CN110724736A

CN110724736A - IVF-ET related micro RNA and application thereof

Info

Publication number: CN110724736A
Application number: CN201810778390.3A
Authority: CN
Inventors: 张璇; 杨菁; 王健; 兖娜娜; 顾文文; 孟楠; 甄兴兴
Original assignee: Renmin Hospital Of Wuhan University; Shanghai Institute of Planned Parenthood Research
Current assignee: Renmin Hospital Of Wuhan University; Shanghai Institute of Planned Parenthood Research
Priority date: 2018-07-16
Filing date: 2018-07-16
Publication date: 2020-01-24

Abstract

The invention provides IVF-ET related micro RNA and application thereof. Specifically, the invention provides application of miRNA or a detection reagent thereof in preparing a kit for judging pregnancy outcome of in vitro fertilization-embryo transfer (IVF-ET). The present invention provides a significant need in the art for biomarker molecules that can be used for the identification and prediction of early pregnancy outcome after IVF-ET embryo transfer.

Description

IVF-ET related micro RNA and application thereof

Technical Field

The invention relates to the field of biotechnology. In particular, the invention relates to IVF-ET related micro RNA and application thereof.

Background

Self-assisted reproductive technologies have advanced significantly over the established decades. In the treatment of human infertility, assisted reproductive technology in vitro fertilization-embryo transfer (IVF-ET) is one of the currently important means. Because the establishment and maintenance of normal human pregnancy need to go through a series of important links such as embryo implantation, placenta formation, embryonic development and the like, and are cooperatively regulated and controlled by different systems in multiple layers, the obstacle of any link can cause poor pregnancy outcome such as abortion and the like. In the IVF-ET cycle, the clinical pregnancy rate after embryo transfer is only 40%, while the miscarriage rate after pregnancy is as high as 18%. Due to the low embryo implantation rate in the assisted reproduction technology, screening of some reliable marker molecules capable of being used for predicting the pregnancy outcome of IVF-ET plays an important guiding role in clinical IVF-ET and early intervention and treatment of infertility.

miRNA is a non-coding RNA molecule which is widely expressed in eukaryotic organisms, mainly comprises 21-25 nucleotides, and regulates and controls the expression of target genes by complementarily combining with 3' -UTR of mRNA of transcription products of the target genes and inhibiting the translation process of the mRNA. At present, the statistics of mature human miRNAs reach 2578 (miRBase20.0), and the miRBase20.0 regulates nearly 50 percent of protein coding genes.

The expression of mirnas is tissue-specific and timely (i.e. expressed only in specific tissues and developmental stages), which means that it plays a variety of regulatory roles in cell growth and development, including: cell proliferation, apoptosis, metabolism, maintenance of stem cell pluripotency and differentiation, and the like. Researches show that miRNA may participate in regulation and control of embryo development and selection, formation of endometrial receptivity, blood vessel recasting of maternal-fetal interfaces, immune function regulation and the like, and the biological processes are closely related to establishment of human pregnancy.

The study of miRNAs has attracted much attention, one reason for the wide range of biological functions of miRNAs as mentioned above, and another reason for their potential utility, such as the screening of biological marker molecules for diseases. In the screening of biological marker molecules, non-invasive means, such as blood, are most desirable. In 1997, fetal DNA was first discovered from maternal blood, and based on this discovery, no innovative prenatal diagnostic techniques were available afterwards. In 2008, placenta-derived mirnas were detected in maternal plasma. The research foundations lay a foundation for the development of miRNA as prenatal diagnosis and disease biomarker molecules.

However, little is currently known about methods for identifying and predicting early pregnancy outcomes after IVF-ET embryo transfer.

Therefore, there is an urgent need in the art to develop biomarker molecules that can be used for the identification and prediction of early pregnancy outcome after IVF-ET embryo transfer.

Disclosure of Invention

The invention aims to provide IVF-ET related micro RNA and application thereof.

In a first aspect of the invention, there is provided the use of a miRNA, or a detection reagent thereof, for the preparation of a kit for the determination of in vitro fertilization-embryo transfer (IVF-ET) pregnancy outcome, said miRNA being selected from the group consisting of: hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p, or a combination thereof.

In another preferred embodiment, the kit contains hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p, or a combination thereof as a positive control.

In another preferred embodiment, the judgment comprises a preliminary judgment.

In another preferred embodiment, the test sample of the test kit comprises blood or tissue.

In another preferred embodiment, the tissue comprises villus tissue or decidua tissue.

In another preferred embodiment, the miRNA is selected from the group consisting of:

(a) 1-6 of any sequence shown in SEQ ID NO;

(b) any one of 6 complementary sequences complementary to any one of the sequences shown in SEQ ID No. 1-6; or

(c) A combination from (a) or (b), and the sequence from (a) and the complementary sequence from (b) are not complementary to each other.

In another preferred embodiment, the detection reagent comprises a primer, an antisense nucleic acid, a probe or a chip.

In a second aspect of the present invention, there is provided a miRNA chip comprising:

a solid support; and

oligonucleotide probes orderly fixed on the solid phase carrier, wherein the oligonucleotide probes specifically correspond to hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p or the combination thereof.

In another preferred embodiment, the oligonucleotide probe comprises:

a complementary binding region; and/or

A linker region attached to the solid support.

In a third aspect of the invention, a kit is provided, the kit comprises hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p or a detection reagent thereof, and instructions for stating that the kit is used for (a) judging the pregnancy ending of in vitro fertilization-embryo transfer and/or (b) judging the sensitivity and/or specificity of in vitro fertilization-embryo transfer.

In another preferred embodiment, the instructions specify the following:

when the expression Ea of hsa-miR-27a-3p in the sample (such as plasma) is measured, the expression Ea of hsa-miR-27a-3p and the expression Ea of the control gene are measured₀The ratio Ea/Ea₀More than or equal to 1.2, preferably more than or equal to 1.5, more preferably more than or equal to 1.6 (e.g. 1.691), the pregnancy outcome of the in vitro fertilization-embryo transfer sample is good, and the control gene is hsa-miR-27a-3p of the failure group.

When the amount Ea of gene expression is measured in the sample (e.g., serum)₀The ratio Ea of the expression amount Ea of hsa-miR-27a-3p₀and/Ea is more than or equal to 1.0, preferably more than or equal to 1.2, more preferably more than or equal to 1.3 (such as 1.305), the sensitivity and/or specificity of the in vitro fertilization-embryo transfer sample is good, and the control gene is hsa-miR-27a-3p of the failure group.

When the expression Ea of hsa-miR-23a-3p in the sample (such as plasma) is measured, the expression Ea of hsa-miR-23a-3p and the expression Ea of the control gene are measured₀The ratio Ea/Ea₀More than or equal to 1.2, preferably more than or equal to 1.5, more preferably more than or equal to 1.7 (e.g. 1.704), indicating that the pregnancy outcome of the in vitro fertilization-embryo transfer sample is good, and the control gene is hsa-miR-23a-3p of the failed group.

When the expression Ea of hsa-miR-100-5p in the sample (such as plasma) is measured, the expression Ea of hsa-miR-100-5p and the expression Ea of the control gene are measured₀The ratio Ea/Ea₀More than or equal to 1.0, preferably more than or equal to 1.2, more preferably more than or equal to 1.4 (e.g. 1.462), indicating that the pregnancy outcome of the in vitro fertilization-embryo transfer sample is good, and the control gene is hsa-miR-100-5p of the failed group.

When the expression Ea of hsa-miR-127-3p in the sample (such as plasma) is measured, the expression Ea of hsa-miR-127-3p and the expression Ea of the control gene are measured₀The ratio Ea/Ea₀More than or equal to 1.2, preferably more than or equal to 1.4, more preferably more than or equal to 1.6 (e.g. 1.620), indicating that the pregnancy outcome of the in vitro fertilization-embryo transfer sample is good, and the control gene is hsa-miR-127-3p of the failed group.

When the amount Ea of gene expression is measured in the sample (e.g., serum)₀The ratio Ea of the expression amount Ea of hsa-miR-100-5p₀and/Ea is more than or equal to 1.0, preferably more than or equal to 1.2, more preferably more than or equal to 1.4 (such as 1.462), the sensitivity and/or specificity of the in vitro fertilization-embryo transfer sample detection is good, and the control gene is hsa-miR-100-5p of the failure group.

Control gene expression when measured in said sample (e.g. serum)Quantity Ea₀The ratio Ea of the expression amount Ea of hsa-miR-486-5p₀and/Ea is more than or equal to 1.0, preferably more than or equal to 1.1, and more preferably more than or equal to 1.2 (such as 1.284), the sensitivity and/or specificity of the in vitro fertilization-embryo transfer sample is good, and the control gene is hsa-miR-486-5p of the failure group.

In a fourth aspect of the invention, there is provided an in vitro non-diagnostic method for determining pregnancy outcome of in vitro fertilization-embryo transfer, comprising the steps of:

determining the expression Ea of hsa-miR-27a-3p in the sample, and comparing the expression Ea with the expression Ea of a control gene₀Comparing if Ea/Ea₀More than or equal to 1.2, preferably more than or equal to 1.5, and more preferably more than or equal to 1.6 (such as 1.691), the pregnancy outcome of the in vitro fertilization-embryo transfer of the test sample is good, and the control gene is hsa-miR-27a-3p of the failed group.

In another preferred embodiment, the method comprises the following steps:

determining the expression quantity Eb of hsa-miR-127-3p in the sample, and comparing the expression quantity Eb with the expression quantity Eb of a control gene₀Making a comparison if Eb/Eb₀More than or equal to 1.2, preferably more than or equal to 1.5, and more preferably more than or equal to 1.6 (e.g., 1.620), indicating that the pregnancy outcome of the in vitro fertilization-embryo transfer of the test sample is good.

In another preferred example, the sample comprises plasma.

In a fifth aspect of the invention, there is provided an isolated miRNA selected from the group consisting of:

(i) miR-23 a-27 a-24-2, miR-433/127, miR-125b1/let-7a-2/miR-100, hsa-miR-486 or miRNA of miR-23 a-27 a-24-2 family, or

(ii) miRNA complementary with miRNA of miR-23 a-27 a-24-2, miR-433/127, miR-125b1/let-7a-2/miR-100, hsa-miR-486 and miR-23 a-27 a-24-2 families.

In another preferred embodiment, the miRNA is selected from the group consisting of: hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p, or a combination thereof.

(a) 1-6 of any sequence shown in SEQ ID NO;

In a sixth aspect of the invention there is provided an isolated or artificially constructed precursor miRNA which is capable of being cleaved and expressed in human cells to form a miRNA according to the fifth aspect of the invention.

In a seventh aspect of the invention there is provided an isolated polynucleotide capable of being transcribed by a human cell into a precursor miRNA, which precursor miRNA is capable of being cleaved and expressed in a human cell as the miRNA of the fifth aspect of the invention.

In another preferred embodiment, the polynucleotide has the structure of formula I:

Seq_{forward direction}-X-Seq_{Reverse direction}

Formula I

In the formula I, the compound is shown in the specification,

Seq_{forward direction}Is a nucleotide sequence capable of expressing said miRNA in human cells;

Seq_{reverse direction}Is and Seq_{Forward direction}A substantially complementary or fully complementary nucleotide sequence;

x is at Seq_{Forward direction}And Seq_{Reverse direction}A spacer sequence therebetween, and the spacer sequence and Seq_{Forward direction}And Seq_{Reverse direction}Are not complementary;

and the structure shown in the formula I forms a secondary structure shown in a formula II after being transferred into human cells:

in formula II, Seq_{Forward direction}、Seq_{Reverse direction}And X is as defined above,

i is expressed in Seq_{Forward direction}And Seq_{Reverse direction}The base complementary pairing relationship is formed between the two.

In an eighth aspect of the present invention, there is provided a method for determining the fate of in vitro fertilization-embryo transfer pregnancy of a test subject, comprising the steps of:

measuring the expression Ea of hsa-miR-27a-3p in the sample of the detection object, and comparing the expression Ea with the expression Ea of the control gene₀Comparing if Ea/Ea₀More than or equal to 1.2, preferably more than or equal to 1.5, and more preferably more than or equal to 1.6 (such as 1.691), it indicates that the pregnancy outcome of in vitro fertilization-embryo transfer of the test object is good.

In another preferred embodiment, the method comprises the following steps:

measuring the expression quantity Eb of hsa-miR-127-3p in the sample of the detection object, and comparing the expression quantity Eb with the expression quantity Eb of the control gene₀Making a comparison if Eb/Eb₀More than or equal to 1.2, preferably more than or equal to 1.5, and more preferably more than or equal to 1.6 (such as 1.620), indicating that the pregnancy outcome of in vitro fertilization-embryo transfer of the test subject is good.

In another preferred embodiment, the assay is performed by real-time PCR.

In another preferred example, the sample comprises plasma.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows miRNAs differentially expressed in plasma from patients in the IVF-ET successful pregnancy and pregnancy failure groups.

FIG. 2 shows miRNAs differentially expressed in serum of patients in the IVF-ET successful pregnancy and pregnancy failure groups.

Detailed Description

The inventor of the invention has conducted extensive and intensive studies, and unexpectedly found that a class of micro-RNA can be used for blood identification and IVF-ET early pregnancy outcome for the first time. Experiments show that in patients who receive IVF-ET embryo transplantation, in IVF-ET patients who succeed in pregnancy, the expression levels of micro RNA such as hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-100-5p, hsa-miR-23a-3p and the like in plasma before embryo transplantation are obviously different from those of patients in an embryo transplantation failure group; and the expression levels of hsa-miR-27a-3p and hsa-miR-100-5p in serum are remarkably different from those of the patients in the control group (the expression of hsa-miR-27a-3p in the pregnancy failure group is 1.305 times that of the pregnancy success group, and the expression of hsa-miR-100-5p in the pregnancy success group is 1.261 times that of the failure group). On this basis, the inventors have completed the present invention.

Term(s) for

MiRNA and its precursor

The present invention provides a novel class of mirnas found in humans. As used herein, the term "miRNA" refers to an RNA molecule that is processed from a transcript that forms a precursor to a miRNA. Mature mirnas typically have 18-26 nucleotides (nt) (more particularly about 19-22nt), although miRNA molecules having other numbers of nucleotides are not excluded. mirnas are typically detectable by Northern blotting.

Human-derived mirnas can be isolated from human cells. As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

mirnas can be processed from Precursor mirnas (prevrosor mirnas), which can be folded into a stable stem-loop (hairpin) structure, typically between 50-100bp in length. The precursor miRNA can fold into a stable stem-loop structure, and the two sides of the stem-loop structure comprise two basically complementary sequences. The precursor miRNA may be natural or synthetic.

A precursor miRNA can be cleaved to generate a miRNA that is substantially complementary to at least a portion of the sequence of the mRNA encoding the gene. As used herein, "substantially complementary" means that the sequences of nucleotides are sufficiently complementary to interact in a predictable manner, such as to form secondary structures (e.g., stem-loop structures). Typically, two "substantially complementary" nucleotide sequences are complementary to each other for at least 70% of the nucleotides; preferably, at least 80% of the nucleotides are complementary; more preferably, at least 90% of the nucleotides are complementary; further preferably, at least 95% of the nucleotides are complementary; such as 98%, 99% or 100%. Generally, two sufficiently complementary molecules may have up to 40 mismatched nucleotides between them; preferably, there are up to 30 mismatched nucleotides; more preferably, there are up to 20 mismatched nucleotides; further preferred, there are up to 10 mismatched nucleotides, such as 1, 2, 3, 4, 5, 8, 11 mismatched nucleotides.

As used herein, a "stem-loop" structure, also referred to as a "hairpin" structure, refers to a nucleotide molecule that can form a secondary structure comprising a double-stranded region (stem) formed by two regions (on the same molecule) of the nucleotide molecule flanking a double-stranded portion; it also includes at least one "loop" structure comprising non-complementary nucleotide molecules, i.e., a single-stranded region. The double-stranded portion of the nucleotide remains double-stranded even if the two regions of the nucleotide molecule are not completely complementary. For example, an insertion, deletion, substitution, etc., can result in the non-complementarity of a small region or the small region itself forming a stem-loop structure or other form of secondary structure, however, the two regions can still be substantially complementary and interact in a predictable manner to form a double-stranded region of the stem-loop structure. The stem-loop structure is well known to those skilled in the art, and usually, after obtaining a nucleic acid having a nucleotide sequence of a primary structure, those skilled in the art can determine whether the nucleic acid can form a stem-loop structure.

The miRNA disclosed by the invention has a sequence shown as SEQ ID NO 1 (uucacaguggcuaaguuccgc). In order to improve the stability or other properties of the miRNA, at least one protective base such as TT can be added on at least one end of the miRNA.

Antisense oligonucleotides

According to the miRNA sequence provided by the invention, antisense oligonucleotides can be designed, and the antisense oligonucleotides can down regulate the expression of corresponding miRNA in vivo. As used herein, "antisense oligonucleotides (AS-Ons or ASO)" also referred to AS "antisense nucleotides" refers to DNA or RNA molecules or analogs thereof that are about 18 to 26nt (more particularly about 19 to 22nt) in length.

In the present invention, the "antisense oligonucleotide" also includes modified antisense nucleotides obtained by means such as nucleic acid lock or nucleic acid chain skeleton modification technology, the modification does not substantially change the activity of the antisense oligonucleotide, and preferably, the modification can improve the stability, activity or therapeutic effect of the antisense oligonucleotide. Nucleic acid Locks (LNAs) generally refer to modification techniques that link the 2 'oxygen and 4' carbon atoms of ribose via a methylene bridge. LNA can prolong the serum half-life of miRNA, improve the affinity to the target and reduce the range and degree of off-target effect. The antisense medicine developed based on the modification technology of the nucleic acid chain skeleton has greatly improved solubility, nuclease degradation resistance and other aspects, and is easy to synthesize in large amount. There are various methods for modifying the backbone of an oligonucleotide, including a thio method, for example, thio-modifying a deoxynucleotide chain to a thiodeoxynucleotide chain. The method is characterized in that oxygen atoms of phosphate bonds on a DNA skeleton are replaced by sulfur atoms, and the DNA skeleton can resist degradation of nuclease. It is understood that any modification capable of maintaining most or all of the activity of the antisense oligonucleotide is encompassed by the invention.

As a preferred mode of the present invention, the antisense oligonucleotide is subjected to nucleic acid lock modification; more preferably, a thio modification is also performed.

After the antisense oligonucleotides are transferred into a human body, the antisense oligonucleotides can obviously reduce the expression of related miRNA.

Polynucleotide constructs

According to the miRNA sequences provided by the present invention, polynucleotide constructs can be designed which, after introduction, can be processed into mirnas that affect the expression of the corresponding mrnas, i.e. the polynucleotide constructs are capable of up-regulating the amount of the corresponding mirnas in vivo. Thus, the present invention provides an isolated polynucleotide (construct) that can be transcribed by human cells into a precursor miRNA, which can be cleaved by human cells and expressed as the miRNA.

In a preferred embodiment of the invention, the polynucleotide construct comprises a structure of formula I:

Seq_{forward direction}-X-Seq_{Reverse direction}

Formula I

In the formula I, the compound is shown in the specification,

Seq_{forward direction}A nucleotide sequence capable of expressing the miRNA in cells, Seq_{Reverse direction}Is and Seq_{Forward direction}A substantially complementary nucleotide sequence; alternatively, Seq_{Reverse direction}A nucleotide sequence capable of expressing the miRNA in cells, Seq_{Forward direction}Is and Seq_{Forward direction}A substantially complementary nucleotide sequence;

the structure of formula I, when transferred into a cell, forms a secondary structure of formula II:

in formula II, Seq_{Forward direction}、Seq_{Reverse direction}And X is as defined above;

Typically, the polynucleotide construct is located on an expression vector. Thus, the invention also includes a vector comprising said miRNA, or said polynucleotide construct. The expression vector usually further contains a promoter, an origin of replication, and/or a marker gene. Methods well known to those skilled in the art can be used to construct the expression vectors required by the present invention. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The expression vector preferably comprises one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as kanamycin, gentamicin, hygromycin, ampicillin resistance.

Chip and method for manufacturing the same

The microRNA expression profiling chip usually contains up to hundreds of probes, covers various microRNAs, and detects the content of various microRNAs contained in a sample on the whole genome level by utilizing the principle of DNA double-strand homologous complementation. Therefore, the transcription level of the microRNA in the whole genome range in the sample to be detected can be detected at the same time.

By utilizing the miRNA sequence, a corresponding miRNA chip can be prepared, and the expression profile and the regulation mode of miRNAs are further researched.

In another aspect, the present invention also provides a chip for analyzing miRNA expression profiles, which can be used to distinguish between spontaneous recurrent abortion samples and normal samples.

The miRNA chip comprises a solid phase carrier and an oligonucleotide probe orderly fixed on the solid phase carrier, wherein the oligonucleotide probe comprises a sequence shown in SEQ ID NO. 1.

Specifically, a suitable probe can be designed according to the miRNA of the present invention, and immobilized on a solid phase carrier to form an "oligonucleotide array". By "oligonucleotide array" is meant an array having addressable locations (i.e., locations characterized by distinct, accessible addresses), each addressable location containing a characteristic oligonucleotide attached thereto. The oligonucleotide array may be divided into a plurality of subarrays as desired.

The solid phase carrier can adopt various common materials in the field of gene chips, such as but not limited to nylon membranes, glass slides or silicon wafers modified by active groups (such as aldehyde groups, amino groups and the like), unmodified glass slides, plastic sheets and the like.

The miRNA chip can be prepared by a conventional method for manufacturing a biochip known in the art. For example, if a modified glass slide or silicon wafer is used as the solid support, and the 5' end of the probe contains a poly-dT string modified with an amino group, the oligonucleotide probe can be prepared into a solution, and then spotted on the modified glass slide or silicon wafer by using a spotting instrument, arranged into a predetermined sequence or array, and then fixed by standing overnight, so as to obtain the miRNA chip of the invention. If the nucleic acid does not contain amino modifications, the preparation can also be referred to: the "Gene diagnostic technique-non-Radioactive operation Manual" edited by Wangshen five; l.l.erisi, v.r.i.er, p.o.brown.expansion of the metabolic and genetic control of genetic compression a genetic scale, science, 1997; 278:680 and maliren, jiang china main edition biochip, beijing: chemical industry Press, 2000, 1-130.

In another aspect, the present invention also provides a method for detecting an miRNA expression profile in human tissue using a miRNA chip, comprising the steps of:

(1) providing a sample of RNA isolated from human tissue, and disposing a marker on said RNA;

(2) contacting the RNA of (1) with the chip to enable the RNA to perform hybridization reaction with the oligonucleotide probe on the solid phase carrier, thereby forming an 'oligonucleotide probe-RNA' binary complex on the solid phase carrier;

(3) detecting the markers of the binary complex formed in (2), thereby determining the expression profile of the corresponding miRNA in the human tissue.

Methods for extracting RNA from human tissue are well known to those skilled in the art, including Trizol.

More preferably, in step (1), after isolating the RNA sample from human tissue, the RNA sample is suitably treated to enrich for RNA having a length, typically between 10 and 100 (small piece of RNA). After the treatment, the small-segment RNA is used for subsequent hybridization, so that the accuracy of capturing miRNA by the chip can be improved. RNA having a certain fragment length can be conveniently isolated by one skilled in the art, for example, by gel electrophoresis.

Labeling of RNA is also well known to those skilled in the art and can be accomplished by the addition of a label, such as a labeling group, that specifically binds to the RNA during hybridization. Such labeling groups include, but are not limited to: digoxin molecules (DIG), biotin molecules (Bio), fluorescein and its derivative biomolecules (FITC, etc.), other fluorescent molecules (e.g., Cy3, Cy5, etc.), Alkaline Phosphatase (AP), horseradish peroxidase (HRP), etc. These labels and methods of labeling are well known in the art.

When the RNA is hybridized with the miRNA chip, the miRNA chip may be prehybridized with a prehybridization buffer.

The solid phase hybridization between the RNA and the miRNA chip according to the present invention is performed according to the classical methods in the art, and the optimal conditions for buffer, probe and sample concentration, prehybridization temperature, hybridization temperature, and time can be easily determined empirically by one of ordinary skill in the art. Alternatively, reference may be made to the molecular cloning guidelines.

And then obtaining information to be detected according to the position, the strength and other information of the marking signal on the miRNA chip. If the amplification product is labeled with a fluorescent group, the information to be detected can also be directly acquired by a fluorescence detection device (such as a confocal laser scanner Scanarray 3000).

Detection kit

The invention also provides a kit, and the kit contains the chip. The kit can be used for detecting the expression profile of miRNA; or for diagnosing pregnancy outcome of in vitro fertilization-embryo transfer, preferably, the kit further comprises a marker for labeling the RNA sample, and a substrate corresponding to the marker.

In addition, the kit may further include various reagents required for RNA extraction, PCR, hybridization, color development, and the like, including but not limited to: an extraction solution, an amplification solution, a hybridization solution, an enzyme, a control solution, a color development solution, a washing solution, an antibody, and the like.

In addition, the kit can also comprise an instruction book and/or chip image analysis software.

The main advantages of the invention include:

1) the invention discovers for the first time that hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p and hsa-miR-23a-3p can be used for identifying and diagnosing the pregnancy outcome of in vitro fertilization-embryo transplantation.

2) The present invention provides a significant need in the art for biomarker molecules that can be used for the identification and prediction of early pregnancy outcome after IVF-ET embryo transfer.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Example 1.

Screening of serum markers

Real-time fluorescent quantitative PCR detection of hsa-miR-23a-3p expression level

Experimental reagent and preparation thereof

(1) RT primer: prepared by Rn 10031.2 from Ruibo biology company, operating according to the instruction, preparing 5 μ M primer stock solution by mixing lyophilized powder with RNase-free water, subpackaging and storing; before use, 10-fold dilutions (45. mu.l water + 5. mu.l stock) were made to prepare 500nM RT primer working solution.

(2) RT enzyme: is a product of TOYOBOe company.

(3)10 × PCR Buffer: is a product of AB company.

(4) Real-time fluorescent quantitative PCR instrument: 7300Real-Time PCR System by ABI, USA

Extraction of plasma and serum RNA

(1) Plasma separation: whole blood samples were collected in EDTA anticoagulation tubes. Gently inverting, mixing, centrifuging at 4 deg.C for 10min at 1600 Xg for 10min, and subpackaging the supernatant (blood plasma) into multiple centrifuge tubes to absorb blood plasma while avoiding leukocyte absorption to the middle layer;

(2) and (3) separating serum: transferring the collected whole blood sample into a centrifuge tube of RNase free, standing at low temperature, separating serum (about 30-60min) after the blood is coagulated, centrifuging at 3000rpm/min for 15min, separating the blood into an upper layer and a lower layer, carefully sucking the upper layer, transferring the upper layer into a new centrifuge tube for storage, paying attention to other impurities such as blood cells and the like which do not suck the lower layer, and immediately transferring the whole blood sample into a refrigerator at minus 80 ℃ for storage after the collected serum is marked;

(3) the Plasma and Serum collected beforehand were removed in a freezer at-80 ℃ and RNA was extracted according to the instructions provided in the miRNeasy Serum/Plasma extraction kit from QIAGEN.

(4) Adding 1ml TRIZOL/ml into 200 μ l plasma or serum, mixing, and standing at room temperature for 5 min;

(5) adding 200 μ l chloroform according to TRIZOL/ml, shaking vigorously for 15s, and standing at room temperature for 2-3 min;

(6) centrifuging at 12000rpm for 15min at 4 ℃;

(7) collecting supernatant, adding 500 μ l isopropanol according to TRIZOL/ml, standing at room temperature for 10 min;

(8) centrifuging at 12000rpm for 10min at 4 deg.C; discarding the supernatant, and depositing RNA at the bottom of the tube;

(9) adding 1ml of 75% ethanol according to TRIZOL/ml, and suspending and precipitating by Vortex;

(10) centrifuging at 4 deg.C and 12000rpm for 5min, and removing supernatant;

(11) drying at room temperature for 5-10 min;

(12) RNA was dissolved in DEPC water (12. mu.l volume);

(13) the OD value was measured, and RNA was quantified.

RT reaction

The primer concentrations were set as described in the specification, and the RT reaction solution was prepared according to the following table, all operations being performed in an ice bath:

RNA template (2. mu.g)	1.0μl
		RT primer working solution (500nM)	7.0. mu.l (1.0. mu.l each)
RNase-free H₂O	3.0μl
		Total volume	11μl

Mixing, centrifuging instantaneously, standing at 70 deg.C for 10min, standing in ice bath for 2 min, adding the reagents into the above primer reaction solution according to the following table, and establishing 50ul RT reaction system:

in order to avoid sample adding errors, in actual operation, the same parts in the reaction system are combined and mixed uniformly, and then are loaded respectively, wherein a negative control reaction tube (without RT enzyme) is set up. RT reaction conditions: 60 minutes at 42 ℃; 70 ℃ for 10 minutes.

PCR reaction

By ddH₂O dilution of RT product 5-fold, i.e.: 50 μ l RT product +200 μ l ddH₂O; a10. mu.l PCR reaction was set up as follows:

diluted RT product	2.0μl
		SYBR Green Mix	5.0μl
Bulge-loop^TM F(5uM)	0.4μl
		Bulge-loop^TMR(5uM)	0.4μl
RNase-free H₂O	2.2μl
		Total volume	10μl

Similarly, in order to reduce and avoid the sample addition error, in the actual operation, the mixture is prepared first and then different primers are added respectively. 1 control reaction (NE) was set up without RT product (with H)₂O instead), the PCR reaction solution was added to 384-well PCR plates (ABI corporation) with 3 duplicate wells. The thermal cycle parameters were set as follows:

data processing

Δ Ct is the average value of (target gene Ct-internal reference Ct); delta Ct is the average value of the target gene delta Ct in the sample to be tested-the target gene delta Ct in the reference sample, if no reference sample exists, the default reference sample delta Ct is 10, the CDA/VA sample is used as the reference sample in the experiment, and the relative sample initial template amount is 2^-ΔΔCt) Average value of (a).

As a result:

the result shows that compared with the group with failure pregnancy, the expression of miR-23a-3p in the plasma of the group with success pregnancy is increased, and the ratio is 1.704; the expression of miR-27a-3p in the plasma of the pregnancy success group is increased, and the ratio of the expression to the plasma of the pregnancy failure group is 1.691; the expression of miR-100-5p in the plasma of the pregnancy success group is increased, and the ratio of the expression to the plasma of the pregnancy failure group is 1.462; the expression of miR-127-3p in the plasma of the pregnancy success group is increased, and the ratio of the expression to the plasma of the pregnancy failure group is 1.620. The results above demonstrate that the expression levels of miR-23a-3p, miR-27a-3p, miR-100-5p and miR-127-3p in plasma can be used for judging IVF-ET pregnancy outcome.

Example 2.

To verify the sensitivity and specificity of the above method, we detected the expression of several miRNAs in serum and verified their expression and changes in the serum of IVF-ET patients. The result shows that the expression of miR-100-5p in the pregnancy success group is increased, and the ratio of the expression of miR-100-5p in the pregnancy failure group to the expression of miR-100-5p in the pregnancy success group is 1.462; the expression of miR-486-5p in a pregnancy success group is increased, and the ratio of the miR-486-5p in the pregnancy success group to the miR-486-5p in a pregnancy failure group is 1.284; the expression of miR-27a-3p in the pregnancy failure group is increased, and the ratio of the expression to the expression in the pregnancy success group is 1.305. The above validation experiments show that our above methods are good in sensitivity and specificity.

In conclusion, the inventor establishes a method for predicting the pregnancy outcome of IVF-ET by detecting the expression of hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-23a-3p and has-miR-486-5p by using peripheral blood plasma and serum of IVF-ET.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> scientific institute of family planning in Shanghai City

Wuhan university people hospital

<120> IVF-ET related microRNA and application thereof

<130>P2018-0089

<160>6

<170>PatentIn version 3.5

<210>1

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

uucacagugg cuaaguuccg c 21

<210>2

<211>22

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ucggauccgu cugagcuugg cu 22

<210>3

<211>22

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

uagcaccauc ugaaaucggu ua 22

<210>4

<211>22

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

aacccguaga uccgaacuug ug 22

<210>5

<211>22

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

uccuguacug agcugccccg ag 22

<210>6

<211>21

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

aucacauugc cagggauuuc c 21

Claims

Use of a miRNA or a detection reagent therefor, for the preparation of a kit for determining the outcome of in vitro fertilization-embryo transfer (IVF-ET) pregnancy, said miRNA being selected from the group consisting of: hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p, or a combination thereof.
2. A miRNA chip, comprising:

a solid support; and

oligonucleotide probes orderly fixed on the solid phase carrier, wherein the oligonucleotide probes specifically correspond to hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p or the combination thereof.
3. The chip of claim 2, wherein said oligonucleotide probes comprise:

a complementary binding region; and/or

A linker region attached to the solid support.
4. A kit, which is characterized by comprising hsa-miR-27a-3p, hsa-miR-127-3p, hsa-miR-29a-3p, hsa-miR-100-5p, hsa-miR-486-5p, hsa-miR-23a-3p or detection reagents thereof and instructions, wherein the instructions refer to the kit

(a) For determining pregnancy outcome of in vitro fertilization-embryo transfer and/or (b) for determining sensitivity and/or specificity of in vitro fertilization-embryo transfer.
5. An in vitro non-diagnostic method for determining in vitro fertilization-embryo transfer pregnancy outcome, comprising the steps of:

determining the expression Ea of hsa-miR-27a-3p in the sample, and comparing the expression Ea with the expression Ea of a control gene₀Comparing if Ea/Ea₀More than or equal to 1.2, preferably more than or equal to 1.5, and more preferably more than or equal to 1.6 (such as 1.691), the pregnancy outcome of the in vitro fertilization-embryo transfer of the test sample is good, and the control gene is hsa-miR-27a-3p of the failed group.
6. An isolated miRNA selected from the group consisting of:

(i) miR-23 a-27 a-24-2, miR-433/127, miR-125b1/let-7a-2/miR-100, hsa-miR-486 or miRNA of miR-23 a-27 a-24-2 family, or

(ii) miRNA complementary with miRNA of miR-23 a-27 a-24-2, miR-433/127, miR-125b1/let-7a-2/miR-100, hsa-miR-486 and miR-23 a-27 a-24-2 families.
7. An isolated or artificially constructed precursor miRNA that is capable of being cleaved and expressed in a human cell to the miRNA of claim 5.
8. An isolated polynucleotide capable of being transcribed by a human cell into a precursor miRNA, wherein the precursor miRNA is capable of being spliced and expressed in the human cell into the miRNA of claim 5.
9. A method for judging the fate of in vitro fertilization-embryo transfer pregnancy of a test object is characterized by comprising the following steps:

measuring the expression Ea of hsa-miR-27a-3p in the sample of the detection object, and comparing the expression Ea with the expression Ea of the control gene₀Comparing if Ea/Ea₀More than or equal to 1.2, preferably more than or equal to 1.5, and more preferably more than or equal to 1.6 (such as 1.691), it indicates that the pregnancy outcome of in vitro fertilization-embryo transfer of the test object is good.
10. The method of claim 9, wherein the sample comprises plasma.