CN103451201B - Extreme halophilic archaea engineering bacteria for producing bioplastics PHBV by effectively utilizing carbon source - Google Patents
Extreme halophilic archaea engineering bacteria for producing bioplastics PHBV by effectively utilizing carbon source Download PDFInfo
- Publication number
- CN103451201B CN103451201B CN201210181052.4A CN201210181052A CN103451201B CN 103451201 B CN103451201 B CN 103451201B CN 201210181052 A CN201210181052 A CN 201210181052A CN 103451201 B CN103451201 B CN 103451201B
- Authority
- CN
- China
- Prior art keywords
- grams per
- per liter
- sequence
- liter
- sodium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses extreme halophilic archaea engineering bacteria for producing bioplastics PHBV (Poly-(HydroxyButyrate-co-Hydroxy Valerate)) by effectively utilizing a carbon source. The recombined extreme halophilic archaea is extracellular polysaccharide synthesis function-deficient engineering bacteria obtained by deleting at least one protein function expressed by an extracellular polysaccharide synthesis cluster in the genome of the extreme halophilic archaea Haloferax mediterranei. The extreme halophilic archaea has the advantages that infectious microbe is not easy to pollute, PHA (Poly Hydroxy Alkanoate) is convenient to extract, the PHBV from a non-correlated carbon source can be synthesized, and the like, and is considered as a highly preponderant PHBV producing strain. The extracellular polysaccharide synthesis function-deficient strain engineering bacteria are characterized in that the polyhydroxyalkanoate can be produced from various carbon sources such as glucose, starch and whey more efficiently in contrast with a wild type strain, the concentration of the PHBV is 20% higher than that of the wild type strain under the same fermentation conditions, and the problems such as sticking, lots of bubbles and dissolved oxygen reduction of a culture solution caused by extracellular polysaccharide accumulation are also solved.
Description
Technical field
The present invention relates to a kind of extremely halophilic archaea engineering bacteria producing polyhydroxyalkanoate PHBV.
Background technology
Polyhydroxyalkanoate be a class by microorganism macromolecule polyester at cell cylinder accumulation when nutrition is unbalanced, the reserve as carbon source and the energy is extensively present in nature.Because it has thermoplasticity, biodegradability and bio-compatibility, PHA is generally considered the potential surrogate causing the petrochemical industry of white pollution to derive plastics, can be applied to and comprise articles for daily use (such as plastics bag, container) and biomedical material (such as artificial blood vessel, drug release carrier) in interior multiple fields, and more and more receive the concern of scientific circles and business circles.
At present, mainly PHB, PHBV and P3HB4HB that PHA industrialization is produced is realized in bacterium.PHB is similar with thermoplastics in some performance, mechanical property and polypropylene (PP) similar.Coli strain VG1(pTU14 through genetic engineering modified) utilize cheap amylum hydrolysate of the sugar to do carbon source, feeding culture 60 hours in batches, bacteria concentration can reach 216 grams per liters, and PHB reaches 90% of dry cell weight at endobacillary accumulation volume.In addition, the process LAN of oxyphorase, improves the ability taking the photograph oxygen and resistance to low dissolved oxygen of thalline; Utilize the controlled inducing cell lysis of lysis genes, discharge intracellular PHB.But the shortcoming of the easy jackknifing of PHB but limits its range of application.In PHB, mix other monomers (as hydroxypentanoic acid) can reduce its intensity and hardness, materialogy performance has had significant improvement; But the interpolation of producing the precursors such as propionic acid in PHBV process greatly improves production cost.
PHBV is the multipolymer of hydroxybutyric acid and hydroxypentanoic acid, although genetic engineering modified intestinal bacteria also can synthesize PHBV, along with the content of the increase PHBV of hydroxypentanoic acid component also reduces gradually by irrelevant carbon source; The molar content of hydroxypentanoic acid component can reach 17.5%, but its PHBV content only accounts for about 12% of dry cell weight.P3HB4HB has been subjected to very large concern as a kind of new PHA material and has carried out suitability for industrialized production.Add Isosorbide-5-Nitrae butyleneglycol or gama-butyrolactone during the fermentation, will accumulate P3HB4HB in cell paste, the molar percentage wherein shared by 4HB can be controlled in 0-40%.
Extremely halophilic archaea is the extreme microorganism that a class relies on high osmotic pressure ambient growth, and its production bacterial strain as PHA has unique advantage: the growing environment that height oozes can simplify sterilization process and even not use sterilizing; The dependence of height being oozed to environment makes thalline be very easy to cracking in clear water, thus makes the extraction of PHA safe, easy.And the rich salt bacterium in Mediterranean Sea is due to its growth velocity, and comparatively other extremely halophilic archaeas are fast, the several kinds of carbon source such as starch, whey can be utilized, most suitable PHA in extremely halophilic archaea can be become by advantages such as irrelevant carbon source synthesis PHBV and produce bacterial classification.1986, the rich salt bacterium in Mediterranean Sea was in the news and can accumulates PHA; Nineteen ninety, Lillo is optimized the component of substratum and culture condition.Along with the PHA of its accumulation is confirmed as PHBV (molar percentage of hydroxypentanoic acid component is minimum is 10.7%), the rich salt bacterium in Mediterranean Sea receives again the concern of people gradually.With process after starch and rice bran (1:8g/g) for carbon source, optimization for fermentation technology, cultivate about 120 hours, PHBV concentration reaches 77.8 grams per liters.Although saved the cost of carbon source to a certain extent, owing to taking yeast extract as nitrogenous source, pass into pure oxygen simultaneously, added the total cost of production on the contrary.Our laboratory is attempting using cheap starch and ammonium chloride to do Carbon and nitrogen sources respectively, is optimized when only passing into air to the production of PHBV simultaneously.
Rich salt bacterium can produce multiple byproduct, as exocellular polysaccharide in PHBV fermentation production process in Mediterranean Sea.The synthesis of exocellular polysaccharide and accumulation not only cause unnecessary carbon source waste, and can produce some side effects to production, comprise improve nutrient solution viscosity, add foam number, reduce dissolved oxygen.Research for the rich salt bacterium exopolysaccharide in Mediterranean Sea is only limitted to its Optimizing manufacture, physico-chemical property, physiological function and composition structure at present, and does not report at genetic level.Consider that the synthesis of exocellular polysaccharide is more similar with the working condition of PHBV, therefore be required at genetic level to bacterial strain transformation.
Summary of the invention
The object of this invention is to provide the recombinant extremely halophilic archaea that a kind of efficiency utilization carbon source produces the transposon mutagenesis afunction of polyhydroxyalkanoate PHBV, and the gene cluster that a kind of extremely halophilic archaea transposon mutagenesis is relevant.
The gene cluster that extremely halophilic archaea transposon mutagenesis provided by the invention is relevant, name is called eps, derive from Mediterranean Sea rich salt bacterium Haloferax mediterranei, its deposit number is CGMCC 1.2087, and protein of its coding is following 1)-4) described in albumen:
1) protein be made up of the amino acid residue sequence shown in sequence in sequence table 2, or the amino acid residue sequence of sequence in sequence table 2 is had the protein with the identical activity of albumen shown in sequence 2 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation;
With, 2) protein be made up of the amino acid residue sequence shown in sequence in sequence table 3, or the amino acid residue sequence of sequence in sequence table 3 is had the protein with the identical activity of albumen shown in sequence 3 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation;
With, 3) protein be made up of the amino acid residue sequence shown in sequence in sequence table 4, or the amino acid residue sequence of sequence in sequence table 4 is had the protein with the identical activity of albumen shown in sequence 4 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation;
With, 4) protein be made up of the amino acid residue sequence shown in sequence in sequence table 5, or the amino acid residue sequence of sequence in sequence table 5 is had the protein with the identical activity of albumen shown in sequence 5 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation.
The sequence of described gene cluster is one of following deoxynucleotide:
1) in sequence table shown in sequence 1 from 5 ' end 547-5762 position nucleotide sequence;
2) DNA sequence dna shown in sequence 1 in sequence table;
3) nucleotide sequence that the DNA sequence dna that can limit with sequence in sequence table 1 is under strict conditions hybridized.
4) with 1), 2) or 3) DNA sequence dna that limits has more than 90% homology, and coding identical function protein DNA sequence.
The key gene bunch of this extremely halophilic archaea transposon mutagenesis comprises a promotor and a coding region.In sequence 1,547-857 position Nucleotide is promoter region, and 858-5762 position Nucleotide is coding region.
Described coding region can give expression to four kinds of protein in translation skill, and the numbering in genome is followed successively by HFX2145-2148.In sequence 1,858-2228 position Nucleotide is the coding region of HFX2145, and its aminoacid sequence is as shown in sequence 2; In sequence 1,2228-3286 position Nucleotide is the coding region of HFX2146, and its aminoacid sequence is as shown in sequence 3; In sequence 1,3283-4308 position Nucleotide is the coding region of HFX2147, and its aminoacid sequence is as shown in sequence 4; In sequence 1,4305-5762 position Nucleotide is the coding region of HFX2148, and its aminoacid sequence is as shown in sequence 5.Predict the function of four kinds of protein successively: UDP-N-acetylglucosamine-6-desaturase, dolichol phosphoric acid-mannose transferase, containing glycosyltransferase 4-similar domain albumen, and polysaccharide synthesis translocator.
The primer pair of amplification said gene bunch also belongs to protection scope of the present invention.
Second object of the present invention is to provide the recombinant extremely halophilic archaea engineering bacteria that a class efficiency utilization carbon source produces polyhydroxyalkanoate.
Recombinant extremely halophilic archaea provided by the present invention is at least one protein function disappearance above-mentioned gene cluster of setting out in the genome of extremely halophilic archaea expressed, the engineering bacteria of the transposon mutagenesis afunction of acquisition.
Namely at least one protein function disappearance said gene bunch expressed can make the afunction of the key gene bunch of this extremely halophilic archaea transposon mutagenesis, thus can cause transposon mutagenesis defect.
The described method lacked by least one protein function of the expression of the gene cluster of the above-mentioned transposon mutagenesis function of setting out in the genome of extremely halophilic archaea is or/and gene knockout and/or gene silencing by the transgenation of described afunction albumen of encoding in described gene cluster; Preferably by the sudden change of the gene cluster of transposon mutagenesis function or/and the expression of the gene of gene knockout and/or gene silencing and/or the described afunction albumen of RNA interference coding.
The key gene bunch of this extremely halophilic archaea transposon mutagenesis can recover the transposon mutagenesis ability of above-mentioned transposon mutagenesis defect bacterial strain by methods such as plasmid or ex situ homologous recombination.
The described extremely halophilic archaea that sets out is Mediterranean Sea rich salt bacterium Haloferax mediterranei; Be preferably Mediterranean Sea rich salt bacterium Haloferax mediterranei CGMCC 1.2087.
Described gene knockout is realized by homologous recombination; The sequence of the upstream exchange arm that described homologous recombination is used is that 5 ' of sequence 1 in sequence table holds 1-865 position nucleotide sequence; The sequence of the downstream exchange arm that described homologous recombination is used is that 5 ' of sequence 1 in sequence table holds 5763-6282 position nucleotide sequence.
And/or, the described extremely halophilic archaea that sets out is before gene cluster described in gene knockout, first knocking out in its genome sequence as 5 ' of sequence in sequence table 6 holds 810-1607 position nucleotide sequence fragment (pyrF gene) to obtain uridylic synthesis deficient strain, knocking out of described gene cluster is carried out as starting strain again using described uracil-deficient type bacterial strain, obtain the transposon mutagenesis deficient strain of uridylic synthesis defect, finally, the 810-1607 position nucleotide sequence fragment original position of sequence in sequence table 6 is struck back, obtain the engineering bacteria of the uridylic complex functionality transposon mutagenesis afunction identical with the described extremely halophilic archaea that sets out.
It is the strain of uridylic synthesis defect that pyrF knocks out strain, utilizes this bacterial strain can do gene knockout experiment more quickly and efficiently, so set out with the strain of uridylic synthesis defect; And owing to being the strain of uridylic synthesis defect, in production, need to add external source uridylic as PHA production bacterial strain, so need pyrF gene original position to cover, in fact, the pyrF site after covering is identical with wild-type; Therefore, the engineering strain that obtains of the method with directly knock out the said gene bunch protein coding gene of expressing with wild-type extremely halophilic archaea or directly knock out the effect of the engineering strain that described gene cluster obtains consistent.
Above-mentioned recombinant extremely halophilic archaea can be used for producing polyhydroxyalkanoate (PHBV).The product polyhydroxyalkanoate (PHBV) that the above-mentioned recombinant extremely halophilic archaea of such transposon mutagenesis defect strain is produced is still the 3-hydroxybutyrate (3HB) and 3-hydroxypentanoic acid (3HV) multipolymer (PHBV) that just can be synthesized by irrelevant carbon source.
The described method producing polyhydroxyalkanoate, is the recombinant extremely halophilic archaea described in fermentation, obtains the somatic cells containing polyhydroxyalkanoate; Described fermentation is carried out in fermentor tank, temperature 32-45 DEG C, air flow 1: 1-2:1vvm, and stir the change manual regulation with dissolved oxygen, pH maintains 6.5-7.5, and in tank body, pressure is 1 normal atmosphere.Described leavening temperature is for being preferably 37 DEG C.
The component of described fermentation substratum is sodium-chlor 110-220 grams per liter, magnesium chloride 0-10 grams per liter, magnesium sulfate 2-20 grams per liter, Repone K 1-5 grams per liter, calcium chloride 0-1 grams per liter, sodium bicarbonate 0-0.3 grams per liter, Sodium Bromide 0-0.5 grams per liter, yeast extract 0-10 grams per liter, ammonium chloride 1-5 grams per liter, potassium primary phosphate 0.02-4 grams per liter, starch 10-50 grams per liter, ferric ammonium citrate 0.005-0.01 grams per liter, trace element solution SL-6 0.5-2 milliliter/liter; PH value is 6.5-7.5; The component of described fermentation substratum is preferably sodium-chlor 110 grams per liter, magnesium chloride 9.6 grams per liter, magnesium sulfate 14.4 grams per liter, Repone K 5 grams per liter, calcium chloride 1 grams per liter, sodium bicarbonate 0.2 grams per liter, Sodium Bromide 0.375 grams per liter, yeast extract 3 grams per liter, ammonium chloride 2 grams per liter, potassium primary phosphate 0.0375 grams per liter, starch 20 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter; Various component and the content thereof of described trace element solution SL-6 are: Zinc vitriol 1 grams per liter, four chloride hydrate manganese 0.3 grams per liters, boric acid 3 grams per liter, cobalt chloride hexahydrate 2 grams per liter, Copper dichloride dihydrate 0.1 grams per liter, Nickel dichloride hexahydrate 0.2 grams per liter, molybdic acid hydrate sodium 0.3 grams per liter; The pH hydrochloric acid soln of described trace element solution is adjusted to 3-4.
Carry out seed culture wherein before the method for described production polyhydroxyalkanoate is also included in fermentation, each component of described seed culture medium and concentration thereof are:
Acid hydrolysis casein 5-10 grams per liter, yeast extract 5-10 grams per liter, Sodium Glutamate 1-2 grams per liter, trisodium citrate 3-6 grams per liter, sodium-chlor 110-220 grams per liter, magnesium chloride 0-9.6 grams per liter, magnesium sulfate 2-30 grams per liter, Repone K 1-5 grams per liter, ferric ammonium citrate 0.005-0.01 grams per liter, trace element solution SL-6 0.5-1 milliliter/liter.PH regulator is to 6.5-7.5.
Described seed culture is divided into two-stage seed culture; The method of described seed culture is inoculated in primary-seed medium by described recombinant extremely halophilic archaea mono-clonal, cultivate for 37 DEG C and obtain first order seed nutrient solution in 3 days, then be in the inoculum size access secondary seed medium of 2% with volumn concentration by first order seed nutrient solution, cultivate for 37 DEG C and obtain secondary seed nutrient solution in 3 days.
Each component of primary-seed medium and concentration thereof are:
Acid hydrolysis casein 5 grams per liter, yeast extract 5 grams per liter, Sodium Glutamate 1 grams per liter, trisodium citrate 3 grams per liter, sodium-chlor 200 grams per liter, bitter salt 20 grams per liter, Repone K 2 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter.
The pH of described primary-seed medium is 7.0-7.2.
Each component of secondary seed medium and concentration thereof are:
Acid hydrolysis casein 10 grams per liter, yeast extract 10 grams per liter, Sodium Glutamate 2 grams per liter, trisodium citrate 6 grams per liter, sodium-chlor 200 grams per liter, bitter salt 20 grams per liter, Repone K 2 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter.The pH of described secondary seed medium is 7.0-7.2.
In described fermenting process, if needed, supplemented medium can be added.
Each component of described supplemented medium and concentration thereof are:
Sodium-chlor 110-220 grams per liter, magnesium chloride 0-10 grams per liter, magnesium sulfate 0-20 grams per liter, Repone K 0-5 grams per liter, calcium chloride 0-1 grams per liter, sodium bicarbonate 0-0.3 grams per liter, Sodium Bromide 0-0.5 grams per liter, yeast extract 0-10 grams per liter, ammonium chloride 10-100 grams per liter, potassium primary phosphate 0-1 grams per liter, starch 200-500 grams per liter, ferric ammonium citrate 0-0.01 grams per liter, trace element solution SL-6 0-1 milliliter/liter.
During described fermentation, described secondary seed nutrient solution is inoculated in described fermention medium, the inoculum size of secondary seed nutrient solution to be volume percent be 10% amount be inoculated in described fermention medium.
The extremely halophilic archaea engineering bacteria that this kind of efficiency utilization carbon source provided by the invention produces polyhydroxyalkanoate is the rich salt bacterium in Mediterranean Sea being achieved afunction by the genetically engineered key gene to transposon mutagenesis bunch, is the strain of transposon mutagenesis defect.
Such transposon mutagenesis defect strain is due to the afunction of the key gene bunch of transposon mutagenesis, no longer there is the ability of synthesis and secretion exocellular polysaccharide, thus avoid the waste of carbon source, solve simultaneously exocellular polysaccharide accumulate the nutrient solution caused become sticky, in a large number bubble and dissolved oxygen under degradation problem.
Utilize this kind of efficiency utilization carbon source provided by the invention to produce the extremely halophilic archaea engineering bacteria of polyhydroxyalkanoate PHBV, under identical working condition, the concentration ratio wild type strain of polyhydroxyalkanoate PHBV improves more than 20%; Solve simultaneously exocellular polysaccharide accumulate the nutrient solution caused become sticky, in a large number bubble and dissolved oxygen under degradation problem.Utilize poly-hydroxy fatty acid production method provided by the invention, ferment 72 hours, the concentration of polyhydroxyalkanoate PHBV can reach 21.28 grams per liters.
Accompanying drawing explanation
Fig. 1 is transposon mutagenesis key gene bunch and the structure iron of upstream and downstream sequence thereof and the functional annotation of prediction thereof; In figure, HFX2145 forecast function is UDP-N-acetylglucosamine-6-desaturase; HFX2146 forecast function is dolichol phosphoric acid-mannose transferase; The forecast function of HFX2147 is for containing glycosyltransferase 4-similar domain albumen; The forecast function of HFX2148 is polysaccharide synthesis translocator.
Fig. 2 is the structure iron of pyrF gene and upstream and downstream sequence thereof
Fig. 3 is the colonial morphology (in Fig. 3 A) comparing each bacterial strain, mannose group component (in Fig. 3 C) in exocellular polysaccharide content (in Fig. 3 B) and exocellular polysaccharide sample, in figure, (I is Haloferax mediterranei Δ pyrF, II is Haloferax mediterranei Δ pyrF Δ eps, III is Haloferax mediterranei Δ pyrF Δ eps::pWL502-eps, IV is Haloferax mediterranei Δ pyrF Δ eps::pWL502, V is Haloferaxmediterranei CGMCC 1.2087, VI is Haloferax mediterranei ES1).
Fig. 4 compares transposon mutagenesis key gene bunch to knock out the real cell quality of strain and wild type strain, PHBV concentration and total sugar concentration, in figure, WT is Haloferax mediterranei CGMCC 1.2087, ES1 is Haloferaxmediterranei ES1.
Embodiment
In following embodiment, if no special instructions, ordinary method is.
Percentage composition in following embodiment, if no special instructions, is mass percentage
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Mediterranean Sea rich salt bacterium Haloferax mediterranei CGMCC 1.2087 is purchased from China General Microbiological DSMZ (CGMCC).
Gene knockout and knock in the uridylic synthesis deletion mycopremna that the pyrF gene (in sequence 65 ' holds 810-1607 position nucleotide sequence) in Mediterranean Sea rich salt bacterium Haloferax mediterranei CGMCC 1.2087 is knocked out rear acquisition by used bacterial strain Mediterranean Sea rich salt bacterium Haloferax mediterranei Δ pyrF(, improve to facilitate examination and knock out efficiency), knock out the carrier pHFX(that sets out and contain pyrF gene), screening culture medium and relative theory and method are at document (Liu, H., J.Han, et al. (2011). " Development of pyrF-based gene knockout systemsfor genome-wide manipulation of the archaea Haloferax mediterranei and Haloarculahispanica. "
journal of Genetics and Genomics38 (6): 261-269.) open, the public can obtain from Institute of Microorganism, Academia Sinica.
Gene covers the plasmid vector pWL502 that uses at document (Cai, S., L.Cai, et al. (2012). " Identification of the Haloarchaeal Phasin (PhaP) That Functions in PolyhydroxyalkanoateAccumulation and Granule Formation in Haloferax mediterranei. "
applied and environmental Microbiology78 (6): 1946-1952.) be disclosed in, the public can obtain from Institute of Microorganism, Academia Sinica.
The determination of embodiment 1, transposon mutagenesis key gene bunch and the acquisition of gene thereof
Based on whole genome sequence and the annotation of the rich salt bacterium in Mediterranean Sea, summarize whole glycosyltransferase.By analysis, gene HFX2145-2148 is considered to the key gene bunch (eps) of possible transposon mutagenesis.These four genes may share a promotor, wherein, HFX2145 relates to the biosynthesizing of precursor substance UDP-N-acetyl glucosamine amino acid, and HFX2146, HFX2147 relate to glycosyl and be transferred to plasma membrane carrier dolichol phosphoric acid successively, and HFX2148 relates to the transmembrane transport of three sugar monomers.The structure of these four encoding genes and the arrangement relation of upstream and downstream gene are as shown in Figure 1.
Design pair of primers epsF1/epsR1 is used for carrying out pcr amplification to the nucleotide sequence of the key gene bunch (eps) comprising transposon mutagenesis, and primer sequence is as follows:
EpsF1:5 '-
gCTCTAGAcATCGCTTTGGGTCG-3 ' (
xba I) (holding 544-558 to mate with the 5' from sequence 1)
EpsR1:5 '-CATG
cCATGGcGGTACAGACCCTTTCA-3 ' (
nco I) (holding 5796-5812 to mate with the 5' from sequence 1)
With the genome of Mediterranean Sea rich salt bacterium Haloferax mediterranei CGMCC 1.2087 for template, increase with primer pair epsF1/epsR1, obtain the PCR primer of 5269bp length.
Pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 68 DEG C of 330s carry out 30 circulations; 68 DEG C extend 7min.Amplification system is 25 μ l.
Spend the night connecting with T4DNA ligase enzyme 16 DEG C through the PCR primer of restriction enzyme Xba I and Nco I double digestion and vector plasmid pWL502, then heat-shock transformed method will connect product conversion e. coli jm109 competence, at the enterprising row filter of the flat board containing amicillin resistance, the positive colony of acquisition is checked order.By the above-mentioned pWL502 recombinant plasmid called after pWL502-eps containing PCR primer correct for qualification.
Sequencing result shows that the nucleotide sequence inserted in plasmid pWL502 is as shown in 544-5812 position Nucleotide in sequence 1, wherein 547-5762 position Nucleotide is the key gene bunch eps of transposon mutagenesis, 547-857 position Nucleotide is the promoter region of gene cluster, and 858-5762 position Nucleotide is the coding region of gene cluster; Coding region comprises 4 genes, and the numbering in genome is followed successively by HFX2145-2148.5' 858-2228 position Nucleotide in sequence 1 is the coding region of HFX2145, and the aminoacid sequence of its coding is as shown in sequence 2; Be the coding region of HFX2146 from the 5' 2228-3286 position Nucleotide of sequence 1, aminoacid sequence of its coding is as shown in sequence 3; Be the coding region of HFX2147 from the 5' 3283-4308 position Nucleotide of sequence 1, aminoacid sequence of its coding is as shown in sequence 4; Be the coding region of HFX2148 from the 5' 4305-5762 position Nucleotide of sequence 1, aminoacid sequence of its coding is as shown in sequence 5.
The qualification of embodiment 2, transposon mutagenesis key gene bunch eps function
Utilize genetic engineering technique knock out eps and cover, verify that it is that transposon mutagenesis is necessary by genetic method.
1, the transposon mutagenesis key gene bunch (eps) of uridylic synthesis defect knocks out the structure of strain
Utilize the genetic operating system based on pyrF gene, the structure iron of pyrF gene and upstream and downstream sequence thereof as shown in Figure 2, be for starting strain with Mediterranean Sea rich salt bacterium Haloferax mediterranei CGMCC 1.2087 with Haloferax mediterranei Δ pyrF(Haloferax mediterranei Δ pyrF, knock out the uridylic synthesis defect bacterial strain that pyrF gene obtains, to facilitate the screening of gene knockout and covering, improve the efficiency knocked out; Liu, H., J.Han, et al. (2011). " Development of pyrF-based gene knockout systems for genome-wide manipulationof the archaea Haloferax mediterranei and Haloarcula hispanica. "
journal of Genetics and genomics38 (6): 261-269.) be starting strain, the eps building uridylic synthesis defect knocks out strain.First build the integrated plasmid pHFX-Δ eps for knocking out eps, then change and homologous recombination double exchange through homologous recombination single cross successively, screen the bacterial strain obtained and verify, namely obtain object bacterial strain, concrete steps are as follows:
1) structure of the integrated plasmid pHFX-Δ eps of eps is knocked out
According to eps coding region in sequence 1 and upstream and downstream nucleotide sequence thereof, devise amplimer epsF2/epsR2 and epsF3/epsR3 of upstream and downstream exchange arm respectively:
EpsF2:5 '-AA
cTGCAGgAGTGGGTGGTCCTGAAT-3 ' (
pst I) (holding 1-18 to mate with the 5' from sequence 1)
EpsR2:5 '-
tAGTGACAGGTtCAACCACAGGCACGACA-3 ' (
11bp is had with epsF2 the identical sequence of length) (holding 848-865 to mate with the 5' from sequence 1)
EpsF3:5 '-
cCTGTGGTTGAaCCTGTCACTAGTACAATA-3 ' (
11bp is had with epsR1 the identical sequence of length) (holding 5763-5781 to mate with the 5' from sequence 1)
EpsR3:5 '-GG
gGTACCtTCCATAAACAACCAC-3 ' (
kpn I) (holding 6267-6282 to mate with the 5' from sequence 1)
With the genome of Mediterranean Sea rich salt bacterium Haloferax mediterranei CGMCC 1.2087 for template, the upstream exchange arm 865bp(sequence knocking out eps with primer pair epsF2 and epsR2 amplification is that 5 ' of sequence 1 in sequence table holds 1-865 position nucleotide sequence).Pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 68 DEG C of 60s carry out 30 circulations; 68 DEG C extend 7min.Amplification system is 25 μ l.
With the genome of Haloferax mediterranei CGMCC 1.2087 for template, the downstream exchange arm 520bp(sequence knocking out eps with primer pair epsF3 and epsR3 amplification is that 5 ' of sequence 1 in sequence table holds 5763-6282 position nucleotide sequence).Pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 68 DEG C of 60s carry out 30 circulations; 68 DEG C extend 7min.Amplification system is 25 μ l.
With the upstream and downstream exchange arm product after reclaiming for template, be that upstream and downstream primer carries out linkings PCR with primer pair epsF2 and epsR3, by epsR2 with epsF3 overlapping partial sequence upstream and downstream exchange arm connected together and realize increasing.This fragment is named as Δ eps, and length is 1385bp.Pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 68 DEG C of 90s carry out 30 circulations; 68 DEG C extend 7min.Amplification system is 25 μ l.
By through the PCR primer Δ eps of restriction enzyme Pst I and Kpn I double digestion and vector plasmid pHFX(Liu, H., J.Han, et al. (2011). " Development of pyrF-based gene knockout systems forgenome-wide manipulation of the archaea Haloferax mediterranei and Haloarculahispanica. "
journal of Genetics and Genomics38 (6): 261-269.) connect with T4DNA ligase enzyme 16 DEG C and spend the night, then heat-shock transformed method will connect product conversion e. coli jm109 competence, at the enterprising row filter of the flat board containing amicillin resistance, the positive colony of acquisition is checked order.The integrated plasmid called after pHFX-Δ eps containing Δ eps will be shown through order-checking.
2) structure of bacterial strain, screening and checking are changed in single cross
Adopt the method for transformation of PEG mediation, integrated plasmid pHFX-Δ eps is transformed Haloferax mediterranei Δ pyrF, coat the various component of screening culture medium AS-168SY described in screening culture medium AS-168SY(after conversion and content is: acid hydrolysis casein 5.0g/L, Sodium Glutamate 1.0g/L, Trisodium Citrate 3.0g/L, NaCl 200g/L, MgSO
47H
2o 20g/L, KCl 2.0g/L, FeSO
47H
2o 0.36g/L, MnCl
24H
2o 0.36mg/L; The pH value of described screening culture medium AS-168SY is 7.1) solid plate, cultivate about 4 days for 37 DEG C.Can the mono-clonal of normal growth be that bacterial strain is changed in single cross on this solid medium.
The checking of bacterial strain is changed in single cross:
According to eps encoding sequence in sequence 1, design amplimer epsF4 and epsR4(604bp being positioned at eps inside for a pair), carry out PCR checking for changing bacterial strain to single cross:
EpsF4:5 '-ATTATCCTACTTACACCCAAAC-3 ' (holding 3735-3756 to mate with the 5' from sequence 1)
EpsR4:5 '-TTGAAGCTAAATCCGTGA-3 ' (holding 4321-4338 to mate with the 5' from sequence 1)
Change the genome of bacterial strain with single cross to be verified for template, carry out PCR reaction with primer pair epsF2 and epsR3 and primer pair epsF4 and epsR4 respectively, pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 90s carry out 30 circulations; 72 DEG C extend 7min.Amplification system is 25 μ l.If the two pairs of primers can amplify the fragment (i.e. epsF2 and epsR3 can amplify the fragment of 1385bp length and epsF4 and epsR4 can amplify the fragment of 604bp length) of corresponding size, then prove that this bacterial strain is that bacterial strain is changed in single cross.
3) structure of double exchange bacterial strain, screening and checking
By step 2) single cross that screens changes bacterial strain and adds Secondary Culture 50 generation in the screening culture medium AS-168SY of the uridylic of final concentration 50 mcg/ml at liquid, by nutrient solution dilution 10
7coat the screening culture medium AS-168SY solid plate adding final concentration 50 mcg/ml uridylic and 250 mcg/ml 5-FOA, cultivate about 4 days for 37 DEG C.Picking mono-clonal lines the screening culture medium AS-168SY solid plate adding final concentration 50 mcg/ml uridylic and 250 mcg/ml 5-FOA, and on this solid plate, the mono-clonal of energy normal growth is double exchange bacterial strain.
Double exchange host strains:
With the genome of double exchange bacterial strain to be verified for template, carry out PCR reaction with primer pair epsF2/epsR3 and epsF4/epsR4 respectively, pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 90s carry out 30 circulations; 72 DEG C extend 7min.Amplification system is 25 μ l.If epsF2 and epsR3 can amplify the fragment of 1385bp length, and epsF4 and epsR4 can not amplify the fragment of 604bp length, then prove that this bacterial strain is double exchange bacterial strain.
The eps that the double exchange bacterial strain of empirical tests is uridylic synthesis defect knocks out strain, is named as Haloferaxmediterranei Δ pyrF Δ eps.
2, a key gene bunch eps for transposon mutagenesis covers via plasmid
Eps is covered as the plasmid pWL502 with self-replicating ability of screening-gene via pyrF, the function of checking eps.First build the integrated plasmid pWL502-eps for covering eps, the eps being transformed into uridylic synthesis defect knocks out in strain Haloferax mediterranei Δ pyrF Δ eps, and through screening and checking, namely obtain object bacterial strain, concrete steps are as follows:
1) structure of the integrated plasmid pWL502-eps of eps is covered
Show the integrated plasmid called after pWL502-eps containing eps by embodiment 1 through order-checking, namely this integrated plasmid can be used for the covering of eps.
2) structure and the screening of bacterial strain is covered
Adopt the method for transformation of PEG mediation, integrated plasmid pWL502-eps is transformed Haloferax mediterranei Δ pyrF Δ eps, coat screening culture medium AS-168SY solid plate after conversion, cultivate about 4 days for 37 DEG C.On this solid medium, the mono-clonal of energy normal growth is covering bacterial strain.Covering Strain Designation is Haloferaxmediterranei Δ pyrF Δ eps::pWL502-eps.
As the contrast of covering experiment, empty plasmid pWL502 transforms Haloferax mediterranei Δ pyrF Δ eps, coats screening culture medium AS-168SY solid plate, cultivate about 4 days for 37 DEG C after conversion.On this solid medium, the mono-clonal of energy normal growth is covering control strain.Covering control strain called after Haloferax mediterranei Δ pyrF Δ eps::pWL502.
3, the detection of transposon mutagenesis ability
Determine whether bacterial strain to be detected has the ability of transposon mutagenesis by these three aspects of detection of the observation of colonial morphology, the mensuration of exocellular polysaccharide concentration and niannan component.
1) observation of colonial morphology
Bacterial strain to be seen is lined (growth district of Haloferax mediterranei Δ pyrF and Haloferax mediterranei Δ pyrF Δ eps is coated with the uridylic of final concentration 50 mcg/ml before line) on screening culture medium AS-168SY solid plate, cultivate 4 days, can observe colonial morphology for 37 DEG C.
2) production of exocellular polysaccharide and the recovery of sample
Test strains is inoculated into by mono-clonal the uridylic that liquid screening culture medium AS-168SY(cultivates substratum interpolation final concentration 50 mcg/ml of Haloferaxmediterranei Δ pyrF and Haloferax mediterranei Δ pyrF Δ eps) in, cultivate 3 days for 37 DEG C, this is seed liquor; Respectively by seed liquor with 4% inoculum size be inoculated in EPS high-yield culture medium (substratum cultivating Haloferax mediterranei Δ pyrF and Haloferax mediterranei Δ pyrF Δ eps adds the uridylic of final concentration 50 mcg/ml), cultivate 60 hours for 37 DEG C.Nutrient solution through twice 10000 revs/min centrifugal 15 minutes, then through the frit of 0.22 micron pore size to remove thalline completely.Nutrient solution supernatant after gained process is exocellular polysaccharide sample.
Various component and the content thereof of described EPS high-yield culture medium are: the artificial salt solution of 30% 833 milliliters/liter, glucose 10 grams per liter, ammonium chloride 1 grams per liter, potassium primary phosphate 0.15 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter; The pH value of described EPS high-yield culture medium is 7.0-7.2, and separately adds 15.1 grams per liter PIPES(piperazines-N-N '-two (2-ethanesulfonic acid)) change of pH in buffering EPS production process.
Various component and the content thereof of described 30% artificial salt solution are: sodium-chlor 240 grams per liter, Magnesium dichloride hexahydrate 30 grams per liter, bitter salt 35 grams per liter, Repone K 7 grams per liter, CALCIUM CHLORIDE DIHYDRATE 0.5 grams per liter; Described 30% artificial salt solution concentration is 1 mol/L, and pH is the Tris hydrochloride buffer adjustment pH to 7.5 of 7.5.
Various component and the content thereof of described trace element solution SL-6 are: Zinc vitriol 1 grams per liter, four chloride hydrate manganese 0.3 grams per liters, boric acid 3 grams per liter, cobalt chloride hexahydrate 2 grams per liter, Copper dichloride dihydrate 0.1 grams per liter, Nickel dichloride hexahydrate 0.2 grams per liter, molybdic acid hydrate sodium 0.3 grams per liter; The pH hydrochloric acid soln of described trace element solution is adjusted to 3-4.
3) anthrone colorimetry measures the content of total reducing sugar in exocellular polysaccharide sample
Nutrient solution supernatant is through 1 × 10
5the dialysis tubing of molecular weight is dialysed four times in distilled water, each 6 hours.Exocellular polysaccharide sample after dialysis anthrone colorimetry measures the content of total reducing sugar.
The concrete steps that described anthrone colorimetry measures total sugar content are:
Get 7 Boiling tubes, add the Standard for Sugars solution 0.2,0.4,0.6,0.8,1.0,1.2,1.4 milliliter of 100 mcg/ml respectively, supplement volume to 2 milliliters with distilled water; Separately get 1 Boiling tube and add 2 ml distilled waters, as blank.Add 4 milliliters of anthrone reagents, shake up, boiling water bath heats 15 minutes, measures optical density value after frozen water cooling in 625 nanometer wave strong points.With sugared concentration for X-coordinate, OD625 is ordinate zou production standard curve.Get and be diluted to certain density testing sample solution 2 milliliters, add 4 milliliters of anthrone reagents, shake up, boiling water bath heats 15 minutes, measures optical density value after frozen water cooling in 625 nanometer wave strong points.Utilize total sugar content in typical curve calculation sample.
Described Standard for Sugars solution accurately takes 10 milligrams of dextrose anhydrouss (in 80 DEG C of baking box inner drying constant weights), with distilled water constant volume to 100 milliliters.
Described anthrone reagent accurately takes 100 milligrams of anthrones, with sulfuric acid constant volume to 100 milliliters.
4) sulfate by ion chromatography mannose group component
Get 4 milliliters, exocellular polysaccharide sample after dialysis, add concentrated hydrochloric acid 1 milliliter, in 120 DEG C of hydrolysis 4 hours.After hydrochloric acid and distilled water water pump being drained, dissolve residual substance completely with 5 milliliters of distilled waters.Get the hydrolysis sugar solution that 1 milliliter of distilled water dissolves again, rotate in 1.5 milliliters of centrifuge tubes and drain, dissolve residual substance with 100 microlitre distilled waters.Again the concentrated hydrolysis sugar soln dissolved by 1/10 volume distilled water detects seminose by high-efficiency anion chromatography after the frit of 0.22 micron pore size, represents mannose group component in exocellular polysaccharide with this.With seminose standardized solution in contrast.
The chromatographic column that described high-efficiency anion chromatography uses is CarboPac PA1 anion exchange separation column, and the sample detector of use is pulsed amperometry.
The chromatographic operating process of described high-efficiency anion is as follows: 200 mM/ls of sodium hydroxide solutions clean chromatographic column 20 minutes with the flow velocity of 1 ml/min, 15 mM/ls of sodium hydroxide solutions balance chromatographic column 20 minutes with the flow velocity of 1 ml/min, 10 microlitre testing samples are via loading ring loading and enter chromatographic column, and 15 mM/ls of sodium hydroxide solutions are with the flow velocity elution chromatography post 20 minutes of 1 ml/min.The appearance time of seminose is about 13.5 minutes.
Described seminose standardized solution accurately takes 10 milligrams of anhydrous seminoses (in 80 DEG C of baking box inner drying constant weights), with distilled water constant volume to 100 milliliters.
Result as shown in Figure 3, the bacterium colony of Haloferax mediterranei Δ pyrF is moistening and smooth compared with Haloferax mediterranei Δ pyrF Δ eps, and hint Haloferax mediterranei Δ pyrF Δ eps may lose the ability of transposon mutagenesis and secretion; The mensuration of exocellular polysaccharide concentration and the detection of mannose group component demonstrate the ability that Haloferaxmediterranei Δ pyrF Δ eps has completely lost synthesis and secretion exocellular polysaccharide.Integrated plasmid pWL502-eps is transformed into the ability can recovering transposon mutagenesis and secretion in Haloferax mediterranei Δ pyrF Δ eps, and the plasmid pWL502 of sky cannot.The key gene bunch eps that above gene knockout and covering experiment demonstrate the transposon mutagenesis of prediction is that transposon mutagenesis is required.
Embodiment 3, do not rely on the eps that external source adds uridylic growth and knock out the structure of strain
The eps of uridylic synthesis defect knocks out strain Haloferax mediterranei Δ pyrF Δ eps owing to relying on the uridylic of external source interpolation, even if efficiency utilization carbon source PHBV can be produced, but be difficult to as industrial bacterial strain, so be necessary that original position covers its missing gene pyrF.
1, the original position of uridylic synthesis defect bacterial strain missing gene pyrF is knocked in
Utilize the genetic operating system based on pyrF gene, with Haloferax mediterranei Δ pyrF Δ eps for starting strain, original position knocks in the gene pyrF of disappearance, builds and does not rely on the eps deletion mutantion strain that external source adds uridylic.First build and be used for the integrated plasmid pT-pyrFr that original position knocks in pyrF, then change and homologous recombination double exchange through homologous recombination single cross successively, screen the bacterial strain obtained and verify, namely obtain object bacterial strain, concrete steps are as follows:
1) original position knocks in the structure of the integrated plasmid pT-pyrFr of pyrF
According to pyrF encoding sequence in sequence 6 and upstream and downstream nucleotide sequence thereof, devise the amplimer pyrFF1/pyrFR1 comprising pyrF coding region and upstream and downstream exchange arm for a pair:
PyrFF1:5 '-GG
gGTACCcGACGATGCGTGGCTGTA-3 ' (
kpn I) (holding 2533-2550 to mate with the 5' from sequence 6)
PyrFR1:5 '-ACATGCATGCCGCCTTGTTCCTTCTGTAGACT-3 ' (Sph I) (holding 77-98 to mate with the 5' from sequence 6)
With the genome of Haloferax mediterranei CGMCC 1.2087 for template, with primer pair pyrFF1/pyrFR1 amplification pyrF coding region and upstream and downstream exchange arm.This fragment is named as pyrFr, and length is 2474bp.Pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 68 DEG C of 180s carry out 30 circulations; 68 DEG C extend 7min.Amplification system is 25 μ l.
By through the PCR primer pyrFr of restriction enzyme Kpn I and Sph I double digestion and vector plasmid pUCm-T(purchased from Sangon Biotech (Shanghai) Co., Ltd., production code member is SK2211) connect with T4DNA ligase enzyme 16 DEG C and spend the night, then heat-shock transformed method will connect product conversion e. coli jm109 competence, at the enterprising row filter of the flat board containing amicillin resistance, the positive colony of acquisition is checked order.The integrated plasmid called after pT-pyrFr containing pyrFr will be shown through order-checking.
2) structure of bacterial strain, screening and checking are changed in single cross
Adopt the method for transformation of PEG mediation, pT-pyrFr is transformed Haloferax mediterranei Δ pyrF Δ eps, after conversion, coat screening culture medium AS-168SY solid plate, cultivate about 4 days for 37 DEG C.On this solid medium, the mono-clonal of energy normal growth is that bacterial strain is changed in single cross.
The checking of bacterial strain is changed in single cross:
Nucleotide sequence according to sequence 6(pyrF gene coding region and upstream and downstream gene) in pyrF encoding sequence and upstream and downstream nucleotide sequence thereof, devise two to being positioned at the outside and product little amplimer pyrFF2/pyrFR2 (1482bp) and pyrFF3/pyrFR3 (869bp) as far as possible of upstream and downstream exchange arm:
PyrFF2:CGCTCAACAGTATCTGGTGGC(holds 2738-2758 to mate with the 5' from sequence 6)
PyrFR2:CGTCGTCAAGCAGGTTCG(holds 1277-1294 to mate with the 5' from sequence 6)
PyrFF3:GACAAGGCTGCGGGACA(holds 853-869 to mate with the 5' from sequence 6)
PyrFR3:GGGGTCAAGTCAAGGGTAATC(holds 1-21 to mate with the 5' from sequence 6)
Change the genome of bacterial strain with single cross to be verified for template, carry out PCR reaction with primer pair pyrFF2/pyrFR2 and pyrFF3/pyrFR3 respectively, pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 120s carry out 30 circulations; 72 DEG C extend 7min.Amplification system is 25 μ l.If appoint pair of primers can amplify the fragment (namely pyrFF2/pyrFR2 can amplify the fragment that the fragment of 1482bp length or pyrFF3/pyrFR3 can amplify 869bp length) of corresponding size in two pairs of primers, then prove that this bacterial strain is that bacterial strain is changed in single cross.
3) structure of double exchange bacterial strain, screening and checking
By step 2) single cross that screens changes bacterial strain Secondary Culture 50 generation in liquid screening medium AS-168SY, by nutrient solution dilution 10
7again coat screening culture medium AS-168SY solid plate, cultivate about 4 days for 37 DEG C.Picking mono-clonal lines screening culture medium AS-168SY solid plate.
Double exchange host strains:
With the genome of double exchange bacterial strain to be verified for template, carry out PCR reaction with primer pair pyrFF2/pyrFR2 and pyrFF3/pyrFR3 respectively, pcr amplification program is: 94 DEG C of 5min denaturations; 94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 120s carry out 30 circulations; 72 DEG C extend 7min.Amplification system is 25 μ l.If the two pairs of primers can amplify the fragment (i.e. pyrFF2/pyrFR2 can amplify the fragment of 1482bp length and pyrFF3/pyrFR3 can amplify the fragment of 869bp length) of corresponding size, then prove that this bacterial strain is double exchange bacterial strain.
The double exchange bacterial strain of empirical tests is the eps not relying on external source interpolation uridylic and knocks out strain Haloferaxmediterranei Δ eps, is named as Haloferax mediterranei ES1.This transposon mutagenesis key gene bunch knocks out strain Haloferax mediterranei ES1 and still depends on high osmotic pressure environment, easy cracking in clear water; Cell still becomes shaft-like, several kinds of carbon source can be utilized to grow, have very strong Starch Hydrolysis and application power; Solid medium is formed pink bacterium colony, but bacterium colony surface becomes dry, fold; Suitable culture temperature is 25-50 DEG C, and optimum culture temperature is 45 DEG C; Be suitable for cultivating pH value for neutral, optimum pH is 7.0-7.2.
2, the detection of transposon mutagenesis ability
Detect the engineering strain Haloferax mediterranei ES1 obtained and whether knock in because of the original position of pyrF gene the proterties having influence on transposon mutagenesis defect.
Determined the ability of its transposon mutagenesis by the observation of colonial morphology, the mensuration of exocellular polysaccharide concentration and the detection of niannan component, concrete steps can refer to the 4th part in embodiment 1.
As shown in Figure 3, the original position of pyrF gene knocks in the proterties of the transposon mutagenesis defect that can not have influence on engineering strain Haloferaxmediterranei ES1 to result.
Embodiment 4, engineering strain and wild strain produce the comparative studies of PHBV
1, the nutrient media components produced for PHBV, fermentation condition and technical process
1) preparation of seed culture medium, fermention medium and supplemented medium
Each component of primary-seed medium and concentration thereof are:
Acid hydrolysis casein 5 grams per liter, yeast extract 5 grams per liter, Sodium Glutamate 1 grams per liter, trisodium citrate 3 grams per liter, sodium-chlor 200 grams per liter, bitter salt 20 grams per liter, Repone K 2 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter.
The pH of described primary-seed medium is 7.0-7.2.
Each component of secondary seed medium and concentration thereof are:
Acid hydrolysis casein 10 grams per liter, yeast extract 10 grams per liter, Sodium Glutamate 2 grams per liter, trisodium citrate 6 grams per liter, sodium-chlor 200 grams per liter, bitter salt 20 grams per liter, Repone K 2 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter.
The pH of described secondary seed medium is 7.0-7.2.
Each component of fermention medium and concentration thereof are:
Sodium-chlor 110 grams per liter, magnesium chloride 9.6 grams per liter, magnesium sulfate 14.4 grams per liter, Repone K 5 grams per liter, calcium chloride 1 grams per liter, sodium bicarbonate 0.2 grams per liter, Sodium Bromide 0.375 grams per liter, yeast extract 3 grams per liter, ammonium chloride 2 grams per liter, potassium primary phosphate 0.0375 grams per liter, starch 20 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter.
Each component of supplemented medium and concentration thereof are:
Sodium-chlor 129 grams per liter, ammonium chloride 45.45 grams per liter, starch 500 grams per liter.
Described primary-seed medium, secondary seed medium and fermentation culture were based on moist heat sterilization under 8 pounds of vapor pressure conditions 30 minutes.
2) actication of culture and seed culture
Be inoculated in primary-seed medium by two bacterial strain Haloferax mediterranei ES1 and the Mediterranean Sea rich salt bacterium Haloferaxmediterranei CGMCC 1.2087 of rich for Mediterranean Sea salt bacterium by mono-clonal, cultivate 3 days for 37 DEG C, this is primary seed solution; By primary seed solution with 2%(volumn concentration) inoculum size be inoculated into respectively in secondary seed medium, 37 DEG C cultivate 3 days, this is secondary seed solution.Secondary seed solution is as the seed liquor of fermentor tank.
3) fermentative production of PHBV
By the secondary seed solution of the bacterial strain Haloferax mediterranei ES1 secondary seed solution of rich for Mediterranean Sea salt bacterium and Mediterranean Sea rich salt bacterium Haloferax mediterranei CGMCC 1.2087 with 10%(volume percent) inoculum size be inoculated in the fermentor tank that 4 liters of fermention mediums are housed respectively, carry out the fermentative production of PHBV.The condition of fermentative production is: temperature 37 DEG C; PH is regulated to be stabilized within the scope of 6.95-7.05 with 2M hydrochloric acid soln or 2M sodium hydroxide solution; Air flow 1.25:1vvm, the change manual regulation stirred with dissolved oxygen is all comparatively suitably suitable with the dissolved oxygen maintained in two fermentor tanks; In tank body, pressure is 1 normal atmosphere; The bubble that fermenting process produces controls the stirring of defoamer peristaltic pump by the induction of froth breaking electrode, thus adds defoamer; Fermentation time 72 hours.Fermentative production proceeds to the 28th hour, and feed supplement liquid adds fermented liquid, to fermentation ends with the speed constant speed of 10.5 mls/hour.
Described defoamer is that 10 milliliters of polyoxypropylene-polyoxyethylene glycerin ethers (trade name is bubble enemy) are dissolved in the aqueous ethanolic solution that volumetric concentration is 20%.
2, correlation parameter detection and analysis
During the fermentation, every nutrient solution getting about 100 milliliters for 8 hours from the moment (namely the 0th hour) that secondary seed solution is inoculated into fermention medium, for detecting parameters in fermented liquid, thus makes analysis.
1) recovery of thalline and the mensuration of PHBV
Get 50 milliliters of nutrient solutions centrifugal 20 minutes through 10000 revs/min, topple over clean supernatant, by centrifuge tube and remain in bottom thalline in-70 DEG C of freeze overnight.The centrifuge tube that freezing thalline is housed is put into rapidly freezing in vacuum freeze drying draining.Thalline after draining weighs gross weight, calculates dry cell weight (the dry mycelium quality namely in often liter of nutrient solution); Dry mycelium takes about 70 milligrams through grinding evenly, be placed in esterification pipe, (3 milliliters of concentrated sulfuric acid dissolutions are in 97 milliliters of chromatographically pure methyl alcohol to add 2 milliliters of esterifying liquids, and accurately take 0.1 gram of phenylformic acid be dissolved in wherein as interior mark for quantitatively) and 2 milliliters of chloroforms, esterification 4 hours in 100 DEG C of baking boxs after mixing.Sample after esterification is cooled to room temperature, adds 1 milliliter of distilled water, and after mixing, room temperature leaves standstill to aqueous phase and chloroform phase layering clear (generally wanting more than two hours).Detect the content of methyl-butyrate and methyl valerate in chloroform phase (lower floor) by vapor-phase chromatography, the two represents the content of hydroxybutyric acid and hydroxypentanoic acid in PHBV respectively; Contrast with standard substance (commodity are buied), calculate PHBV concentration (the PHBV total mass namely in often liter of nutrient solution).Cell real quality more can illustrate the growing state of thalline than dry cell weight.In conjunction with dry cell weight, calculate cell real quality (namely dry cell weight deducts PHBV concentration).
2) mensuration of remaining total reducing sugar
Get 1 milliliter of nutrient solution through twice 10000 revs/min within centrifugal 15 minutes, remove thalline completely, nutrient solution supernatant is diluted to certain multiple, measures the content of remaining total reducing sugar in nutrient solution supernatant with anthrone colorimetry.The content of remaining total reducing sugar is close to starch concentration.The concrete steps of described anthrone colorimetry can refer to the step 2 of the 4th part in embodiment 1).
As shown in Figure 4, Haloferax mediterranei ES1 and Haloferax mediterranei CGMCC1.2087 has identical growth velocity to result, and the cut-out of transposon mutagenesis approach is not to absorption and the utilization generation feedback inhibition of carbon source; In Haloferax mediterranei ES1, originally comprise other metabolic pathways of PHBV synthesis because transposon mutagenesis defect has flowed to for the carbon source of transposon mutagenesis.With Haloferax mediterranei ES1 fermentative production PHBV, ferment 72 hours, the concentration of PHBV in fermented liquid reaches 21.28 grams per liters; The concentration ratio Haloferax mediterranei CGMCC 1.2087(17.80 grams per liter of PHBV under identical fermentation condition) improve 20%.
Claims (9)
1. the gene cluster that extremely halophilic archaea transposon mutagenesis is relevant, protein of its coding is following 1)-4) described in albumen:
1) protein be made up of the amino acid residue sequence shown in sequence in sequence table 2;
With, 2) protein that is made up of the amino acid residue sequence shown in sequence in sequence table 3;
With, 3) protein that is made up of the amino acid residue sequence shown in sequence in sequence table 4;
With, 4) protein that is made up of the amino acid residue sequence shown in sequence in sequence table 5.
2. gene cluster according to claim 1, is characterized in that: the sequence of described gene cluster is one of following deoxynucleotide:
1) in sequence table shown in sequence 1 from 5 ' end 547-5762 position nucleotide sequence;
2) DNA sequence dna shown in sequence 1 in sequence table.
3. a recombinant extremely halophilic archaea is the afunction of all albumen that the gene cluster as claimed in claim 1 or 2 of being set out in the genome of extremely halophilic archaea is expressed, the engineering bacteria of the transposon mutagenesis afunction of acquisition; The rich salt bacterium in Mediterranean Sea of the described extremely halophilic archaea that sets out to be preserving number be CGMCC 1.2087
haloferax mediterranei;
The method of the afunction of described all albumen of the gene cluster described in the claim 1 or 2 of setting out in the genome of extremely halophilic archaea being expressed is by the gene cluster gene knockout described in claim 1 or 2.
4. recombinant extremely halophilic archaea according to claim 3, is characterized in that: described gene knockout is realized by homologous recombination; The sequence of the upstream exchange arm that described homologous recombination is used is that 5 ' of sequence 1 in sequence table holds 1-865 position nucleotide sequence; The sequence of the downstream exchange arm that described homologous recombination is used is that 5 ' of sequence 1 in sequence table holds 5763-6282 position nucleotide sequence;
And/or, the described extremely halophilic archaea that sets out is before gene cluster described in gene knockout, first knocking out in its genome sequence as 5 ' of sequence in sequence table 6 holds 810-1607 position nucleotide sequence fragment to obtain uridylic synthesis deficient strain, knocking out of described gene cluster is carried out as starting strain again using described uridylic synthesis deficient strain, obtain the transposon mutagenesis deficient strain of uridylic synthesis defect, finally, 810-1607 position nucleotide sequence fragment original position is held to strike back by 5 ' of sequence in sequence table 6, obtain the engineering bacteria of the uridylic complex functionality transposon mutagenesis afunction identical with the described extremely halophilic archaea that sets out.
5. the recombinant extremely halophilic archaea described in claim 3 or 4 is producing the application in PHBV.
6. application according to claim 5, is characterized in that: the described method producing PHBV, is the recombinant extremely halophilic archaea in fermentation claim 3-5 described in any one, obtains the somatic cells containing PHBV; Described fermentation is carried out in fermentor tank, temperature 32-45 DEG C, air flow 1:1-2:1 vvm, and stir the change manual regulation with dissolved oxygen, pH maintains 6.5-7.5, and in tank body, pressure is 1 normal atmosphere.
7. application according to claim 6, is characterized in that: described leavening temperature is 37 DEG C.
8. application according to claim 6, it is characterized in that: in described fermentation, the component of fermention medium is sodium-chlor 110-220 grams per liter, magnesium chloride 0-10 grams per liter, magnesium sulfate 2-20 grams per liter, Repone K 1-5 grams per liter, calcium chloride 0-1 grams per liter, sodium bicarbonate 0-0.3 grams per liter, Sodium Bromide 0-0.5 grams per liter, yeast extract 0-10 grams per liter, ammonium chloride 1-5 grams per liter, potassium primary phosphate 0.02-4 grams per liter, starch 10-50 grams per liter, ferric ammonium citrate 0.005-0.01 grams per liter, trace element solution SL-6 0.5-2 milliliter/liter; PH value is 6.5-7.5;
And/or, carry out actication of culture and seed culture before described method of producing PHBV is also included in fermentation; Wherein, each component of seed culture medium and concentration thereof are:
Acid hydrolysis casein 5-10 grams per liter, yeast extract 5-10 grams per liter, Sodium Glutamate 1-2 grams per liter, trisodium citrate 3-6 grams per liter, sodium-chlor 110-220 grams per liter, magnesium chloride 0-9.6 grams per liter, magnesium sulfate 2-30 grams per liter, Repone K 1-5 grams per liter, ferric ammonium citrate 0.005-0.01 grams per liter, trace element solution SL-6 0.5-1 milliliter/liter; PH regulator is to 6.5-7.5;
Or described seed culture is divided into two-stage seed culture; The method of described seed culture is inoculated in primary-seed medium by described recombinant extremely halophilic archaea mono-clonal, cultivate for 37 DEG C and obtain first order seed nutrient solution in 3 days, then be in the inoculum size access secondary seed medium of 2% with volumn concentration by first order seed nutrient solution, cultivate for 37 DEG C and obtain secondary seed nutrient solution in 3 days;
Each component of primary-seed medium and concentration thereof are:
Acid hydrolysis casein 5 grams per liter, yeast extract 5 grams per liter, Sodium Glutamate 1 grams per liter, trisodium citrate 3 grams per liter, sodium-chlor 200 grams per liter, bitter salt 20 grams per liter, Repone K 2 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter; The pH of described primary-seed medium is 7.0-7.2;
Each component of secondary seed medium and concentration thereof are:
Acid hydrolysis casein 10 grams per liter, yeast extract 10 grams per liter, Sodium Glutamate 2 grams per liter, trisodium citrate 6 grams per liter, sodium-chlor 200 grams per liter, bitter salt 20 grams per liter, Repone K 2 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter; The pH of described secondary seed medium is 7.0-7.2;
And/or, in described fermenting process, add supplemented medium; Each component of described supplemented medium and concentration thereof are: sodium-chlor 110-220 grams per liter, magnesium chloride 0-10 grams per liter, magnesium sulfate 0-20 grams per liter, Repone K 0-5 grams per liter, calcium chloride 0-1 grams per liter, sodium bicarbonate 0-0.3 grams per liter, Sodium Bromide 0-0.5 grams per liter, yeast extract 0-10 grams per liter, ammonium chloride 10-100 grams per liter, potassium primary phosphate 0-1 grams per liter, starch 200-500 grams per liter, ferric ammonium citrate 0-0.01 grams per liter, trace element solution SL-6 0-1 milliliter/liter;
Various component and the content thereof of described trace element solution SL-6 are: Zinc vitriol 1 grams per liter, four chloride hydrate manganese 0.3 grams per liters, boric acid 3 grams per liter, cobalt chloride hexahydrate 2 grams per liter, Copper dichloride dihydrate 0.1 grams per liter, Nickel dichloride hexahydrate 0.2 grams per liter, molybdic acid hydrate sodium 0.3 grams per liter; The pH hydrochloric acid soln of described trace element solution is adjusted to 3-4;
And/or, during described fermentation, described secondary seed nutrient solution is inoculated in described fermention medium, the inoculum size of secondary seed nutrient solution to be volume percent be 10% amount be inoculated in described fermention medium.
9. application according to claim 8, is characterized in that: the component of described fermention medium is sodium-chlor 110 grams per liter, magnesium chloride 9.6 grams per liter, magnesium sulfate 14.4 grams per liter, Repone K 5 grams per liter, calcium chloride 1 grams per liter, sodium bicarbonate 0.2 grams per liter, Sodium Bromide 0.375 grams per liter, yeast extract 3 grams per liter, ammonium chloride 2 grams per liter, potassium primary phosphate 0.0375 grams per liter, starch 20 grams per liter, ferric ammonium citrate 0.008 grams per liter, trace element solution SL-6 1 milliliter/liter.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210181052.4A CN103451201B (en) | 2012-06-04 | 2012-06-04 | Extreme halophilic archaea engineering bacteria for producing bioplastics PHBV by effectively utilizing carbon source |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210181052.4A CN103451201B (en) | 2012-06-04 | 2012-06-04 | Extreme halophilic archaea engineering bacteria for producing bioplastics PHBV by effectively utilizing carbon source |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103451201A CN103451201A (en) | 2013-12-18 |
| CN103451201B true CN103451201B (en) | 2015-06-10 |
Family
ID=49734038
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210181052.4A Active CN103451201B (en) | 2012-06-04 | 2012-06-04 | Extreme halophilic archaea engineering bacteria for producing bioplastics PHBV by effectively utilizing carbon source |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103451201B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104448258B (en) * | 2014-11-18 | 2017-01-04 | 中国科学院微生物研究所 | A kind of PHBV polymer, preparation method and utilize the hemostatic material that PHBV polymer makes |
| CN105695521A (en) * | 2014-11-27 | 2016-06-22 | 中国科学院微生物研究所 | Poly(hydroxybutyrate-hydroxyvalerate) (PHBV) copolymer and preparation method thereof |
| CN108103114A (en) * | 2017-12-28 | 2018-06-01 | 北京工业大学 | A kind of method for inhibiting halophilic archaea EPS output increased PHA yield |
| CN109971782A (en) * | 2019-04-11 | 2019-07-05 | 中国农业科学院兰州兽医研究所 | A kind of salmonella typhimurium replys the construction method of strain |
| CN112167131B (en) * | 2020-09-30 | 2023-03-10 | 天津科技大学 | Halobacterium rubrum and rhodobacter salina strain and application of strengthened artemia thereof in aquatic seedling raising or aquaculture |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006126796A1 (en) * | 2005-05-24 | 2006-11-30 | Lg Chem, Ltd. | Cells or plants having a producing ability of polylactate or its copolymers and method for preparing polylactate or its copolymers using the same |
| CN101139575A (en) * | 2007-08-06 | 2008-03-12 | 中国科学院微生物研究所 | Extremely halophilic archaea polyhydroxy fatty acid ester synthases and encoding gene and application |
| CN101525599A (en) * | 2008-03-07 | 2009-09-09 | 中国科学院微生物研究所 | Enzyme relevant to synthesis of poly (hydroxybutyrate-hydroxyvalerate) and encoding gene and application thereof |
-
2012
- 2012-06-04 CN CN201210181052.4A patent/CN103451201B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006126796A1 (en) * | 2005-05-24 | 2006-11-30 | Lg Chem, Ltd. | Cells or plants having a producing ability of polylactate or its copolymers and method for preparing polylactate or its copolymers using the same |
| CN101139575A (en) * | 2007-08-06 | 2008-03-12 | 中国科学院微生物研究所 | Extremely halophilic archaea polyhydroxy fatty acid ester synthases and encoding gene and application |
| CN101525599A (en) * | 2008-03-07 | 2009-09-09 | 中国科学院微生物研究所 | Enzyme relevant to synthesis of poly (hydroxybutyrate-hydroxyvalerate) and encoding gene and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| CP001868;Han J.等;《Genbank》;20120529;基因组序列 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103451201A (en) | 2013-12-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103451201B (en) | Extreme halophilic archaea engineering bacteria for producing bioplastics PHBV by effectively utilizing carbon source | |
| CN104293724A (en) | Genetically engineered bacteria for efficiently producing N-acetylglucosamine | |
| CN109370975B (en) | Method for improving yield of L-arginine synthesized by corynebacterium crenatum | |
| CN105087529A (en) | Genetically engineered protease K and production method of protease K | |
| CN100532536C (en) | Penicillium citrinum bacteria with high nuclease P1 yield and its selective breeding process | |
| CN115873754A (en) | Enteromorpha clotrimaca RS804 and application thereof | |
| CN107574173A (en) | A kind of recombinant plasmid and its method for building High-productive Monascus Pigment Strain | |
| CN103981112A (en) | Double-promoter multi-copy recombinant pichia pastoris strain for highly producing endo-inulinase | |
| CN103695315B (en) | A kind of fermentable produces the method for chitin oligosaccharide | |
| CN105801675B (en) | A kind of High-activity chitosanase control gene csn and the method using gene production High-activity chitosanase | |
| CN102517303B (en) | Recombination blue-green alga for producing lactic acid as well as preparation method and applications thereof | |
| CN109536427A (en) | A kind of engineering lactic acid bacteria that acid stress resistance improves | |
| CN116144571B (en) | Bacillus pumilus independent of antibiotics and capable of stabilizing high-yield alpha-amylase, and construction method and application thereof | |
| CN104263680B (en) | Thermoanaerobacter ethanolicus and method for producing ethanol by using same | |
| CN107881123B (en) | Genetically engineered bacterium for producing pyruvic acid by using methanol and construction method and application thereof | |
| CN102199643A (en) | Preparation method of citicoline | |
| CN104611284A (en) | Strain for production of cyclodextrin glucosyltransferase and application of strain | |
| CN102061295A (en) | Vitreoscilla hemoglobin gene expression box and method for improving yield of saccharifying enzyme produced by aspergillus niger | |
| CN112210523B (en) | Recombinant bacillus subtilis for producing feruloyl esterase and application thereof | |
| CN107488603A (en) | One kind is overexpressed choline phosphate cytidylyltransferase Saccharomyces cerevisiae gene engineering bacteria and construction method and application | |
| CN104480056B (en) | A kind of genetic engineering bacterium of high-yield extracellular polysaccharide and its preparation method and application | |
| CN107245471A (en) | It is a kind of to recombinate streptomyces hygroscopicus and its application in jinggangmycin A yield is improved | |
| CN107974453A (en) | It is a kind of to improve brewing yeast cell vigor and the methods and applications of multiple resistance | |
| CN105462868A (en) | Method for improving yield and production intensity of pyruvic acid | |
| CN100519739C (en) | Novel rumen bacteria variants and process for preparing succinic acid employing the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |