CN110724737B - Application of exosome lncRNA-A in heart failure detection - Google Patents

Abstract

The invention discloses an exosome lncRNA-A marker, wherein the nucleotide sequence table of the marker is SEQ ID NO.1; also discloses application of the reagent for detecting the expression level of the exosome lncRNA-A marker in blood in preparingbase:Sub>A heart failure diagnosis reagent, and disclosesbase:Sub>A method for preparing the heart failure diagnosis reagent by using the reagent for detecting the expression level of the exosome lncRNA-A marker in blood. The invention optimizes the defects of the existing heart failure diagnosis and detection, providesbase:Sub>A peripheral blood plasma exosome lncRNA-A sequence andbase:Sub>A detection method, particularly relates to application in early prevention and detection of heart failure diseases and drug treatment target point reference, and can be used asbase:Sub>A simple method for dynamically monitoring the prognosis of heart failure.

Description

Application of exosome lncRNA-A in heart failure detection

Technical Field

The invention relates to the technical field of biological medicines, in particular to application of an exosome lncRNA-A in heart failure detection.

Background

Heart failure (heart failure, HF), a complex syndrome of ventricular congestion or impaired pumping capacity caused by organic or functional heart disease, is characterized clinically by dyspnea and weakness (impaired exercise tolerance) and fluid retention (pulmonary congestion and peripheral edema). Heart failure is the terminal stage of development of all cardiovascular diseases, of which coronary heart disease is the main cause. In the early stage of the disease, myocardial cells are compensated and enlarged to increase myocardial contractility, so that more blood can be accommodated in the heart cavity in a compensation way, when the myocardial hypertrophy reaches the compensation limit, the myocardial contractility is reduced, the heart cavity is gradually enlarged, the wall of the heart becomes thinner, and at the moment, the blood supply and demand imbalance of the organism and the heart causes heart failure.

Heart failure remains a major public health problem at present, and is one of the highest morbidity and mortality among cardiovascular diseases. The Chinese cardiovascular disease report 2018 indicates that the prevalence rate of cardiovascular diseases in China is continuously increased, 2.9 million patients with cardiovascular diseases are calculated, and the heart failure is 450 thousands. According to 42 hospitals in partial areas of China, retrospective investigation on 10714 columns of heart failure hospitalized cases shows that the etiology of the heart failure is coronary heart disease and hypertension is high; the death rate of heart failure in each age group is higher than that of other cardiovascular diseases in the same period, and the main death causes are left heart failure (59%), arrhythmia (13%) and sudden death (13%) in turn. Therefore, there is a clinical urgent need for a biomarker capable of performing early diagnosis, evaluating treatment effect and judging prognosis of heart failure, so as to assist in establishing accurate treatment and prognosis strategies and help clinicians to take more active and effective treatment measures to reduce adverse events. HF biomarker detection is a main mode for detection and diagnostic evaluation of HF patients after admission, and commonly used HF markers include BNP and NT-proBNP, ADM and MR-proADM, gal-3, sst-2, GDF-15, H-FABP, CRP and the like. The generation and number of these markers are correlated with the mechanisms of pressure increase, inflammatory response, myocardial injury, myocardial remodeling, and neuroendocrine system activation in the progression of HF, identifying the cause, stratification of risk, prognosis, and treatment of HF from different levels. Wherein the rising degree of serum BNP and NT-proBNP is positively correlated with the severity of heart failure, and can be used for screening and identifying various heart diseases of patients with different etiologies and different degrees of left ventricular systolic dysfunction, and the detection is often used as a gold standard for clinical diagnosis of heart failure; the prediction value of ADM and MR-proADM on the 3-month mortality of patients admitted with acute dyspnea including AHF is higher than that of BNP, which indicates that the ADM and MR-proADM have certain application prospect on the short-term prognosis of HF; gal-3 is associated with all-cause mortality or cardiovascular mortality and can help determine the short-term mortality risk in patients with CHF, AHF; the H-FABP may be the earliest and most sensitive marker of the damaged myocardium, and the serum H-FABP level has strong correlation with the severity and clinical result of HF, and can be used as an additional marker for BNP to judge HF prognosis. However, the whole course of heart failure often cannot be well determined by adopting single marker detection, and multiple markers are often used for comprehensive detection in clinical detection, so that the treatment and prognosis evaluation of HF are continuously perfected.

With the continuous development and improvement of genomics and gene sequencing technologies, more and more non-coding RNAs (ncRNAs) and functions are identified, so that the possibility of searching key regulatory molecules for myocardial remodeling and heart failure from the gene level and detecting and evaluating the heart failure is possible. In recent years, researches show that various ncRNAs such as miRNA and lncRNA can be used as new biomarkers of cardiovascular diseases such as myocardial infarction, myocardial injury, heart failure and the like. LncRNA (Long non-coding RNA) as a Long non-coding RNA is positioned in cell nucleus or cytoplasm, has the length of more than 200 nucleotides, is ncRNA with the most intracellular content and has multiple biological functions. The lncRNA not only participates in the regulation and control process of organism functions, such as chromosome and genome modification, X chromosome silencing and the like, but also influences the important regulation and control processes of transcriptional activation, interference, intranuclear transportation and the like, is closely related to various cardiovascular diseases, and can participate in regulation and control in the pathological processes of various diseases, such as cardiac development, cardiac hypertrophy, myocardial infarction, heart failure and the like. Zangrando et al found in mouse myocardial infarction model that lncRNA Mirt1 and Mirt2 located on Chr19 locate in the left ventricle of myocardial infarction model, left ventricular cardiomyocytes remodel when the two lncRNA are expressed together, when the expression of Mirt1 and Mrit2 is increased, the ejection fraction of ventricle returns to normal, and the systolic function of heart returns to normal; in 31423 lncRNA detected by Liu et al, 64 lncRNA are increased and 87 lncRNA are reduced after the early reperfusion of the mouse heart ischemia, and the abnormal expression phenomenon of the lncRNA is obvious in an ischemic infarction area; hu et al found that the control of NFIA low expression through lncRNA RP5-833A20.1/has-miR-383-5p pathway can slow the formation of atherosclerotic plaques, but the abnormal expression of the NFIA can promote the formation of the atherosclerotic plaques; in vitro studies have shown that LncRNA-Chrf is significantly elevated in angiotensin II-induced cardiac hypertrophy cardiomyocytes, the same phenomenon is observed in mouse cardiac aortic constriction and human heart failure samples, and Chrf is widely expressed in cardiovascular cells and other tissues, but performs a specific function in cardiac myocytes. The Chrf can be combined with miR-489 to reduce miR-489 combined with Myd88, so that the expression of the target gene Myd88 is up-regulated to induce myocardial hypertrophy; research shows that Brg1 has a double helicase region capable of combining with lncRNA Mhrt, and when Mhrt is combined with Brg1, the combination of Brg1 to surrounding naked DNA is prevented, so that the effect of protecting myocardial cells is achieved, the damage of Brg1 to cardiac muscle is reduced, and therefore, mhrt may become the exploration direction of the treatment of heart failure caused by pathological cardiac hypertrophy. In view of the fact that LncRNA has stronger biodiversity, even if the genomic sequence of the orthologous LncRNA has lower sequence conservation, species specificity and tissue specificity are relatively higher, so that the expression of LncRNA has high nuclear tissue specificity. The lncRNA can be detected in myocardial tissues and exosomes, and a plurality of heart-specific lncRNAs have unique monitoring and functional characteristics on myocardial regeneration, myocardial remodeling, cardiac function and the like, so that the heart-specific exosomes lncRNA can be used as a targeting molecule and a biomarker related to heart diseases.

Exosome (Exosome) is an extracellular vesicle with the diameter of 30-100 nm, mainly is a membrane vesicle which is formed by fusing an intracellular multivesicular body with a cell membrane and releasing the cell membrane into an extracellular matrix, is represented as a lipid bilayer-coated oblate sphere under an electron microscope, has a characteristic cup-shaped appearance, contains protein, lipid, transcription factors, mRNA, non-coding RNA (ncRNA) and nucleic acid content, gives abundant biological information to the Exosome, plays a specific biological effect by being transmitted to other cells through the Exosome, and is an important participant of intercellular communication. The homologous exosomes have similar forms and sizes, while the exosomes from different sources have slightly different diameters, and the exosomes can realize intercellular information transfer in a non-cell contact mode and can pass through a blood brain barrier. Exosomes can be secreted not only by most cells, but also by bacteria and viruses, exist in plasma, serum, saliva, amniotic fluid, breast milk and urine, have specific proteins, active nucleic acids and lipids, play important biological roles in the processes of intercellular substance transfer, information exchange, cell proliferation and differentiation, angiogenesis, immunoregulation and the like, and participate in the pathological processes of tumors and cardiovascular, digestive, immune, nervous and other system diseases.

Exosomes are widely distributed in the body and carry signal molecules of various secretion source cells, and are circulating disease markers with clinical value. Compared with the histopathological examination, the detection method based on the body fluid exosomes such as blood has higher patient acceptance, is convenient for disease monitoring, and can reflect the overall condition of the disease better. Compared with the traditional serum free nucleic acid and protein markers, the exosome has the advantages of obvious targeting property, more information, easiness in storage, small interference of a detection matrix and the like. With the continuous and intensive research on the special structure of the exosome, the important role of lncRNA in the exosome under the physiological and pathological states of the cardiovascular system is continuously discovered, and the lncRNA can be called as a new biological marker and a new therapeutic target for diagnosing cardiovascular diseases such as heart failure.

Disclosure of Invention

The technical problem is as follows: novel biological markers and therapeutic targets for heart failure diagnosis.

The technical scheme is as follows: the invention discloses an exosome lncRNA-A marker; also disclosesbase:Sub>A reagent for detecting the expression level of the exosome lncRNA-A marker in blood; the nucleotide sequence table of the marker is SEQ ID NO.1. The nucleotide sequence of the marker is specifically as follows:

ATCTCGGCTCACTGCAAGCTCTGCATCCTGGGTTCACGCCATTCTCCTGTTTCAGCCTCCAG

GTAGCTGGGCCTACCGGCGCCCGCCACCACGCCCGGCTAATTTTTTGTATTTTTAGTAGAG

ACGGGGTTTCACCGTGTTAGCCAGGATGGTCTCGATCTCCTGACCTGGTGATCCGCCCGCC

TCGGCCTCCCAAAGTGCTGAGATTACAGGCGTGAGCTACCGCGCCCCGCCAATTTACCGTG

CAGGATTGCAAACACCAGAGAGAAAATCAGTCTCTGGAATGATGCCTTTGATGGACCAAG

ATGCAGCTGATGAAGCATTGAACCAATTAGCACCTAGCAGGAGGGCACCCTTGCTCTGTG

TCCTTGAAGGTTAAAGCTGTCAAAAAGTGGTCTCCCTCAAGTTCGGCCATCTTGCTCTCAG

AGATCTAGAACTGGACTCAGTCAAAATTTTGGGCCAAGGAGACCGACGCGCTGTCGCCTG

CACTAAGAGAAACGCAACGAACAACTTTGTCAATGCATTGCATTATACTATAGCAGCAAC

TATACTTTTAAATGATTCGAATCTTGAGGTTTCAAACTGAACCGTCTTGTGCCTTTTGCCCG

GCGGGCATTTCTGCGGGGACCGCGGGTCACCTTCTGAATTTTTACCTTCATAAACAGCAAG

GACTGCGCTCTTTCGCACGGCGCCCCGTTTTTTCGTAG

the invention also discloses application of the reagent for detecting the expression level of the exosome lncRNA-A marker in blood in preparingbase:Sub>A heart failure diagnosis reagent, wherein the nucleotide sequence of the lncRNA-A marker is SEQ ID NO.1.

Further, the reagent for detecting the expression level of the blood IncRNA-A marker isbase:Sub>A real-time quantitative PCR reagent.

The invention also disclosesbase:Sub>A method for preparingbase:Sub>A heart failure diagnosis reagent by using the reagent for detecting the expression level of the exosome lncRNA-A marker in blood, which comprises the following steps: plasma collection, exosome extraction, lncRNA genome sequencing, comparison, specific lncRNA-A screening and function test.

Further, the detection method specifically comprises the following steps: RNA fragmentation, reverse transcription, XP Beads sorting and purifying, PCR pre-amplification, XP Beads purifying, PCR secondary amplification, XP Beads purifying and library quality inspection.

Reverse transcription takes fragmented RNA as a template, uses random primers to configure a reverse transcription system, and performs PCR reaction.

Has the advantages that:

the invention has the following beneficial effects: the invention optimizes the defects of the existing heart failure diagnosis and detection, providesbase:Sub>A peripheral blood plasma exosome lncRNA-A sequence andbase:Sub>A detection method, particularly relates to application in early prevention and detection of heart failure diseases and drug treatment target point reference, and can be used asbase:Sub>A simple method for dynamically monitoring the prognosis of heart failure. The lncRNA-A marker in the peripheral blood plasma exosome is used asbase:Sub>A marker for detecting cardiovascular related diseases, such as early prevention of heart failure,base:Sub>A detection marker andbase:Sub>A drug treatment target point reference.

Drawings

FIG. 1 is a diagram showing the results of ultrasonic examination of cardiac functions of a normal patient and a heart failure patient;

FIG. 2 is a graph showing the results of ultrasonic examination of the heart after coronary artery ligation in different mice;

FIG. 3 is a structural diagram of exosomes extracted from plasma of a patient and a mouse observed under a projection electron microscope;

FIG. 4 is an analysis graph of the expression profile of exosome lncRNA significantly expressed in the normal group and the heart failure group of patients and mice;

FIG. 5 is a graph of differential lncRNA clusters;

figure 6 is a volcanic plot of differentially expressed lncRNA;

FIG. 7 shows the gene sequence of lncRNA-A.

Detailed Description

The present invention will be further illustrated with reference to the accompanying drawings and specific embodiments, which are to be understood as merely illustrative of the invention and not as limiting the scope of the invention.

Example 1

1. Plasma exosome extraction:

extracting exosomes and exosome RNAs from peripheral blood plasma of a patient:

1. selecting patients and normal people who are admitted to hospital due to heart failure caused by coronary heart disease, respectively extracting 5ml of venous blood, placing the venous blood in an anticoagulation (containing EDTA) blood collection tube, centrifuging the blood for 10min at 1900g at 4 ℃, transferring the upper layer yellow plasma rich in platelets to a new EP tube, centrifuging the blood for 15min at 3000g at 4 ℃, removing supernatant and transferring the supernatant to the new EP tube.

2. Taking the supernatant plasma, adding the ExoQuick Exsome Precipitation solution, mixing by turning upside down, standing in a refrigerator at 4 ℃ for 30min, centrifuging at 4 ℃ for 30min at 1500g, and carefully removing the supernatant to obtain a precipitate.

3. Centrifuging at 4 deg.C and 1500g for 5min, and removing supernatant to obtain beige or white precipitate as exosome.

4. And (5) detecting and verifying the exosome and the concentration and the diameter of the exosome by adopting a PBS (phosphate buffered saline) resuspension electron microscope.

5. Extracting total RNA from exosome by adopting an SBI and EXOQ5A-1 kit according to the kit instruction steps, measuring the RNA concentration by a spectrophotometer, and indicating that the RNA purity reaches the standard when the OD260/280 ratio is between 1.8 and 2.0.

2. Extracting orbital venous blood plasma exosomes of the mouse:

1. in heart ultrasonic verified mice with heart failure and normal mice, 0.5ml of venous blood is collected from the orbital venous plexus, placed in an anticoagulation (containing EDTA) blood collection tube, centrifuged at 1900g for 10min at 4 ℃, the upper layer yellow plasma rich in platelets is transferred to a new EP tube, centrifuged at 3000g for 15min again at 4 ℃, and the supernatant is removed and transferred to a new EP tube.

2. Taking supernatant plasma, adding ExoQuick extract Precipitation solution, mixing by turning upside down, standing in a refrigerator at 4 deg.C for 30min, centrifuging at 4 deg.C for 30min at 1500g, and carefully removing supernatant to obtain precipitate.

3. Centrifuging at 4 deg.C and 1500g for 5min, and removing supernatant to obtain beige or white precipitate as exosome.

4. And (5) detecting and verifying the exosome and the concentration and the diameter of the exosome by adopting a PBS (phosphate buffered saline) resuspension electron microscope.

5. Extracting total RNA from exosome by adopting an SBI and EXOQ5A-1 kit according to the kit instruction steps, measuring the RNA concentration by a spectrophotometer, and indicating that the RNA purity reaches the standard when the OD260/280 ratio is between 1.8 and 2.0.

3. LncRNA library construction, sequencing, comparison and screening

The RNA sample reaching the standard is subjected to high-throughput sequencing analysis by utilizing an illumina HiSeq PE150 platform through RNA fragmentation → reverse transcription → XP Beads sorting and purification → PCR pre-amplification → XP Beads purification → PCR secondary amplification → XP Beads purification → library quality inspection, the sequencing Data are filtered, a linker sequence and low-quality reads are removed, clear Data are obtained, known rRNA and the like are removed, and usable statistical Data are obtained. Comparing sequencing data with reference genes by using tophat2.11 software, counting the reads/base coverage condition of one region of each chromosome, calculating the expression condition of the genes among different groups according to the comparison result, obtaining a plasma exosome lncRNA expression profile, obtaining lncRNA with high differential expression between two groups of samples of a patient and a model mouse by using | logFC | >2 and p <0.01 as screening conditions, and visually displaying the gene expression distribution condition in each group of samples by using pictures such as a scatter diagram, a volcano diagram and the like. And performing real-time fluorescent quantitative PCR reaction by using the kit, determining the expression level of the lncRNA with differential expression, and calculating the relative expression amount of the lncRNA in the sample, wherein the result shows that the expression of the lncRNA-A between two groups of samples has obvious difference and belongs to up-regulation/down-regulation expression. The target gene prediction is carried out on lncRNA-A by utilizingbase:Sub>A target gene prediction software Targerscan and other websites, and the biological function of the lncRNA-A in heart failure is predicted by GO function enrichment analysis and KEGG channel analysis. And (3) comparing clean reads to a reference gene by using comparison software HISAT2, and assembling the compared sequences to obtain an exon data distribution map and a transcript length distribution map. The qRT-PCR is used for verification inbase:Sub>A heart failure group andbase:Sub>A normal group, and the expression level of lncRNA-A is obviously up-regulated/down-regulated and is consistent withbase:Sub>A sequencing result.

4. LncRNA-A gene sequence

LncRNA-A gene sequence (see FIG. 7). The details are as follows

ATCTCGGCTCACTGCAAGCTCTGCATCCTGGGTTCACGCCATTCTCCTGTTTCAGCCTCCAG

GTAGCTGGGCCTACCGGCGCCCGCCACCACGCCCGGCTAATTTTTTGTATTTTTAGTAGAG

ACGGGGTTTCACCGTGTTAGCCAGGATGGTCTCGATCTCCTGACCTGGTGATCCGCCCGCC

TCGGCCTCCCAAAGTGCTGAGATTACAGGCGTGAGCTACCGCGCCCCGCCAATTTACCGTG

CAGGATTGCAAACACCAGAGAGAAAATCAGTCTCTGGAATGATGCCTTTGATGGACCAAG

ATGCAGCTGATGAAGCATTGAACCAATTAGCACCTAGCAGGAGGGCACCCTTGCTCTGTG

TCCTTGAAGGTTAAAGCTGTCAAAAAGTGGTCTCCCTCAAGTTCGGCCATCTTGCTCTCAG

AGATCTAGAACTGGACTCAGTCAAAATTTTGGGCCAAGGAGACCGACGCGCTGTCGCCTG

CACTAAGAGAAACGCAACGAACAACTTTGTCAATGCATTGCATTATACTATAGCAGCAAC

TATACTTTTAAATGATTCGAATCTTGAGGTTTCAAACTGAACCGTCTTGTGCCTTTTGCCCG

GCGGGCATTTCTGCGGGGACCGCGGGTCACCTTCTGAATTTTTACCTTCATAAACAGCAAG

GACTGCGCTCTTTCGCACGGCGCCCCGTTTTTTCGTAG

5. Functional verification of LncRNA-A:

as shown in fig. 1 to 7, fig. 1 is a result of ultrasonic examination of cardiac function of a normal patient and a heart failure patient. Heart failure patients with decreased EF are indicated by heart failure patients with heart ejection fraction EF% <50%

Figure 2 is the results of the cardiac ultrasonography after coronary ligation in different mice. As can be seen, the LVID, EF% and FS% of the mice with lncRNA-A over-expression after coronary artery ligation are obviously different (improvement)

FIG. 3 shows exosomes extracted from plasma of patients and mice observed under a transmission electron microscope. The shape of the exosome is circular or similar to a circle, the exosome is of a double-layer lipid molecular structure, the size and the distribution of the exosome are uneven, the diameter of the exosome is between 20 and 200nm, and the exosome is consistent with the description of the normal shape characteristics of the exosome, so that the exosome is proved to be extracted.

FIG. 4 is the analysis of the expression profile of exosome lncRNA significantly expressed in the normal group and heart failure group of patients and mice. It can be seen that there are 15 IncRNAs up-regulated (fold change >2, padj-value < 0.05) and 11 down-regulated (fold change < -2, padj-value < 0.05) in the exosome RNAs after heart failure.

Figure 5 is a graph of differential lncRNA clustering.

FIG. 6 is a volcano plot of differentially expressed lncRNA

FIG. 7 shows the gene sequence of lncRNA-A. The LncRNA-A belongs to intergenic lncRNA, is located at the 6p21 site of the human chromosome and has the length of 707nt bases through sequencing.

Constructing lncRNA-A plasmid and performing AC16 human myocardial cell transient transfection experiment, and checking the transfection efficiency and plasmid expression condition through real-time PCR, wherein the result shows that the expression of lncRNA-A is more than 2 times that ofbase:Sub>A control group, and the success of plasmid construction is shown. Compared withbase:Sub>A control group andbase:Sub>A PE-induced untransfected plasmid group, cells in the transfected group are not obviously hypertrophic, and the lncRNA-A is verified to have the effect of inhibiting heart failure caused by excessive hypertrophy of myocardial cells.

( simulatingbase:Sub>A myocardial infarction hypoxia model by using an AC16 human myocardial cell line, inhibiting the expression of lncRNA-A by using an siRNA technology, and detecting the growth and apoptosis levels of cells; detecting the expression level of inflammatory factors (IL-6, IL-1 beta and TNF-alpha), and detecting the activity level of related signal pathways. Further verifying whether the signal path participates in the process by using a signal path inhibitor )

The mice adopting lncRNA-A overexpression and healthy normal mice are divided intobase:Sub>A normal coronary artery ligation-free group,base:Sub>A normal coronary artery ligation group, an lncRNA-A overexpression coronary artery ligation-free group and an lncRNA-A overexpression coronary artery ligation group. After four weeks, lncRNA-A over-expressed coronary ligation group had significantly different cardiac function compared to normal coronary ligation group.

The technical means disclosed in the scheme of the invention are not limited to the technical means disclosed in the above embodiments, but also include the technical means formed by any combination of the above technical features. It should be noted that modifications and adaptations can be made by those skilled in the art without departing from the principles of the present invention and are intended to be within the scope of the present invention.

Sequence listing

<110> Nanjing Ke medical technology Co., ltd

<120> application of exosome lncRNA-A in heart failure detection

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 707

<212> DNA

<213> Homo sapiens

<400> 1

atctcggctc actgcaagct ctgcatcctg ggttcacgcc attctcctgt ttcagcctcc 60

aggtagctgg gcctaccggc gcccgccacc acgcccggct aattttttgt atttttagta 120

gagacggggt ttcaccgtgt tagccaggat ggtctcgatc tcctgacctg gtgatccgcc 180

cgcctcggcc tcccaaagtg ctgagattac aggcgtgagc taccgcgccc cgccaattta 240

ccgtgcagga ttgcaaacac cagagagaaa atcagtctct ggaatgatgc ctttgatgga 300

ccaagatgca gctgatgaag cattgaacca attagcacct agcaggaggg cacccttgct 360

ctgtgtcctt gaaggttaaa gctgtcaaaa agtggtctcc ctcaagttcg gccatcttgc 420

tctcagagat ctagaactgg actcagtcaa aattttgggc caaggagacc gacgcgctgt 480

cgcctgcact aagagaaacg caacgaacaa ctttgtcaat gcattgcatt atactatagc 540

agcaactata cttttaaatg attcgaatct tgaggtttca aactgaaccg tcttgtgcct 600

tttgcccggc gggcatttct gcggggaccg cgggtcacct tctgaatttt taccttcata 660

aacagcaagg actgcgctct ttcgcacggc gccccgtttt ttcgtag 707

Claims (3)

1. base:Sub>A reagent for detecting the expression level of an exosome lncRNA-base:Sub>A marker in blood, which comprises: the nucleotide sequence of the marker is SEQ ID NO.1.

2. The application ofbase:Sub>A reagent for detecting the expression level of an exosome lncRNA-A marker in blood in preparingbase:Sub>A heart failure diagnostic reagent is characterized in that: the nucleotide sequence of the lncRNA-A marker is SEQ ID NO.1.

3. The use of the reagent according to claim 2 for detecting the expression level of an exosome lncRNA-base:Sub>A marker in blood for preparingbase:Sub>A heart failure diagnostic reagent, wherein: the reagent for detecting the expression level of the blood lncRNA-A marker isbase:Sub>A real-time quantitative PCR reagent.

Images