CN110724657A - Strategy for regulating cell morphology and improving polylactic acid production performance - Google Patents
Strategy for regulating cell morphology and improving polylactic acid production performance Download PDFInfo
- Publication number
- CN110724657A CN110724657A CN201911035041.3A CN201911035041A CN110724657A CN 110724657 A CN110724657 A CN 110724657A CN 201911035041 A CN201911035041 A CN 201911035041A CN 110724657 A CN110724657 A CN 110724657A
- Authority
- CN
- China
- Prior art keywords
- polylactic acid
- amino acid
- acid sequence
- gene
- genetically engineered
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K14/245—Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1025—Acyltransferases (2.3)
- C12N9/1029—Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/13—Transferases (2.) transferring sulfur containing groups (2.8)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/62—Carboxylic acid esters
- C12P7/625—Polyesters of hydroxy carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
- C12Y101/01036—Acetoacetyl-CoA reductase (1.1.1.36)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/14—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (1.14.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y208/00—Transferases transferring sulfur-containing groups (2.8)
- C12Y208/03—CoA-transferases (2.8.3)
- C12Y208/03001—Propionate CoA-transferase (2.8.3.1)
Abstract
The invention discloses a strategy for regulating cell morphology and improving polylactic acid production performance, belonging to the technical field of biological engineering. The invention utilizes the cell division inhibitor to inhibit cell division by means of molecular biology, thereby achieving the purposes of improving the volume and the specific surface area of cells and facilitating the accumulation of intracellular products. By introducing a regulation and control circuit of the targeted cell division inhibitor, the volume of the cell is enlarged, and the intracellular accumulation of the polylactic acid is increased. The polylactic acid produced by the invention has the content of 53.8w percent and the dry weight of 27.2 g/L.
Description
Technical Field
The invention relates to a strategy for regulating cell morphology and improving polylactic acid production performance, belonging to the technical field of biological engineering.
Background
Polylactic acid is a good biocompatible material, and is a polymer obtained by polymerizing lactic acid serving as a main raw material, and the raw material source is sufficient and can be regenerated. The production process of polylactic acid is pollution-free, and the product can be biodegraded, so that the polylactic acid can be recycled in nature, and is an ideal green high polymer material.
The dynamic regulation and control system is a new metabolic flow regulation and control means in the field of metabolic engineering, and is different from static regulation and control, and is mainly characterized in that in the fermentation process, an engineering strain can make corresponding enzyme activity regulation according to fermentation time, physiological state, intracellular metabolite concentration and extracellular environment change, so that the metabolic flow distribution is influenced, and the product production capacity is improved. The existing method for producing polylactic acid mainly comprises the steps of controlling the ratio of pathway enzymes, adjusting the balance of cofactors, and knocking out targets by model prediction, wherein the highest content can reach 49%, but the problems of low content, difficult downstream separation, long time consumption and large pollution exist.
Disclosure of Invention
The first purpose of the invention is to provide a gene engineering bacterium, which expresses a target gene for regulating and controlling the cell size and a target gene for regulating and controlling the production of polylactic acid; the target gene for regulating the cell size comprises a gene sulA for coding a cell division inhibitor SuaA, and the amino acid sequence of the cell division inhibitor SuaA is consistent with the amino acid sequence coded by SEQ ID NO. 1; the target gene for regulating and controlling the production of the polylactic acid comprises a gene phaA for coding ketoester-containing thiolase phaA, a gene phaB for coding acetoacetyl-CoA reductase phaB, a gene phaC for coding polyhydroxybutyrate synthase phaC and a gene pCT for coding propionyl-CoA transferase pCT; the amino acid sequence of the ketoester constitutional thiolase phaA is consistent with the amino acid sequence coded by SEQ ID NO.2, the amino acid sequence of the acetoacetyl-CoA reductase is consistent with the amino acid sequence coded by SEQ ID NO.3, the amino acid sequence of the polyhydroxybutyrate synthase is consistent with the amino acid sequence coded by SEQ ID NO.4, and the amino acid sequence of the propionyl-CoA transferase pCT is consistent with the amino acid sequence coded by SEQ ID NO. 5.
In one embodiment of the invention, the nucleotide sequence of the gene sulA encoding the cell division inhibitor SuaA is shown in SEQ ID No. 1.
In one embodiment of the invention, the nucleotide sequence of the gene phaA encoding ketoester-lyase phaA is shown in SEQ ID NO. 2.
In one embodiment of the invention, the nucleotide sequence of the gene phaB encoding acetoacetyl-coa reductase phaB is shown in SEQ ID No. 3.
In one embodiment of the invention, the nucleotide sequence of the gene phaC encoding the polyhydroxybutyrate synthase phaC is shown in SEQ ID NO. 4.
In one embodiment of the invention, the nucleotide sequence of the gene pCT encoding propionyl-coa transferase pCT is shown in SEQ ID No. 5.
In one embodiment of the invention, P is usedJ23119-phaABC-pCT and pSC101-sulA are expression vectors.
In one embodiment of the present invention, lactic acid producing strain GL0002 is used as a host.
The construction method of the lactic acid producing strain GL0002 is disclosed in the literature: guo L, Zhang F, Zhang C, HuG, Gao C, Chen X, et al.enhancement of matrix production through engineering of the very high performance of the Periplastic rTCA pathway in Escherichia coli Biotechnol Bioeng 2018,115(6) 1571. times.1580.
The P isJ23119phaABC-pCT expresses ketoester-constitutively lyase phaA, acetoacetyl-coa reductase phaB, polyhydroxybutyrate synthase phaC and propionyl-coa transferase pCT.
Said PJ23119The construction method of the-phaABC-pCT plasmid comprises the following steps:
(1) based on a commercial Plasmid pTargetF (Addgene Plasmid #62226), a T7Te terminator sequence is inserted after an rrnB T1 terminator in a full-Plasmid PCR mode so as to reduce leakage expression; further, a whole plasmid PCR mode is adopted, the sgRNA expression frame is removed, and an engineering plasmid pJ01 only containing a Pj23119 constitutive promoter and double termination is obtained;
(2) using Ralstonia eutropha genome as template, designing primer containing B0034RBS (nucleotide sequence shown in SEQ ID NO. 6), respectively amplifying to obtain phaA and phaB genes, and adding phaA and phInserting two aB genes into an expression frame of Pj23119 (the nucleotide sequence is shown as SEQ ID NO. 7) in a multi-gene one-step homologous recombination mode to obtain PJ23119-phaAB plasmid; inserting two genes phaC and pct into an expression frame of Pj23119 in a way of multigene one-step homologous recombination by taking Pseudomonas mobilis (Pseudomonas) genome as a template by the same method, and finally combining the two genes into PJ23119-phaABC-pCT；
Said PJ23119The construction method of the-phaABC-pCT plasmid comprises the following steps:
a primer containing B0034RBS was designed using Escherichia coli (MG 1655) as a template, and the sulA gene containing B0034RBS was amplified to obtain a fragment, which was inserted into pSC101 plasmid to obtain pSC101-sulA plasmid.
The second purpose of the invention is a method for producing polylactic acid, which utilizes the genetic engineering bacteria to produce polylactic acid by fermentation.
In one embodiment of the invention, the medium of the fermentation comprises NBS mineral salts medium.
In one embodiment of the present invention, the fermentation conditions are 35-38 deg.C, 200-220rpm, strain fermentation initial OD600Fermenting for 70-100h at 0.04-0.1; or, the fermentation conditions are 35-38 ℃, 480-530rpm, the inoculum size is 5-10%, the liquid loading amount is 30-50%, the pH is 6.0-7.0, and the initial OD of the strain fermentation is6000.04-0.3, ventilation amount of 1-2vvm, and fermentation for 70-100 h.
The third purpose of the invention is to provide the application of the genetically engineered bacterium or the method for producing the polylactic acid in preparing the target protein, wherein the target protein comprises enzyme protein or non-enzyme protein.
The fourth purpose of the invention is to provide the application of the genetically engineered bacterium or the method for producing the polylactic acid in the fields of biology, pharmacy, food or chemical engineering.
Has the advantages that: the invention provides a method for constructing a gene regulation line. In addition, the method has simple design, few system elements and low strain growth load. By constructing a polylactic acid production engineering strain and introducing a regulation gene circuit, the content of the polylactic acid reaches 53.8w percent, and the polylactic acid has better application prospect.
Drawings
FIG. 1: a cellular parameter that regulates cellular morphology.
FIG. 2: production route of polylactic acid.
FIG. 3: plasmid map, PJ23119phaABC-pCT and pSC 101-sulA.
FIG. 4: change in polylactic acid content in shake flasks.
FIG. 5: change in polylactic acid content in 7.5L fermentor.
Detailed Description
Materials and methods
Plasmid construction is carried out by classical molecular biology means.
Cellular morphological parameter measurements were performed using a fluorescence microscope (Nikon microscopip, 80i) with an ambient temperature of 30 degrees.
Seed culture medium: LB culture medium, the ingredients include peptone 10g/L, yeast powder 5g/L, sodium chloride 10 g/L.
Fermentation medium: NBS inorganic salt culture medium with the components of 50g/L, CaCl glucose2·2H2O15 mg/L, 0.667mL/L of microelement liquid, sterilizing and supplementing MgSO4·7H2O 0.25g/L，VB10.5mg/L, betaine hydrochloride 1 mM. The preparation method of the trace element liquid is FeCl3·6H2O 2.4g/L、CoCl2·6H2O 0.3g/L、CuCl20.15g/L、ZnCl2·4H2O0.3g/L、NaMnO40.3g/L、H3BO30.075g/L、MnCl2·4H2O0.5 g/L, dissolved in 0.1M HCl.
Preparation of a fermentation sample: taking a fermentation liquid sample, centrifuging at 12000rpm for 5min, taking supernatant liquid, diluting, filtering by a 0.22 mu m water system membrane, and taking filtrate as a sample for liquid chromatography analysis.
And (3) measuring the content of the polylactic acid: a high performance liquid chromatograph (equipped with ultraviolet detector) adopts a Berloe AminexHPX-87H (300 × 7.8mm, 9 μ M) chromatographic column, and the mobile phase is H with concentration of 0.005M2SO4Filtering the mobile phase with 0.22 μm filter membrane, ultrasonic degassing at flow rate of 0.6mL/min and column temperature of 35 deg.C, and detecting at ultraviolet detection wavelength of 210 nm.
Example 1 evaluation of cell morphology
The method comprises the steps of respectively adding B0034RBS to the ATG position in front of a gene by adopting a fusion PCR mode, wherein the gene is the sulA for coding a cell division inhibitor sulA, the minC (the nucleotide sequence is shown as SEQ ID NO. 8) for coding a diaphragm forming protein, the minD (the nucleotide sequence is shown as SEQ ID NO. 9), the minE (the nucleotide sequence is shown as SEQ ID NO. 10) and the mreB (the nucleotide sequence is shown as SEQ ID NO. 11) for coding cytoskeleton protein. And recovering the PCR product, and carrying out enzyme digestion connection on the PCR product and a vector pSC101 plasmid to respectively obtain recombinant plasmids pSC101-sulA, pSC101-minC, pSC101-minD, pSC101-minE and pSC 101-mreB.
Coli JM109 was transfected with the obtained recombinant plasmids pSC101-sulA, pSC101-minC, pSC101-minD, pSC101-minE, and pSC101-mreB, respectively, to obtain a plasmid containing a cell division inhibitor sulA.
The evaluation of the cytomorphological parameters of the above strains was carried out in LB medium using a fluorescence microscope and an excitation scanning electron microscope. The results are shown in FIG. 1. As can be seen from FIGS. 1A-D, the expression of the sulA gene resulted in a significant increase in the average cell length from 4.5 μm to 22.5 μm without a significant change in the average cell width; the minC gene is expressed, so that the average cell length reaches 18.6 mu m, and the average cell width is not obviously changed; the minD gene is expressed, so that the average cell length is 10.8 mu m, and the average cell width is not obviously changed; the minE gene is expressed, so that the average cell length reaches 6.5 mu m, and the average cell width is not obviously changed; the mreB gene was expressed such that the average cell length was 4.01 μm and the average cell width did not change significantly. The average volume of the cells was from 6.3 μm compared with the control group containing the empty plasmid3Increase to 43.2 μm3Cell surface area from 25.6 μm2Increase to 101.2 mu m2. Indicating that the expression of sulA results in a large change in cell morphology.
Example 2 detection of polylactic acid content in Shake flasks
Will already haveThe constructed vector P for expressing the gene related to the synthetic pathway of polylactic acid (FIG. 2)J23119Introduction of-phaABC-pCT and pSC101-sulA (FIG. 3) into competent cells of lactic acid producing strain GL0002 to obtain a vector with PJ23119Polylactic acid producing strains of-phaABC-pCT and pSC101-sulA plasmids.
Culturing the above polylactic acid producing strain in NBS culture medium at 37 deg.C and 200rpm, and fermenting to obtain initial OD600The fermentation time is 0.04, and the fermentation time is 85 h. And (5) identifying the content. As shown in FIG. 4, the intracellular polylactic acid content increased to 24.2 w%, the dry weight increased to 8.12g/L, and the glucose consumption gradually increased with the increase of the culture time. Meanwhile, it can be seen that the intracellular polylactic acid content is increased to 24.2 w% due to the cell elongation, and only the control group of the polylactic acid production pathway is 13.5 w%.
As shown in fig. 4, a significant increase in intracellular polylactic acid content was observed by nile red staining and fluorescence microscopy, compared to the control group expressing only the polylactic acid production pathway.
Example 3 detection of polylactic acid content in fermenter
The fermentation performance of the DS7 strain was tested in a 7.5L fermentor containing NBS medium. The liquid loading was 3.5L, pH 6.7, pressure 1mpa, constant temperature 37 ℃, 500rpm, initial inoculation OD600The fermentation period was 84h, the aeration rate was 0.2, and the aeration rate was 1 vvm.
As shown in FIG. 5, at the end of the fermentation, the accumulated amount of polylactic acid content reached 53.8 w%, and the dry weight reached 27.2 g/L.
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
SEQUENCE LISTING
<110> university of south of the Yangtze river
<120> a strategy for improving polylactic acid production performance by regulating cell morphology
<160>11
<170>PatentIn version 3.3
<210>1
<211>510
<212>DNA
<213> Artificial Synthesis
<400>1
atgtacactt caggctatgc acatcgttct tcgtcgttct catccgcagc aagtaaaatt 60
gcgcgtgtct ctacggaaaa cactacagcc gggcttatca gtgaagttgt ctatcgcgaa 120
gatcagccca tgatgacgca acttctactg ttgccattgt tacagcaact cggtcagcaa 180
tcgcgctggc aactctggtt aacaccgcaa caaaaactga gtcgggaatg ggttcaggca 240
tctgggctac ccttaacgaa agtaatgcag attagccagc tctccccttg ccacactgtg 300
gagtcaatgg ttcgcgcttt acgcacgggc aattacagtg tggtgatcgg ttggttggca 360
gatgatttga ctgaagaaga gcatgctgaa cttgttgatg cggcaaatga aggtaacgct 420
atggggttta ttatgcgtcc ggtaagcgca tcctctcacg ccacgagaca actttccggg 480
ctaaaaattc actctaattt gtatcattaa 510
<210>2
<211>1182
<212>DNA
<213> Artificial Synthesis
<400>2
atgacagacg tggtgattgt tagcgcagcc cgcaccgccg ttggtaagtt tggcggcagc 60
ctggcaaaga tccctgcccc tgagctgggc gcagtggtta tcaaggcagc cctggagcgc 120
gcaggtgtga aaccggagca ggtgagtgag gtgatcatgg gccaggttct gaccgcaggt 180
agtggccaaa atccggcccg tcaggccgca atcaaagcag gcttacctgc catggtgccg 240
gccatgacca tcaacaaggt gtgcggcagt ggcctgaagg ccgtgatgtt agccgccaac 300
gccatcatgg ccggcgatgc agagatcgtg gtggcaggcg gccaggaaaa tatgagcgcc 360
gcacctcatg ttctgccggg cagtcgcgat ggcttccgta tgggcgacgc aaagctggtg 420
gacaccatga tcgtggacgg cctgtgggac gtgtacaacc agtaccacat gggcatcacc 480
gccgagaacg tggccaagga gtacggcatc acacgcgagg cccaggatga gttcgcagtt 540
ggcagccaga acaaggcaga ggccgcccag aaagccggca agttcgatga agaaatcgtg 600
ccggtgctga tcccgcagcg caaaggtgac ccggtggcct tcaaaaccga tgagttcgtg 660
cgccagggcg caaccctgga tagcatgagc ggcctgaagc cggccttcga taaggcaggc 720
acagtgaccg ccgccaatgc cagtggcctg aacgatggtg cagccgcagt ggttgtgatg 780
agcgccgcca aagccaagga actgggtctg accccgctgg caaccatcaa aagctacgcc 840
aacgccggcg ttgatcctaa agtgatgggc atgggtccgg ttccggccag taagcgcgcc 900
ttaagtcgcg ccgaatggac accgcaggac ctggacctga tggaaatcaa cgaagccttc 960
gcagcccagg cattagcagt gcatcagcaa atgggctggg acaccagcaa ggtgaacgtg 1020
aacggtggcg ccatcgcaat tggccaccct atcggcgcaa gtggctgtcg catcctggtg 1080
accctgctgc acgaaatgaa gcgccgtgac gccaagaaag gcctggccag cttatgcatt 1140
ggtggtggta tgggcgttgc cttagcagtg gaacgcaagt aa 1182
<210>3
<211>741
<212>DNA
<213> Artificial Synthesis
<400>3
atgacccagc gcattgccta tgtgaccggt ggtatgggcg gtattggtac cgccatctgt 60
cagcgtctgg caaaagatgg ctttcgcgtt gttgctggtt gcggtccgaa tagtccgcgc 120
cgtgaaaaat ggctggaaca gcagaaggca ctgggcttcg actttatcgc aagcgaaggc 180
aatgtggcag actgggatag caccaaaacc gccttcgata aggtgaaaag cgaggtgggc 240
gaagttgacg tgctgatcaa caacgctggt atcacccgcg atgtggtgtt tcgcaaaatg 300
acccgcgccg attgggatgc agtgatcgat accaatttaa cctctttatt caacgtgacc 360
aaacaagtta ttgacggcat ggcagatcgt ggctggggtc gcattgttaa catcagcagc 420
gtgaacggcc agaaaggtca gtttggccag accaactaca gcaccgccaa agccggttta 480
cacggtttta ccatggcttt agcacaagaa gtggccacca aaggtgtgac cgtgaatacc 540
gttagcccgg gctacattgc caccgacatg gtgaaagcca ttcgccaaga tgttctggac 600
aaaatcgtgg caaccatccc ggtgaaacgt ctgggtttac cggaagagat cgccagcatt 660
tgcgcttggc tgagcagtga agaaagcggc ttcagcaccg gtgccgattt ctctttaaac 720
ggtggtttac atatgggtta a 741
<210>4
<211>1680
<212>DNA
<213> Artificial Synthesis
<400>4
atgagcaaca aaaacagcga cgacctgaac cgtcaggctt ccgagaacac gctgggtctg 60
aaccctgtaa tcggtctgcg tggcaaggat ctgctgactt ctgcacgtat ggtcctgact 120
caagcaatca agcagccaat ccactctgtc aagcacgtcg cacacttcgg tatcgagctg 180
aagaacgtca tgttcggtaa aagcaaactg caaccggagt ccgatgaccg tcgtttcaac 240
gacccggcat ggtctcagaa ccctctgtac aaacgttacc tgcaaaccta cctggcctgg 300
cgtaaagagc tgcacgactg gatcggtaac tccaaactgt ccgagcagga catcaaccgt 360
gcacacttcg tcatcacgct gatgaccgaa gctatggcac ctactaactc cgctgctaac 420
ccagcagcag tgaaacgctt cttcgaaacc ggtggcaaaa gcctgctgga cggtctgact 480
catctggcaa aggacctggt taacaacggt ggtatgccaa gccaggttga catgggtgca 540
ttcgaagtgg gcaaatctct gggtactacc gaaggtgcag tggtgttccg taacgacgtg 600
ctggaactga tccagtaccg tccaactact gaacaggtgc acgaacgtcc actgctggta 660
gtgccgccgc aaattaacaaattctacgtg ttcgacctgt ccccggacaa atccctggct 720
cgtttctgtc tgtctaacaa ccagcagacc ttcatcgtgt cctggcgtaa cccgactaaa 780
gcgcagcgtg aatggggtct gtctacttac atcgacgctc tgaaagaagc cgttgacgtt 840
gtttccgcca tcacgggtag caaagacatc aacatgctgg gcgcttgctc cggtggtatt 900
acctgcactg ctctgctggg tcattacgct gctctgggtg agaagaaagt gaacgctctg 960
actctgctgg ttacggttct ggataccacc ctggactctc aggttgctct gttcgttgat 1020
gagaaaacgc tggaagccgc taaacgccac tcttatcagg cgggtgtact ggaaggccgt 1080
gatatggcga aagttttcgc gtggatgcgc ccgaatgatc tgatctggaa ctactgggtt 1140
aacaactacc tgctgggcaa cgaaccgccg gtttttgata tcctgttttg gaacaacgat 1200
accacccgcc tgccggcggc gtttcacggc gatctgattg aaatgtttaa aaacaacccg 1260
ctggtacgcg cgaacgcgct ggaagtaagc ggcaccccga ttgatctgaa acaggttacc 1320
gcggatatct atagcctggc gggcaccaat gatcacatta ccccgtggaa atcctgttac 1380
aaaagcgccc agctgtttgg cggcaaagta gaatttgtac tgagctccag cggccacatt 1440
aagagcattc tgaatccgcc gggcaatccg aaatcccgct atatgacctc taccgatatg 1500
ccggcgaccg cgaatgaatg gcaggaaaat tctaccaaac ataccgattc ttggtggctg 1560
cattggcagg cgtggcaggc cgaacgctct ggcaaactga agaaatctcc gacctctctg 1620
ggcaacaaag cctatccgtc tggcgaagcg gcgccgggca cctatgttca tgaacgctaa 1680
<210>5
<211>1554
<212>DNA
<213> Artificial Synthesis
<400>5
atgagaaaag tagaaatcat tactgctgaa caagcagctc agctcgtaaa agacaacgac 60
acgattacgt ctatcggctt tgtcagcagc gcccatccgg aagcactgac caaagctttg 120
gaaaaacggt tcctggacac gaacaccccg cagaacttga cctacatcta tgcaggctct 180
caggacaaac gcgatggccg tgccgctgaa catctggcac acacaggcct tttgaaacgc 240
gccatcatcg gtcactggca gactgtaccg gctatcggta aactggctgt cgaaaacaag 300
attgaagctt acaacttctc gcagggcacg ttggtccact ggttccgcgc cttggcaggt 360
cataagctcg gcgtcttcac cgacatcggt ctggaaactt tcctcgatcc ccgtcagctc 420
ggcggcaagc tcaatgacgt aaccaaagaa gacctcgtca aactgatcga agtcgatggt 480
catgaacagc ttttctaccc gaccttcccg gtcaacgtag ctttcctccg cggtacgtat 540
gctgatgaat ccggcaatat caccatggac gaagaaatcg ggcctttcga aagcacttcc 600
gtagcccagg ccgttcacaa ctgtggcggt aaagtcgtcg tccaggtcaa agacgtcgtc 660
gctcacggca gcctcgaccc gcgcatggtc aagatccctg gcatctatgt cgactacgtc 720
gtcgtagcag ctccggaaga ccatcagcag acgtatgact gcgaatacga tccgtccctc 780
agcggtgaac atcgtgctcc tgaaggcgct accgatgcag ctctccccat gagcgctaag 840
aaaatcatcg gccgccgcgg cgctttggaa ttgactgaaa acgctgtcgt caacctcggc 900
gtcggtgctc cggaatacgt tgcttctgtt gccggtgaag aaggtatcgc cgataccatt 960
accctgaccg tcgaaggtgg cgccatcggt ggcgtaccgc agggcggtgc ccgcttcggt 1020
tcgtcccgca atgccgatgc catcatcgac cacacctatc agttcgactt ctacgatggc 1080
ggcggtctgg acatcgctta cctcggcctg gcccagtgcg atggctcggg caacatcaac 1140
gtcagcaagt tcggtactaa cgttgccggc tgcggcggtt tccccaacat ttcccagcag 1200
acaccgaatg tttacttctg cggcaccttc acggctggcg gcttgaaaat cgctgtcgaa 1260
gacggcaaag tcaagatcct ccaggaaggc aaagccaaga agttcatcaa agctgtcgac 1320
cagatcactt tcaacggttc ctatgcagcc cgcaacggca aacacgttct ctacatcaca 1380
gaacgctgcg tatttgaact gaccaaagaa ggcttgaaac tcatcgaagt cgcaccgggc 1440
atcgatattg aaaaagatat cctcgctcac atggacttca agccgatcat tgataatccg 1500
aaactcatgg atgcccgcct cttccaggac ggtcccatgg gactgaaaaa ataa 1554
<210>6
<211>12
<212>DNA
<213> Artificial Synthesis
<400>6
aaagaggaga aa 12
<210>7
<211>29
<212>DNA
<213> Artificial Synthesis
<400>7
ttgacagcta gctcagtcct aggtataat 29
<210>8
<211>525
<212>DNA
<213> Artificial Synthesis
<400>8
atgtctagaa tgtacacttc aggctatgca catcgttctt cgtcgttctc atccgcagca 60
agtaaaattg cgcgtgtctc tacggaaaac actacagccg ggcttatcag tgaagttgtc 120
tatcgcgaag atcagcccat gatgacgcaa cttctactgt tgccattgtt acagcaactc 180
ggtcagcaat cgcgctggca actctggtta acaccgcaac aaaaactgag tcgggaatgg 240
gttcaggcat ctgggctacc cttaacgaaa gtaatgcaga ttagccagct ctccccttgc 300
cacactgtgg agtcaatggt tcgcgcttta cgcacgggca attacagtgt ggtgatcggt 360
tggttggcag atgatttgac tgaagaagag catgctgaac ttgttgatgc ggcaaatgaa 420
ggtaacgcta tggggtttat tatgcgtccg gtaagcgcat cctctcacgc cacgagacaa 480
ctttccgggc taaaaattca ctctaatttg tatcattaac tcgag 525
<210>9
<211>813
<212>DNA
<213> Artificial Synthesis
<400>9
atggcacgca ttattgttgt tacttcgggc aaagggggtg ttggtaagac aacctccagc 60
gcggccatcg ccactggttt ggcccagaag ggaaagaaaa ctgtcgtgat agattttgat 120
atcggcctgc gtaatctcga cctgattatg ggttgtgaac gccgggtcgt ttacgatttc 180
gtcaacgtca ttcagggcga tgcaacgcta aatcaggcgt taattaaaga taagcgtact 240
gaaaatctct atattctgcc ggcatcgcaa acacgcgata aagatgccct cacccgtgaa 300
ggggtcgcca aagttcttga tgatctgaaa gcgatggatt ttgaatttat cgtttgtgac 360
tccccggcag ggattgaaac cggtgcgtta atggcactct attttgcaga cgaagccatt 420
attaccacca acccggaagt ctcctcagta cgcgactctg accgtatttt aggcattctg 480
gcgtcgaaat cacgccgcgc agaaaatggc gaagagccta ttaaagagca cctgctgtta 540
acgcgctata acccaggccg cgtaagcaga ggtgacatgc tgagcatgga agatgtgctg 600
gagatcctgc gcatcaaact cgtcggcgtg atcccagagg atcaatcagt attgcgcgcc 660
tctaaccagg gtgaaccggt cattctcgac attaacgccg atgcgggtaa agcctacgca 720
gataccgtag aacgtctgtt gggagaagaa cgtcctttcc gcttcattga agaagagaag 780
aaaggcttcc tcaaacgctt gttcggagga taa 813
<210>10
<211>267
<212>DNA
<213> Artificial Synthesis
<400>10
atggcattac tcgatttctt tctctcgcgg aagaaaaaca cagccaacat tgcaaaagaa 60
cggctgcaga ttattgttgc tgaacgccgt cgcagcgatg cagaaccgca ttatctgccg 120
cagttgcgta aagatattct tgaggtcatt tgtaaatacg tacaaattga tcctgagatg 180
gtaaccgtac agcttgagca aaaagatggc gatatttcta ttcttgagct gaacgtgacc 240
ttaccggaag cagaagagct gaaataa 267
<210>11
<211>1044
<212>DNA
<213> Artificial Synthesis
<400>11
atgttgaaaa aatttcgtgg catgttttcc aatgacttgt ccattgacct gggtactgcg 60
aataccctca tttatgtaaa aggacaaggc atcgtattga atgagccttc cgtggtggcc 120
attcgtcagg atcgtgccgg ttcaccgaaa agcgtagctg cagtaggtca tgacgcgaag 180
cagatgctgg gccgtacgcc gggcaatatt gctgccattc gcccaatgaa agacggcgtt 240
atcgccgact tcttcgtgac tgaaaaaatg ctccagcact tcatcaaaca agtgcacagc 300
aacagcttta tgcgtccaag cccgcgcgtt ctggtttgtg tgccggttgg cgcgacccag 360
gttgaacgcc gcgcaattcg tgaatccgcg cagggcgctg gtgcccgtga agtcttcctg 420
attgaagaac cgatggctgc cgcaattggt gctggcctgc cggtttctga agcgaccggt 480
tctatggtgg ttgatatcgg tggtggtacc actgaagttg ctgttatctc cttgaacggt 540
gtggtttact cctcttctgt gcgcattggt ggtgaccgtt tcgacgaagc tatcatcaac 600
tatgtgcgtc gtaattacgg ttctctgatc ggtgaagcca ccgcagaacg tatcaagcac 660
gaaatcggtt cggcttatcc gggcgatgaa gtccgtgaaa tcgaagttcg tggccgtaac 720
ctggcagaag gtgttccacg cggttttacc ctgaactcca atgaaatcct cgaagcactg 780
caggaaccgc tgaccggtat tgtgagcgcg gtaatggttg cactggaaca gtgcccgccg 840
gaactggctt ccgacatctc cgagcgcggc atggtgctca ccggtggtgg cgcactgctg 900
cgtaaccttg accgtttgtt aatggaagaa accggcattc cagtcgttgt tgctgaagac 960
ccgctgacct gtgtggcgcg cggtggcggc aaagcgctgg aaatgatcga catgcacggc 1020
ggcgacctgt tcagcgaaga gtaa 1044
Claims (10)
1. A genetically engineered bacterium, wherein, express the target gene regulating and controlling cell size and regulate the target gene of polylactic acid production; the target gene for regulating the cell size comprises a gene sulA for coding a cell division inhibitor SuaA, and the amino acid sequence of the cell division inhibitor SuaA is consistent with the amino acid sequence coded by SEQ ID NO. 1; the target gene for regulating and controlling the production of the polylactic acid comprises a gene phaA for coding ketoester-containing thiolase phaA, a gene phaB for coding acetoacetyl-CoA reductase phaB, a gene phaC for coding polyhydroxybutyrate synthase phaC and a gene pCT for coding propionyl-CoA transferase pCT; the amino acid sequence of the ketoester constitutional thiolase phaA is consistent with the amino acid sequence coded by SEQ ID NO.2, the amino acid sequence of the acetoacetyl-CoA reductase is consistent with the amino acid sequence coded by SEQ ID NO.3, the amino acid sequence of the polyhydroxybutyrate synthase is consistent with the amino acid sequence coded by SEQ ID NO.4, and the amino acid sequence of the propionyl-CoA transferase pCT is consistent with the amino acid sequence coded by SEQ ID NO. 5.
2. The genetically engineered bacterium of claim 1, wherein lactic acid producing strain GL0002 is used as a host.
3. The genetically engineered bacterium of claim 1 or 2, wherein the expression of the cell size-regulating target gene and the polylactic acid production-regulating target gene is free expression.
4. The genetically engineered bacterium of claim 3, wherein the expression vector P of the genetically engineered bacteriumJ23119-phaABC-pCT and pSC101-sulA are expression vectors.
5. A method for producing polylactic acid, which is characterized in that the genetically engineered bacterium of any one of claims 1 to 4 is used for producing polylactic acid by fermentation.
6. The method of claim 5, wherein the fermentation medium is NBS mineral salts medium.
7. The method as claimed in claim 5, wherein the fermentation conditions are 35-38 ℃, 200-600Fermenting for 70-100h at 0.04-0.1.
8. The method as claimed in claim 5, wherein the fermentation conditions are 35-38 ℃, 480-530rpm, an inoculum size of 5-10%, a liquid loading of 30-50%, a pH of 6.0-7.0, and an initial OD of strain fermentation6000.04-0.3, ventilation amount of 1-2vvm, and fermentation for 70-100 h.
9. Use of the genetically engineered bacteria of any one of claims 1 to 4 in the preparation of a protein of interest, wherein the protein of interest comprises an enzymatic protein or a non-enzymatic protein.
10. Use of the genetically engineered bacterium of any one of claims 1 to 4 in the fields of biology, pharmacy, food or chemical engineering.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911035041.3A CN110724657B (en) | 2019-10-29 | 2019-10-29 | Strategy for regulating cell morphology and improving polylactic acid production performance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911035041.3A CN110724657B (en) | 2019-10-29 | 2019-10-29 | Strategy for regulating cell morphology and improving polylactic acid production performance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110724657A true CN110724657A (en) | 2020-01-24 |
| CN110724657B CN110724657B (en) | 2022-01-11 |
Family
ID=69222410
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911035041.3A Active CN110724657B (en) | 2019-10-29 | 2019-10-29 | Strategy for regulating cell morphology and improving polylactic acid production performance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110724657B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113122563A (en) * | 2021-04-22 | 2021-07-16 | 洛阳华荣生物技术有限公司 | Method for constructing R-3-aminobutyric acid production strain |
| CN114107153A (en) * | 2021-11-26 | 2022-03-01 | 江南大学 | Recombinant bacterium for producing adipic acid, construction method and application |
| CN114196609A (en) * | 2021-12-31 | 2022-03-18 | 淮阴工学院 | Escherichia coli engineering bacterium for synthesizing pure polylactic acid from lactic acid and preparation method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101835895A (en) * | 2007-09-07 | 2010-09-15 | Lg化学株式会社 | Can produce the recombinant microorganism of poly-lactic acid ester or poly-lactic acid ester multipolymer and use this microorganism to produce the method for poly-lactic acid ester or poly-lactic acid ester multipolymer by sucrose by sucrose |
| CN102307988A (en) * | 2009-02-05 | 2012-01-04 | Lg化学株式会社 | Recombinant relastonia eutropha capable of producing polyactic acid or polylatic acid copolymer, and method for producing polyactic acid or polylatic acid copolymer using same |
| CN109295085A (en) * | 2018-10-19 | 2019-02-01 | 北京化工大学 | A kind of genetic engineering bacterium producing lactic acid and 3-hydroxybutyrate copolyesters and its construction method and application |
-
2019
- 2019-10-29 CN CN201911035041.3A patent/CN110724657B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101835895A (en) * | 2007-09-07 | 2010-09-15 | Lg化学株式会社 | Can produce the recombinant microorganism of poly-lactic acid ester or poly-lactic acid ester multipolymer and use this microorganism to produce the method for poly-lactic acid ester or poly-lactic acid ester multipolymer by sucrose by sucrose |
| CN102307988A (en) * | 2009-02-05 | 2012-01-04 | Lg化学株式会社 | Recombinant relastonia eutropha capable of producing polyactic acid or polylatic acid copolymer, and method for producing polyactic acid or polylatic acid copolymer using same |
| CN109295085A (en) * | 2018-10-19 | 2019-02-01 | 北京化工大学 | A kind of genetic engineering bacterium producing lactic acid and 3-hydroxybutyrate copolyesters and its construction method and application |
Non-Patent Citations (4)
| Title |
|---|
| LIANG GUO等: "Enhancement of malate production through engineering of the periplasmic rTCA pathway in Escherichia coli", 《BIOTECHNOLOGY AND BIOENGINEERING》 * |
| YU KYUNG JUNG等: "Metabolic Engineering of Escherichia coli for the Production of Polylactic Acid and Its Copolymers", 《BIOTECHNOLOGY AND BIOENGINEERING》 * |
| 刘鹏等: "基因工程菌生产D-乳酸研究进展", 《现代化工》 * |
| 时梦询: "基于工程大肠杆菌的聚乳酸生物合成途径研究", 《中国优秀硕士学位论文全文数据库 工程科技I辑》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113122563A (en) * | 2021-04-22 | 2021-07-16 | 洛阳华荣生物技术有限公司 | Method for constructing R-3-aminobutyric acid production strain |
| CN113122563B (en) * | 2021-04-22 | 2023-12-08 | 洛阳华荣生物技术有限公司 | Method for constructing R-3-aminobutyric acid producing bacteria |
| CN114107153A (en) * | 2021-11-26 | 2022-03-01 | 江南大学 | Recombinant bacterium for producing adipic acid, construction method and application |
| CN114196609A (en) * | 2021-12-31 | 2022-03-18 | 淮阴工学院 | Escherichia coli engineering bacterium for synthesizing pure polylactic acid from lactic acid and preparation method and application thereof |
| CN114196609B (en) * | 2021-12-31 | 2023-06-23 | 淮阴工学院 | Escherichia coli engineering bacteria for synthesizing pure polylactic acid from lactic acid, and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110724657B (en) | 2022-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110724657B (en) | Strategy for regulating cell morphology and improving polylactic acid production performance | |
| Schiraldi et al. | Perspectives on biotechnological applications of archaea | |
| CN102869783B (en) | Psicose-epimerization enzyme immobilizatio and use described psicose-epimerase to prepare the method for D-Psicose | |
| CN110904140B (en) | Protein dynamic expression regulation system and application thereof in shikimic acid production | |
| Marques et al. | Combined engineering of disaccharide transport and phosphorolysis for enhanced ATP yield from sucrose fermentation in Saccharomyces cerevisiae | |
| CN106834200A (en) | A kind of method for improving adipic acid yield in Escherichia coli | |
| CN112359005B (en) | Escherichia coli engineering bacterium with improved acid stress capability and application thereof | |
| CN106754985A (en) | Encode gene and its application of glutamine dipeptide biosynthetic enzyme | |
| US11773383B2 (en) | Methods for promoting extracellular expression of proteins in Bacillus subtilis using a cutinase | |
| CN101463358A (en) | Nitrile hydratase gene cluster and use thereof | |
| CN108866117B (en) | Method for synthesizing 3-hydroxypropionic acid by using photosynthetic bacteria, corresponding recombinant cell and application thereof | |
| CN103451201B (en) | Extreme halophilic archaea engineering bacteria for producing bioplastics PHBV by effectively utilizing carbon source | |
| CN112391329B (en) | Escherichia coli engineering bacteria with improved acid stress resistance and application thereof | |
| CN112708569B (en) | Yeast engineering bacterium for producing chondroitin sulfate by fermentation and application thereof | |
| EP4029946A1 (en) | Transformed microorganism, and method for producing polyhydroxyalkanoic acid using said microorganism | |
| CN110343654B (en) | Genetic engineering bacterium for producing sucrose phosphorylase | |
| CN104673814A (en) | L-threonine aldolase from enterobacter cloacae and application thereof | |
| CN112391330B (en) | Method for improving acid stress resistance of recombinant escherichia coli | |
| CN109913515A (en) | A method of it improving bacillus glycerol metabolism and increases Polyurethane-epoxy resin yield | |
| CN107988290A (en) | A kind of biological method for improving glutathione cumulant | |
| CN112708571A (en) | Recombinant yeast for producing chondroitin sulfate with controllable molecular weight by fermentation and application thereof | |
| CN114746548A (en) | Nucleic acids, vectors, host cells and methods for producing fructosyltransferase from aspergillus japonicus | |
| CN112391331B (en) | Recombinant escherichia coli for overexpression of GatA gene and application thereof | |
| CN109022471A (en) | Produce the escherichia expression system of oxalate oxidase, the production method and its application of oxalate oxidase | |
| CN112143690B (en) | Recombinant bacterium with improved acid tolerance, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |