/L are mixed and then quickly added into 90ml of AgNO₃In the solution, the solution in the conical flask changes from colorless to gray;

3) assembly of SERS detection sensor

3-1) taking 20. mu.L of 1. mu.M capture sequence and 20. mu.L of 1. mu.M signal sequence, respectively, and putting them into a mixed solution of 20. mu.L of 5mM TCEP solution and 50. mu.L of 1M Tris-HCl buffer solution with pH =7.4 to activate thiol groups; after reacting for 1 hour, soaking the silicon dioxide SERS substrate by using a capture sequence solution, mixing a signal sequence solution with AgNPs with positive charges, standing overnight at room temperature, respectively adding 20 mu L of 1 mu M6-sulfydryl-1-hexanol for reacting for 3 hours, and respectively washing by using a large amount of water to remove sequences which are not specifically combined, thereby finishing the modification of sulfydryl;

3-2) adding the positively charged AgNPs solution modified with the signal sequence into a silicon dioxide SERS substrate, adding target sequences with different concentrations, reacting for 4h, cleaning the silicon dioxide SERS substrate, and drying at normal temperature to prepare for the next SERS measurement.

Images