CN110711177A - Osthole microemulsion and preparation method and application thereof - Google Patents

Abstract

The invention belongs to the technical field of medicines, and particularly relates to osthole microemulsion as well as a preparation method and application thereof. The osthole microemulsion comprises osthole and auxiliary materials, wherein the auxiliary materials comprise a mixed emulsifier, ethyl oleate and deionized water; the mixed emulsifier comprises polyoxyethylene 35 castor oil, 15-hydroxystearic acid polyethylene glycol ester and polyethylene glycol 400. The osthole microemulsion has protection effects on damaged cells to different degrees, and particularly has the best protection effect on the cells by the osthole microemulsion of 10 mu mol/L.

Description

Osthole microemulsion and preparation method and application thereof

Technical Field

The invention belongs to the technical field of medicines, and particularly relates to osthole microemulsion as well as a preparation method and application thereof.

Background

Alzheimer's disease (Alzheimer's)disease, AD) is a common neurodegenerative disease occurring in the central nervous system, mainly occurring in the early and old stages of the elderly, and characterized by memory loss, progressive dementia, personality changes and language disorders^[1]. At present, the drug therapy mainly comprises cholinesterase inhibitors, memantine therapy, insulin nasal drip, application of anti-oxidation drugs, hormone replacement therapy, traditional Chinese medicine and herbal medicine therapy and the like, and non-drug therapy such as brain non-invasive stimulation technology, cognitive training, phototherapy and the like.

Epidemiological investigation shows that the estrogen has a therapeutic effect on the Parkinson's disease. In recent years, osthole (osthol) has been found to have a plant estrogen-like effect and thus has a potential neuroprotective effect. The studies on osthole have been increasingly conducted.

Osthole is a natural coumarin compound, and is an extract of Cnidium monnieri (L.) Cusson. The common cnidium fruit is a traditional Chinese herbal medicine in China, and has been recorded about functions and usage in Ben Cao gang mu, jin Kui Yao L ü e and Qian jin Fang, and its eating methods include common cnidium fruit soup, common cnidium fruit-bitter ginseng wine, common cnidium fruit-stemona root powder, common cnidium fruit-porridge and common cnidium fruit-lightyellow sophora root powder. Osthole is the highest compound content in fructus Cnidii, and is the main component of fructus Cnidii. Osthole has antiinflammatory, antiallergic and neuroprotective effects. Osthole has reproductive organ, kidney and spleen targeting property, and has the characteristics of low intracerebral concentration, quick distribution, quick elimination, low bioavailability and the like although the osthole can penetrate blood brain barrier. A large number of documents show that the osthole solution with higher concentration has better treatment effect on diseases, but the clinical application of the osthole solution is greatly limited due to lower solubility of the osthole.

Patent CN109700762A discloses a mixed material osthole foaming microemulsion and a preparation process, the osthole foaming microemulsion comprises osthole and auxiliary materials, wherein the auxiliary materials comprise ethyl oleate, mixed surfactant and deionized water; the mixed surfactant comprises polyoxyethylene castor oil 40 and diethylene glycol monoethyl ether. Ethyl oleate: polyoxyethylene 40 hydrogenated castor oil: diethylene glycol monoethyl ether: deionized water 8.13:14.81:6.58: 71.44. The patent provides the osthole foaming microemulsion, achieves the purpose of solubilizing the osthole, and provides certain guiding significance for further preparation forming of the osthole foaming microemulsion in the later period. However, the dosage of the foaming microemulsion is difficult to control because the foaming microemulsion is in a foaming state, and the subsequent accurate control of the dosage is inconvenient. And the foaming microemulsion is inconvenient to use for preparing an oral preparation.

The literature of Chinese iris, muak and gamma, etc. the osthole up-regulates miRNA-9 to inhibit BACE-1 expression and treat Alzheimer disease, and the action mechanism of osthole up-regulating miRNA-9 to treat AD is disclosed in the Chinese pharmacological report, 2019, volume 35, stage 4, 524 and 529. Screening microRNAs with differential expression after osthole treatment by adopting a gene chip technology; the database and the Cytoscape predict a target gene regulated by miRNA-9; the liposome 2000 establishes an SH-SY5Y cell model with high APP expression, and an MTT method detects the influence of osthole on cell activity; transferring the miRNA-9 inhibitor into SH-SY5Y cells with high APP expression, and detecting the expression conditions of miR-9 and BACE-1mRNA of each group by an RT-PCR method; and detecting the expression condition of BACE-1 protein in the cells by using a Western blot method. Results the results of the database show that the osthole-regulated miRNA-9 can be combined with BACE-1 in a targeting way. MTT results showed 50. mu. mol. L^-1The osthole has good protective effect on cells. RT-PCR results show that osthole can up-regulate the expression of miR-9, and the expression of miRNA-9 in an inhibitor group is the lowest. Compared with the model group, the osthole can inhibit the expression of BACE-1mRNA and protein, and the BACE-1mRNA and protein of the inhibitor group are expressed most. Conclusion treatment of Alzheimer's disease with osthole may be associated with upregulation of miRNA-9, thereby inhibiting BACE-1 expression. This document discloses 50. mu. mol. L^-1The osthole has a better protective effect on cells, but the concentration of the osthole with the better protective effect on the cells is still larger, and whether the curative effect of the osthole can be improved by improving the dosage form is the technical problem to be solved by the application.

Disclosure of Invention

In order to solve the technical problems, the invention provides an osthole microemulsion and a preparation method thereof.

The present invention solves the above problems by the following means

An osthole microemulsion comprises osthole and adjuvants, wherein the adjuvants comprise mixed emulsifier, ethyl oleate and deionized water; the mixed emulsifier comprises polyoxyethylene 35 castor oil, 15-hydroxystearic acid polyethylene glycol ester and polyethylene glycol.

In the osthole microemulsion, the volume usage ratio of the polyoxyethylene 35 castor oil, the 15-hydroxystearic acid polyethylene glycol ester and the polyethylene glycol is that the polyoxyethylene 35 castor oil: 15-Hydroxystearic acid polyethylene glycol ester: polyethylene glycol 2: 2:1, unit is g: g.

In the osthole microemulsion, the volume usage ratio of the ethyl oleate to the polyoxyethylene 35 castor oil is 2.5:8, and the unit is g: g.

In the osthole microemulsion, the concentration of the osthole microemulsion is 0.5-30 mg/mL.

Preferably, the concentration of the osthole micro emulsion is 5-20 mg/mL.

Preferably, the concentration of the osthole microemulsion is 10 mg/mL.

Preferably, the concentration of the osthole microemulsion is 5 mg/mL.

The preparation method of the osthole microemulsion comprises the following steps:

(1) mixing ethylene oxide 35 castor oil and 15-hydroxystearic acid polyethylene glycol ester to be used as an emulsifier, and mixing the emulsifier with polyethylene glycol 400 to prepare a mixed emulsifier;

(2) the oil phase is ethyl oleate, and is mixed with the mixed emulsifier and stirred to obtain a mixture;

(3) adding osthole into the mixture, stirring to dissolve completely, and diluting with deionized water to desired volume to obtain the final product with concentration of 0.5-30 mg/mL.

The osthole microemulsion is applied to the preparation of medicines for inhibiting SH-SY5Y apoptosis. The SH-SY5Y cell apoptosis is SH-SY5Y cell apoptosis caused by L-Glu.

The osthole microemulsion is applied to the preparation of the medicine for increasing the SOD content in cells. The cells are SH-SY5Y cells damaged by L-Glu.

The osthole microemulsion is applied to the preparation of medicines for increasing the content of GSH in cells. The cells are SH-SY5Y cells damaged by L-Glu.

The beneficial effect of the invention is that,

(1) the research on the behaviours of a dementia-causing mouse model adopting the intraperitoneal injection of scopolamine shows that after the nano-emulsion is improved and the nano-emulsion is administrated to a mouse through nose, the nano-emulsion can obviously improve the learning and dementia memory of the mouse, and the nasal dose effect of 0.1mg/kg and the curative effect of oral osthole (25mg/kg) are achieved. Greatly reduces the administration dosage and improves the bioavailability.

(2) The research of preparing a dementia rat model by adopting a silent gene method discovers that the comparison research of preparing osthole into nanoemulsion by adopting an intragastric administration method and a common monomer intragastric administration method discovers that the osthole is not easy to be damaged. The effect of the nanoemulsion (6.25mg/kg) with a smaller dosage on improving the AD model is better than the effect of the gavage administration dosage of 25 mg/kg.

(3) The invention provides a preparation method of osthole microemulsion. In a preliminary experiment to optimize the microemulsion formulation at the early stage of the experiment, we found that when ethyl oleate was used as the oil phase and polyethylene glycol 400 as the co-surfactant, a pseudo-ternary phase diagram of the different surfactants is shown in fig. 1. The shaded area in the figure indicates the nanoemulsion region, the larger the nanoemulsion region, the stronger the emulsifying capacity. Finally, a mixture of polyoxyethylene 35 castor oil and HS-15 is selected as the emulsifier. The ratio of polyoxyethylene 35 castor oil to HS-15 is 1:1 as an emulsifier, polyethylene glycol 400 as a co-emulsifier, ethyl oleate as an oil phase, and a blank microemulsion formula is screened by combining a pseudo-ternary phase diagram, so that the basic physicochemical properties of the osthole microemulsion are optimized and researched. The osthole microemulsion prepared by the preparation method of the osthole microemulsion has good physical stability, the particle size distribution is about 22nm, and the PDI is 0.05.

(4) In vitro efficacy evaluation results show that the osthole nanoemulsion can resist neuronal-like cell injury caused by L-glutamic acid at 10umol/L, maintain normal forms of cells and synapses, remarkably improve the cell survival rate, remarkably improve the content of GSH in L-Glu injured cells, and remarkably play a role in neuroprotection by Tunel staining. The osthole nanoemulsion can play an important role in protecting nerve cells damaged by L-Glu by influencing oxidative stress apoptosis.

SH-SY5Y cell is a tumor cell with low differentiation degree, is derived from a human neuroblastoma cell line, and has tyrosine hydroxylase, dopamine hydroxylase activity and dopamine transporter, so that the cell line is widely applied to the research on pathogenesis of nervous system diseases, particularly the research on pathogenesis of AD. Therefore, SH-SY5Y cells were selected. Experiments prove that the osthole microemulsion has no obvious influence on SY5Y cells in a normal proliferation cycle. And (3) giving L-Glu stimulation to induce cell damage, and establishing an AD model according to the cell damage. The osthole microemulsion is directly acted on the damaged cells, and the activity of the damaged cells in an MTT (methyl thiazolyl tetrazolium) experiment is obviously improved compared with that of an AD (adenosine) group, and the Tunel staining microscope observation shows that the number of apoptotic cells is obviously reduced after the osthole microemulsion is applied. Therefore, the osthole micro-emulsion with different concentrations has different degrees of protection effect on damaged cells, and especially the protection effect on the cells by the osthole micro-emulsion with 10 mu mol/L is the best.

(5) The in vitro efficacy evaluation result shows that compared with a control group, the contents of SOD and GSH-Px in the model group are obviously reduced, which indicates that the modeling is successful. After the osthole microemulsion is given, the contents of SOD and GSH-Px in cells can be obviously improved in each dosage group, which shows that the osthole microemulsion can inhibit free radicals, namely the osthole microemulsion has a protective effect on SH-SY5Y cell damage caused by L-Glu.

Drawings

FIG. 1 is a pseudo-ternary phase diagram of an O/W microemulsion system (the shaded areas represent the microemulsion regions). Wherein A is polyoxyethylene 35 castor oil; b is HS-15; c: tween 80; d: polyoxyethylene 35 castor oil and HS-15 in a ratio of 1: 1.

FIG. 2 is a distribution diagram of the particle size of osthole microemulsion.

FIG. 3 shows the identification of microemulsion of osthole.

FIG. 410% osthole microemulsion transmission electron micrograph.

Figure 5 the stability effect of three different sterilization methods on the nanoemulsion.

FIG. 6 SH-SY5Y cells were grown at 4h, 8h, 12h and 24h (200X), respectively.

FIG. 7 shows the effect of different concentrations of L-glutamic acid on SY5Y nerve cell injury.

FIG. 8 influence of blank microemulsion on the activity of SY5Y cells damaged by L-glutamic acid.

Fig. 9. delivery process of blank microemulsion to SY5Y cells.

FIG. 10 the effect of osthole microemulsions on cell activity.

FIG. 11 shows the protective effect of osthole microemulsion on SH-SY5Y cells damaged by L-Glu.

FIG. 12 the effect of osthole on SOD activity and GSH content (Mean. + -. SE) in AD cell models.

FIG. 13 TUNEL staining method for detecting the effect of osthole microemulsion pre-protecting SY5Y cell apoptosis.

FIG. 14 Effect of osthole on the water maze spatial exploration in AD mice.

FIG. 15 Effect of osthole on memory ability of AD mice (light and dark box method).

FIG. 16 shows the trend of each group of escape latency of the water maze positional navigation test.

Detailed Description

The invention will be further described with reference to the accompanying drawings and specific embodiments so that those skilled in the art may better understand the invention, but the invention is not limited thereto.

In the embodiment of the invention, the experimental reagents are purchased as follows:

osthole standard (Osthole, Ost), (content 99.81%, purity not less than 98%, available from Shang city Co., Ltd., CAS: 484-12-8); methanol (chromatographol, tianjin), lot No. 20161101; polyoxyethylene 35 castor oil (fengli zhijing limited liability company, beijing), batch number: 95615775L 0; 15-Hydroxystearic acid polyethylene glycol ester (HS-15) (Beijing, Phoenix Li Jing Ltd.): 34445116K 0; absolute ethanol (tianjin ketong), batch number: 20161006, respectively; polyethylene glycol 400 (Tianjin Bodi); ethyl oleate (Shandong ruisheng), batch number: YO 20170901; methanol (analytically pure, Tianjin Kanton); ham's F-12 cell culture medium (seimer feishel corporation); dimethyl sulfoxide (DMSO) (chemical pure, shanghai); mtt (biotopped); (ii) trypsin; fetal bovine serum (ilex purpurea hassk); l-glutamic acid (Solarbio); double antibody (Shandong Lu antibody).

Example 1 preparation of osthole microemulsion

4.0mL of castor oil and 4.0mL of LHS-15 are mixed as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was 2mL ethyl oleate, mixed with the mixed emulsifier, and stirred to give a mixture. 125mg of osthole was added to the mixture, and the mixture was stirred to completely dissolve the osthole, and then the volume was adjusted to 25mL with pure water. Obtaining the osthole micro-emulsion mother liquor with the concentration of 5 mg/mL.

Example 2 preparation of osthole microemulsion

4.0mL of castor oil and 4.0mL of LHS-15 are mixed as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was 2mL ethyl oleate, mixed with the mixed emulsifier, and stirred to give a mixture. To the mixture was added 25mg of osthole, and the solution was stirred to dissolve completely, and the volume was adjusted to 50mL with pure water. Obtaining the osthole micro-emulsion mother liquor with the concentration of 0.5 mg/mL.

Example 3 preparation of osthole microemulsion

4.0mL of castor oil and 4.0mL of LHS-15 are mixed as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was 2mL ethyl oleate, mixed with the mixed emulsifier, and stirred to give a mixture. 0.5g of osthole was added to the mixture, and the mixture was stirred to completely dissolve the osthole, and then the volume was adjusted to 25mL with pure water. Obtaining the osthole micro-emulsion mother liquor with the concentration of 20 mg/mL.

Example 4 preparation of osthole microemulsion

4.0mL of castor oil and 4.0mL of LHS-15 are mixed as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was 2mL ethyl oleate, mixed with the mixed emulsifier, and stirred to give a mixture. 0.75g of osthole was added to the mixture, and the mixture was stirred to completely dissolve the osthole, and then the volume was adjusted to 25mL with pure water. Obtaining the osthole micro-emulsion mother liquor with the concentration of 30 mg/mL.

Example 5 preparation of osthole microemulsion

4.0mL of castor oil and 4.0mL of LHS-15 are mixed as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was 2mL ethyl oleate, mixed with the mixed emulsifier, and stirred to give a mixture. 0.625g of osthole was added to the mixture, and the mixture was stirred to completely dissolve the osthole, and then the volume of the solution was adjusted to 25mL with pure water. Obtaining the osthole micro-emulsion mother liquor with the concentration of 15 mg/mL.

Example 6 preparation of osthole microemulsion

4.0mL of castor oil and 4.0mL of LHS-15 are mixed as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was 2mL ethyl oleate, mixed with the mixed emulsifier, and stirred to give a mixture. 0.25g of osthole was added to the mixture, and the mixture was stirred to completely dissolve the osthole, and then the volume was adjusted to 25mL with pure water. Obtaining the osthole micro-emulsion mother liquor with the concentration of 10 mg/mL.

Example 7 preparation of osthole microemulsion

1) Preparing the osthole microemulsion:

4.0mL of castor oil and 4.0mL of LHS-15 are mixed as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was 2mL ethyl oleate, mixed with the mixed emulsifier, and stirred to give a mixture. 0.25g of osthole was added to the mixture, and the mixture was stirred to completely dissolve the osthole, and then the volume was adjusted to 25mL with pure water. Obtaining the osthole microemulsion mother liquor with the concentration of 10mg/mL (40 mmol/L).

Preparing osthole micro-emulsion solutions with different concentrations: taking 10 mu L of 40mmol/L osthole microemulsion mother liquor, and diluting to 10mL by using F-12 incomplete culture medium to obtain 40 mu mol/L osthole microemulsion.

① 10 mu mol/L osthole microemulsion is prepared by collecting 2mL of 40 mu mol/L osthole microemulsion, and diluting to 8mL with culture medium.

Comparative example 1 preparation of blank microemulsion solution

4.0mL of castor oil was mixed with 4.0mL of HS-15 as an emulsifier, and then mixed with 2.0mL of polyethylene glycol 400 to prepare a mixed emulsifier. The oil phase was mixed with a mixed emulsifier using 2mL of ethyl oleate, and stirred to obtain a mixture. The volume was adjusted to 25mL with pure water. As a blank microemulsion.

Physicochemical tests and pharmacological tests were carried out on the osthole microemulsion of the present invention, and the details are as follows:

1.1 establishment of the osthole analysis method

1.1.1. Establishment of ultraviolet absorption wavelength

Precisely weighing 5.05mg of an osthole raw material medicine, placing the raw material medicine into a 100mL volumetric flask, dissolving the raw material medicine by using methanol, diluting the raw material medicine to a scale mark, using the methanol as a blank control, and scanning the raw material medicine within the ultraviolet wavelength range of 200-400 nm, wherein the result shows that the osthole has a maximum absorption peak at 322 nm.

1.1.2 chromatographic conditions

Welchrom C18 chromatographic column (4.6X 200nm,5 μm), methanol as mobile phase, water 80:20, flow rate 1mL/min, detection wavelength 322nm, column temperature 30 deg.C, sample size 20 μ L, and injecting the prepared methanol solution of osthole into chromatograph according to the above chromatographic conditions. The experimental result shows that the osthole has good separation state under the chromatographic condition.

1.1.3 creation of Standard Curve

Precisely weighing 25mg of osthole raw material medicine, placing in a 100mL volumetric flask, fully dissolving with methanol, and diluting to scale mark to prepare a reference substance stock solution. Sequentially adding methanol to dilute into series of standard solutions with different concentrations of 5.0, 10.0, 25.0, 35.0 and 75.0 μ g/mL, precisely taking 20 μ L of the standard solution, injecting into a chromatograph, injecting according to chromatographic conditions under 1.1.2, recording peak area, repeatedly injecting the standard solutions with different concentrations for 3 times, performing linear regression by taking the average value (A) of the peak area of the chromatographic peak as ordinate and the concentration (C) of the standard solution as abscissa, and drawing osthole standard curve to obtain regression equation A44684C-29809, r²The result shows that the osthole has good linear relation in the concentration range of 5.0-75.0 mug/mL.

1.1.4 precision investigation

Taking osthole standard solutions with different concentrations of 5.0, 25.0 and 75.0 mug/mL, carrying out continuous sample injection according to the chromatographic conditions under the item 1.1.2, measuring for 5 times, recording the peak area, calculating the RSD value under the peak area with different concentrations, and inspecting the precision of the osthole under different concentrations, wherein the results are shown in Table 1.

TABLE 1 precision measurement of osthole

Tab.1 The result precision of Osthole

The result shows that the RSD of the osthole with the precision under different concentrations is less than 5.00 percent, which indicates that the precision of a chromatographic system meets the requirement of methodology.

1.1.5 stability Studies

Precisely weighing 5mg of osthole raw material medicine, placing the raw material medicine into a 100mL volumetric flask, adding a methanol solution, fully dissolving, diluting to a scale mark, taking 20 mu l of the solution respectively at 0 hour, 1 hour, 4 hours and 8 hours, injecting into a chromatographic column, injecting according to chromatographic conditions under 1.1.2, measuring, recording the peak area, calculating the RSD of the peak area, and obtaining the result shown in Table 2.

TABLE 2 osthole stability results

Tab.2 The results of Osthole stability intraday and interday

The results show that the osthole solution is relatively stable within 8 h.

1.1.6 recovery Studies

Precisely weighing about 2mg of osthole raw material medicine, placing the raw material medicine into a 10mL volumetric flask, precisely weighing three parts of osthole reference substance solution which is equivalent to 80%, 100% and 120% of the raw material medicine, diluting the three parts of osthole reference substance solution to 10mL by using methanol, and fully dissolving the three parts of osthole reference substance solution. Precisely placing 1mL of the solution into a 10mL volumetric flask, diluting with methanol, mixing uniformly to obtain test solution with low, medium and high concentrations, performing sample injection measurement according to chromatographic conditions of item 1.1.3, recording peak area, calculating recovery rate and RSD according to the obtained standard curve, and obtaining the result shown in Table 3.

TABLE 3 osthole sample recovery rate experimental results

Tab.3 The recovery results of Osthole by HPLC analysis

The results show that the sample recovery rates measured by the test solutions with low, medium and high concentrations are respectively less than 5.00 percent of RSD, and the method has good accuracy.

1.2 basic physicochemical Properties of osthole

1.2.1 measurement of saturation solubility in oil phase

Respectively taking 0.5mL of each of ethyl oleate and isopropyl myristate, pouring into a plug-type plastic centrifuge tube, adding 50mg of an excessive osthole raw material drug, performing ultrasonic treatment for 10min to dissolve the osthole raw material drug as much as possible, standing at room temperature for 24h, centrifuging at 12000rpm for 15min at a high speed, taking a supernatant, appropriately diluting the supernatant with methanol, performing sample injection measurement according to the chromatographic condition under 1.1.2, recording the peak area, and calculating the solubility of OST in different oil phases according to the obtained standard curve, wherein the result shows that the solubility of osthole in ethyl oleate is 37.2mg/mL and the solubility of osthole in isopropyl myristate is 27.2 mg/mL. From the results, it can be seen that osthole is relatively good in solubility in ethyl oleate.

1.2.2 determination of the lipid/Water partition coefficient of osthole

Precisely weighing 40mg of osthole raw material medicine, placing the osthole raw material medicine into a plug-type plastic centrifuge tube, adding 2mL of distilled water saturated n-octanol and 2mL of n-octanol saturated distilled water which are prepared in advance, then violently shaking for 15min on a vortex mixer, carrying out ultrasonic treatment for 10min to completely dissolve the osthole raw material medicine, placing the osthole raw material medicine into a 37 ℃ air constant temperature oscillator to shake for 72h to fully reach balance, carrying out high speed centrifugation for 15min at 12000rpm, respectively taking out an oil phase and a water phase, respectively diluting the oil phase and the water phase to proper concentrations by methanol, and carrying out sample injection determination according to chromatographic conditions under 2.1.2Concentration of osthole in both phases (Coil and Cwater). Calculating the log P of the ratio of the drug amounts in the oil phase and the water phase according to the following formula,

results Coil 2.4mg/mL, Cwater 1.4 μ g/mL, logP 3.23. From the above results, it can be seen that although osthole has a relatively low solubility in water, it has a high lipid solubility because its lipid/water partition coefficient logP is 3.23.

1.3 preparation of osthole microemulsion

1.3.1. Preparation of pseudo-ternary phase diagram

The nanoemulsions were selected using a water titration method to make a pseudo-ternary phase diagram at room temperature. A pseudo-ternary phase diagram is constructed consisting of water, oil, surfactant/co-surfactant mixtures of different hydrophilic-lipophilic balance (HLB) values. The ratio of surfactant to co-surfactant (Km) was 1:1, 2:1, 3:1, 4: 1. The oil is mixed with a mixture of surfactant and co-surfactant in a mass ratio of 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, 9: 1. Each oil and surfactant mixture was titrated with distilled water under magnetic stirring and the phases were visually observed for clarity and fluidity. The resulting mixtures were identified as nanoemulsions when they appeared as single-phase, transparent or translucent, liquid with low viscosity and easy flow. Data were processed using originpro8.0 software and pseudo-ternary phase diagrams were plotted against the mass fractions of oil, water and mixed surfactant. See figure 1 for details.

1.3.2 preparation of osthole microemulsion

When ethyl oleate was used as the oil phase and polyethylene glycol 400 as the co-surfactant, a pseudo-ternary phase diagram for the different surfactants is shown in fig. 1. The hatched area in the figure indicates the microemulsion area, the larger the microemulsion area, the stronger the emulsifying capacity. When the surfactant is a mixture of HS-15 and EL-35, the ratio is 1:1, Km is 4: at 1, the shaded area is the largest. The preparation method comprises the steps of uniformly mixing ethyl oleate and a mixed emulsifier under the condition of magnetic stirring at room temperature, adding the osthole raw material medicine, fully stirring to completely dissolve the osthole raw material medicine, and finally slowly dripping distilled water with the amount of the prescription under the stirring condition to obtain the osthole micro-emulsion.

1.3.3 characterization of physico-chemical Properties of osthole nanoemulsion

After the preparation is finished, the appearance shape and the physical stability of the osthole microemulsion are inspected, and the osthole microemulsion is observed to be clear and transparent liquid with blue opalescence and has slight smell. Taking a proper amount of osthole microemulsion, centrifuging at 12000rpm for 15min at high speed, observing that the microemulsion is still clear and transparent liquid with blue opalescence and has no phenomena of layering, turbidity, precipitation and the like, and showing that the prepared microemulsion has good physical stability.

The particle size of the prepared microemulsion is measured by a Malvern laser particle size measuring instrument at room temperature, the result shows that the average particle size of the blank microemulsion is 23.25nm, the polydispersity index PDI is 0.136, the average particle size of the osthole microemulsion is 21.92nm, and the polydispersity index PDI is 0.05, the result shows that the prepared microemulsion has small and uniform particle size and meets the requirement of the microemulsion, and the particle size measurement result of the osthole microemulsion is shown in figure 2.

The type of the microemulsion is identified by a dyeing method, an oily dye Sudan red III (red) and a water-soluble dye methylene blue (blue) are respectively dripped into osthole microemulsion, the diffusion speed of the two dyes in the microemulsion is observed, the result shows that the diffusion speed of the blue is faster than that of the red, the prepared microemulsion is an O/W type microemulsion, and the result is shown in figure 3.

1.3.4 Observation of osthole microemulsion by electron microscope

The obtained osthole microemulsion was observed by negative staining under electron microscope, and the result is shown in FIG. 4 (white spherical object is microemulsion drop). The figure shows that the osthole microemulsion is spherical particles with different sizes and shapes, and has uniform dispersion and smaller particle size.

1.4 neural cell protection study of osthole microemulsion on L-glutamic acid injury

1.4.1 Sterilization of osthole microemulsion

1. High-temperature high-pressure sterilization: after high temperature and high pressure, the microemulsion becomes turbid, layered and denatured, which is not preferable.

2. Ultraviolet sterilization: ultraviolet irradiation is carried out for 2 hours, then the cell is acted on, the cell is infected with bacteria, and the ultraviolet can only kill surface bacteria but can not kill bacteria in the solution.

3. Filtering with a microporous filter membrane: after filtration, the cells were treated, and no contamination was observed. See FIG. 5

1.4.2 SH-SY5Y cell culture and treatment

SH-SY5Y cells are cultured in DMEM complete culture medium (10% fetal calf serum and 2% double antibody), incubated in a constant-temperature incubator at 37 ℃ with the volume fraction of CO2 being 5%, and the medium is changed once every 24h until the cells are paved into a stone-like cell culture bottle, and then passage is carried out.

Sucking out the culture solution, adding 2ml of trypsin, standing, observing under a microscope that the cells become round and bright and are separated from a cell culture bottle, adding 3.00ml of PBS, pouring into a 15ml centrifuge tube, centrifuging for 5min at 1000r/min, sucking out the supernatant, adding 3.00ml of DMEM complete culture medium into the centrifuge tube, blowing and beating the cells uniformly, dividing the cells into 3 cell culture bottles, adding 3.00ml of DMEM complete culture medium into the cells respectively, and transferring the cells into a constant-temperature incubator at 37 ℃ for incubation. The cell growth state was observed within 24 hours. As shown in fig. 6.

1.4.3 establishment of AD cell model

After SY5Y cells are treated by L-glutamic acid with different concentrations (a neuron cell model simulating AD injury), the MTT method detects the cell activity, the activity change trend is shown in figure 7, the activity of SY5Y cells can be obviously reduced by P <0.005 when the L-Glu is in the concentration range of 15-40mmol/L, and the reduction trend of the cell activity between the groups treated by the L-Glu with higher concentration (5 mmol/L-40 mmol/L) is obviously slowed down. The optimal damage concentration (IC50) of L-Glu to cells is estimated to be about 30mmol/L, so that 30mmol/L L-Glu is selected for processing SY5Y cells for 6h in the experiment to serve as the optimal condition established by an AD in vitro cell model for subsequent experiments.

1.4.4 Effect of blank microemulsion on SY5Y cell Activity

SY5Y cells were collected, the cell concentration was adjusted, the cells were seeded at a density of 20,000 cells/well (100 uL per well) in a 96-well plate, the cells were cultured and processed in groups of 6 wells, and MTT assay was performed on the cells after the completion of the culture. The result shows that the blank microemulsion has no influence on cell growth, especially on an AD model with L-Glu damage, and has good bedding and blank control for the later-stage protection research of the drug on the AD model. The specific results are shown in FIG. 8.

1.4.5 Process for delivering SY5Y cells by fluorescently labeling osthole microemulsion

After SY5Y cells were collected, cell concentration was adjusted at 5X 10 on a 6-well plate⁴Cells/well density inoculation, 24 hours of culture, PBS washing 3 times, and 0.01 u g/ml coumarin-6 washing. The microemulsion was added and the incubation time of the coumarin-6 microemulsion was the same as the osthole microemulsion, washed 3 times with PBS, fixed with 4% para-formaldehyde for 10 minutes, washed 3 times with PBS, washed 1 time with 0.1% triton x-100 for 1 min, washed three times with PBS, incubated with 0.5 μ g/ml DAPI for 5 minutes and washed with PBS. The nanoemulsion formulation observed under a fluorescence microscope can enter cells through SY5Y cell membrane as shown in FIG. 9.

1.4.6 Effect of osthole microemulsion on SY5Y cell Activity

After the SY5Y cells were collected, the cell concentration was adjusted to 2X 10⁴The cells were inoculated in 96-well culture plates (100 uL per well), cultured and processed in groups according to the method, each group was set with 6 multiple wells, and after the culture was completed, MTT assay was performed on the cells. The result shows that the high-concentration osthole microemulsion has cytotoxicity effect on the undamaged SY5Y cells, and as shown in figure 10, when the concentration of the osthole microemulsion is 10umol/L, the result is basically the same as that of the blank group, and the result is better.

1.4.7 osthole microemulsion has the protection effect on SH-SY5Y cells damaged by L-Glu

The MTT method is adopted in the experiment to detect the influence of osthole microemulsion (10 mu mol/L) on the activity of SH-SY5Y cells. As a result, as shown in FIG. 11, the survival rate of cells was significantly reduced in the L-Glu-injured group compared with the control group (^#P<0.05); compared with the L-Glu damaged group, the 10 mu mol/L osthole microemulsion pre-protected group has obviously improved cell survival rate (P)<0.01), indicating that the osthole microemulsion has the function of pre-protecting SH-SY5Y cell apoptosis.

1.4.8 detection of oxidative stress markers

FIG. 12 shows the results of detecting SOD activity and GSH content in different treatments. Pairwise comparison between groups shows that the SOD activity of the model group is reduced compared with that of the normal group, and the difference has statistical significance (P < 0.05); SOD activity of the OST group is increased compared with that of the model group, and the difference has statistical significance (P < 0.01). The GSH content of the model group is lower than that of the normal group, the difference is statistically significant (P <0.05), the GSH content of the OST low-dose group is obviously increased compared with that of the model group, and the difference is statistically significant (P < 0.01). See in particular fig. 12.

1.4.9 Tunel staining microscope for apoptosis

Tunel is a nuclear fluorescent dye with membrane permeability, with little DNA fragmentation in normal or proliferating cells, and therefore no 3-OH formation, and little ability to be stained. During apoptosis, chromosomal DNA breakage is a gradual and staged process, when double strand breakage of DNA or nicking of only one strand occurs, a series of DNA 3-OH ends are generated, under the action of deoxyribonucleotide terminal transferase (TdT), derivatives formed by deoxyribonucleotide, fluorescein, peroxidase, alkaline phosphorylase and biotin are marked on the 3' -end of DNA, so that apoptotic cells are detected.

Tunel staining experimental results show (see figure 13 for details), the normal control group (figure 13-A) SY5Y cells only have a small amount of chromosome red fluorescence staining and nucleus condensed apoptotic cells; compared with the control group, the AD group (figure 13-B) cells have obvious nuclear deep staining and nuclear condensation, and the number of apoptotic neurons is obviously increased; the number of apoptosis was reduced in the OST group (FIGS. 13-C, D) at each concentration compared with the AD group. The L-Glu treated SY5Y cell 6h can induce the cell to apoptosis greatly, and the osthole microemulsion can pre-protect the SY5Y cell apoptosis.

1.5 statistical analysis method

Experimental data are expressed as Mean ± std. All data were statistically analyzed using the SPSS Statistics 18.0 software, with differences of P <0.05, statistically significant.

The behaviours of a mouse model which is used for inducing dementia and is injected by scopolamine in an abdominal cavity are researched, and the research shows that after the nano-emulsion is improved and is administrated to a mouse through the nose, the learning and the dementia memory of the mouse can be obviously improved, and the nasal dose effect of 0.1mg/kg and the curative effect of oral osthole (25mg/kg) can be obviously improved. Greatly reduces the administration dosage and improves the bioavailability.

1. Laboratory animal

40 female mice of Kunming breed of 8 months old, SPF grade, weight of 18g-22g, provided by the center of experimental animals of Shandong province, and license number of the experimental animals is SYXK (Lu) 20120005. The unit of sale, Jinanpunyue laboratory animal reproduction Limited company, with the license number of SCXK (Shandong) 20140007, is then raised in the SPF animal house at the laboratory animal center of Taishan medical college.

2. Experimental reagent

Osthole (Osthole, Ost) (purity not less than 98%, available from Shancheng division of Co-Ltd. of Beijing Putian Biotechnology [ CAS:484-12-81 ]; 3% sodium pentobarbital (Sigma)), 0.9% physiological saline (Chenxin pharmaceutical Co., Ltd.).

3. Preparation of scopolamine-induced dysmnesia model

Referring to the influence of taurine such as alexandrium odoratum and the like on learning and memory and cholinergic receptors of a mouse model with dementia, the method in Chinese pharmacology report 2005,21(6)715-717 is slightly improved, and on day 21, 3mg/kg of scopolamine hydrobromide is injected into the abdominal cavity of the mouse 30min after the administration by gavage every day (a normal control group is replaced by equal amount of normal saline), and a water maze experiment is carried out 30min after the model is made.

4. Animal grouping and dosing regimens

The Kunming mouse is divided into 4 groups at random, namely a normal group, a model group, an osthole nanoemulsion group and an osthole dosage group.

5. Learning memory ability detection

Morris Water maze testThe diameter of the round water pool of the mouse water maze is 120cm, the height is 40cm, the water depth is 30cm, and the inner wall of the water pool is black. The pool was divided equally into 4 quadrants with the platform (8 cm diameter, lcm below water) centered in 1 of the quadrants. Are provided together with4 different water inlet mark points are arranged and marked as the 1 st, 2 nd, 3 th and 4 th water inlet points, and a camera device is arranged right above the water maze and is connected with a computer tracking system.

Maze adaptation training:the mice were first placed on a platform 8cm in diameter for 120s to remember that there was a platform in the water. The mouse was then lowered into the water back to the pool wall from the entry point on the opposite side of the platform table, swimming freely for 60s, and allowed to rest on the platform for 60s if the mouse found the platform within 60 s. If the platform is not found within 60s, the laboratory technician brings the platform to the platform station for 60s, then grabs the mouse back to dry the mouse, puts the mouse back to the cage for rest, and starts positioning navigation training the next day.

Positioning navigation training:for 5 days, mice were trained to swim continuously 4 times a day, 1 water spot each time, 60 s/time. If the mice do not reach the platform within 60s per training, the experimenter can induce the mice to swim to the platform and stay for 10 s. After 4 training sessions, the mice were wiped dry and returned to their cages. The swimming trajectory of the mouse and the time spent finding the platform (escape latency) within the time frame were recorded and none found was recorded as 60 s. The next month after 5 days training was completed the space exploration started.

And (3) space exploration testing:before the space exploration is started, the platform is taken out of the water, training is carried out for 1 time for 60s, the water inlet point is the opposite side quadrant of the original platform position, and the activity time of the mouse in the platform quadrant and the times of passing through the original platform position are recorded.

Light and dark box experiment:

darkness avoidance, also known as passive avoidance (passive avoidance), utilizes a mouse or rat device with a habit of darkness avoidance, half being a dark room, half being a light room, connected by a small hole in the middle. The bottom of the darkroom is paved with an electrified copper grid. The animal is shocked when entering the dark room. The darkness-avoiding experimental software is widely used for the research on the experimental research aspects of learning memory function, cognitive neuroscience, neurophysiology, neuropharmacology, cognitive function retrogression and the like, and has higher sensitivity on the memory process, particularly memory reproduction. Therefore, the classical experimental method is used for verifying the improvement research of the osthole microemulsion on the AD animal model.

6. The experimental results are as follows:

from FIG. 14, it is seen that the number of times the mice cross the platform after administration was calculated, differences between groups were compared by one-way variance analysis, differences between groups were obtained, quadrant activity time of the platform in the model group was reduced compared to that in the normal group, and the differences had statistical significance; compared with the model group, the activity time of the platform quadrant of the osthole nanoemulsion (0.1mg/kg) group is increased, the difference between the activity time of the platform quadrant of the osthole nanoemulsion (0.1mg/kg) group and the activity time of the platform quadrant of the osthole nanoemulsion (25mg/kg) group is not changed greatly, and the effect of the osthole nanoemulsion and the osthole nanoemulsion on the behaviouristic improvement of the dementia mouse is similar.

As can be seen from fig. 15: the osthole nanoemulsion is nasally administrated to influence the learning and memory capacity of AD mice (senile dementia mice), and the incubation period of a model group is shortest in single electric shock stimulation training. Compared with the model group, the dark-avoiding latency of the osthole nanoemulsion through the nasal group (0.1mg/kg) of the AD mice is increased, and the curative effect of the osthole nanoemulsion in the dark-avoiding latency is not obviously different from that of the AD mice in the gastric perfusion group (25mg/kg), which indicates that the improvement effect of the memory capacity of the AD mice can be caused by the small dose of the osthole nanoemulsion.

Thirdly, a silent gene method is adopted to prepare a dementia rat model for research, and the results of comparative research on the preparation of the osthole into the nanoemulsion by adopting a gavage administration method and a common monomer gavage method are found. The effect of the nanoemulsion (6.25mg/kg) with a smaller dosage on improving the AD model is better than the effect of the gavage administration dosage of 25 mg/kg.

1. Laboratory animal

40 female SD rats, 8 months old, SPF grade, weight 180-220 g, purchased from Jinan Pengyue laboratory animal reproduction Limited company, license number: SCXK (Shandong) 20140007, and then raised in SPF animal house at Taishan medical college laboratory animal center, license number: SYXK (lu) 20120005.

2. Reagent preparation

AAV9-Oxtr-RNAi virus formulation: the corresponding concentrations were diluted with physiological saline for the experiments.

3. Animal grouping and dosing regimens

40 SD rats were randomly grouped, blank control group and model group, osthole nano group, and osthole group 10 each. Model groups AAV9-Oxtr-RNAi viral sequences (CGGGTCAGTAGTGTCAAGCTT) were injected in the basal nucleus at a dose of 0.4. mu.l. The Morris water maze experiment was performed 21 days after dosing.

As shown in fig. 16: the escape latency of the water maze positioning navigation experiment is subjected to repeated measurement variance analysis, and the result shows that each group of escape latency presents a shortening trend along with the increase of training time. The escape latency of the model group on days 1-5 is prolonged compared with that of the normal group, and the difference has statistical significance; compared with the model group, the escape latency of the osthole nanoemulsion on the 4 th day is obviously shortened by the administration group (the dose is 6.25mg/kg), and the difference has statistical significance (P is less than 0.05). The effect is slightly better than the effect of the common osthole gavage dosage of 25 mg/kg. Thus, the improvement of the nano-emulsion dosage form is more beneficial to the improvement of the learning and memory of the dementia rats.

Claims (10)

1. An osthole microemulsion is characterized by comprising osthole and auxiliary materials, wherein the auxiliary materials comprise a mixed emulsifier, ethyl oleate and deionized water; the mixed emulsifier comprises polyoxyethylene 35 castor oil, 15-hydroxystearic acid polyethylene glycol ester and polyethylene glycol 400.

2. The osthole microemulsion according to claim 1, wherein the weight ratio of polyoxyethylene 35 castor oil, 15-hydroxystearic acid polyethylene glycol ester and polyethylene glycol is polyoxyethylene 35 castor oil: 15-Hydroxystearic acid polyethylene glycol ester: polyethylene glycol 2: 2: 1.

3. the osthole microemulsion of claim 1, wherein the weight ratio of ethyl oleate to mixed emulsifier is 2: 8.

4. The osthole microemulsion according to claim 1, wherein the concentration of the osthole microemulsion is 0.5-30 mg/mL.

5. The osthole microemulsion of claim 4, wherein the concentration of the osthole microemulsion is 5 mg/mL.

6. The method for preparing an osthole microemulsion according to claim 1, comprising the steps of:

(1) mixing ethylene oxide 35 castor oil and 15-hydroxystearic acid polyethylene glycol ester to be used as an emulsifier, and mixing the emulsifier with polyethylene glycol 400 to prepare a mixed emulsifier;

(2) the oil phase is ethyl oleate, and is mixed with the mixed emulsifier and stirred to obtain a mixture;

(3) adding osthole into the mixture, stirring to dissolve completely, and diluting with deionized water to desired volume to obtain the final product with concentration of 0.5-10 mg/mL.

7. A microemulsion of osthole as claimed in any one of claims 1-5 for use in the treatment of AD.

8. A microemulsion of osthole as claimed in any one of claims 1-5 for use in the preparation of a medicament for inhibiting SH-SY5Y apoptosis.

9. A microemulsion of osthole as claimed in any one of claims 1-5 for use in preparing a medicament for increasing SOD level in cells.

10. A microemulsion of osthole as claimed in any one of claims 1-5 for use in the preparation of a medicament for increasing GSH content in cells.

Images