CN110699461A - Fluorescent PCR detection method of thelenota ananas, primers and probes thereof - Google Patents
Fluorescent PCR detection method of thelenota ananas, primers and probes thereof Download PDFInfo
- Publication number
- CN110699461A CN110699461A CN201910947886.3A CN201910947886A CN110699461A CN 110699461 A CN110699461 A CN 110699461A CN 201910947886 A CN201910947886 A CN 201910947886A CN 110699461 A CN110699461 A CN 110699461A
- Authority
- CN
- China
- Prior art keywords
- thelenota ananas
- primers
- pcr
- result
- probes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a real-time fluorescence PCR detection method of thelenota ananas. Primers and probes with species specificity are designed based on a thelenota ananas mitochondrial cytochrome oxidase subunit I sequence (GenBank: FJ589205.1) with high species specificity, and species identification of thelenota ananas is realized by a Real-Time PCR method. The primer and the probe of the method have higher specificity and sensitivity, so the method can be used for identifying the authenticity of the deep-processed sea cucumber product.
Description
Technical Field
The invention relates to a real-time fluorescence PCR detection method of Thelenota ananas. The TaqMan probe real-time fluorescent PCR detection technology is used for detecting and identifying species components of thelenota ananas, and belongs to the technical field of biology.
Background
The sea cucumber belongs to Echinodermata (Holothuroidea) animals, and there are 1400 sea cucumber species in the world, which belong to 6 orders and 25 families respectively, and are distributed in China for over 140 species. However, there are about 40 kinds of sea cucumbers available in the world, and about more than 20 kinds produced in China sea area. However, the price of various sea cucumbers is greatly different due to different nutritional ingredients and different contents of some important biological active substances (such as sea cucumber polysaccharide, polypeptide, sea cucumber saponin and the like). Thelenota ananas belongs to animals of the order of tenosynodaceae (Aspidochirodia) and Apostichopaceae (Stichopodidae), is a high-quality sea cucumber species in the sea cucumbers produced in China except for the apostichopus japonicus, is mainly distributed in the southwest Taiping ocean, is mainly produced in the West sand isles of the south China sea, and is also a sea cucumber with the best quality in the sea area. The plum blossom ginseng is large and thick in flesh, large in back meat thorn, and plum blossom-shaped because the base parts of every 3-11 meat thorns are connected, so the plum blossom-shaped ginseng is called.
The huge price difference among different sea cucumber species and the diversified selling forms of dried sea cucumber, salted sea cucumber, instant sea cucumber, freeze-dried sea cucumber, sea cucumber capsules, sea cucumber oral liquid and the like cause that the fishes and the dragons are often mixed and are good in order in the market. The traditional sea cucumber identification method mainly depends on the external form and the anatomical features of the sea cucumber, such as the presence or absence of bone fragment features and respiratory trees, and the like, but the traditional sea cucumber identification method usually needs rich experience of an identifier. Therefore, the establishment of a molecular identification method for realizing simple, quick, accurate and objective identification of thelenota ananas is a problem which is urgently needed to be solved at present.
Disclosure of Invention
The invention utilizes the real-time fluorescence PCR technology to identify thelenota ananas so as to meet the supervision requirement on the sale and counterfeit phenomena of sea cucumber products. The invention provides a method for qualitatively detecting and identifying thelenota ananas, which can be used for identifying the authenticity of sea cucumber products.
In order to achieve the purpose, the invention adopts the following technical scheme:
(1) and (4) extracting sample DNA. Taking a 2g of a plum blossom ginseng sample foamed in cold water for 12 hours, sufficiently grinding the plum blossom ginseng sample, extracting DNA by using a DNA extraction Kit (DNeasy nericon Food Kit, QIAGEN) according to the instruction, and dissolving the extracted DNA in 50 mu L of water;
(2) and (3) real-time fluorescence PCR amplification detection. The primer probe sequences are shown in Table 1. The real-time fluorescent PCR reaction system is as follows: mu.L of Premix Ex Taq (Takara), 0.4. mu.L of the forward primer (10 pmol/. mu.L), 0.4. mu.L of the reverse primer (10 pmol/. mu.L) and 0.4. mu.L of the probe (10 pmol/. mu.L), 2. mu.L of the above-mentioned extracted DNA solution was taken, and the volume was made up to 20. mu.L with water. Performing reaction by using a fluorescent quantitative PCR instrument lighting cycle480(Roche) with the reaction program of (1)95 ℃ and 10 sec; (2)95 ℃ for 5 sec; 60 ℃, 23 sec; 50 cycles.
(3) And (6) judging the result. When the Ct value is less than or equal to 43, the result is positive, and when the Ct value is more than 43, the result is negative.
TABLE 1 primers and probes for Real-Time PCR
F: an upstream primer; r: a downstream primer; p: and (3) a probe.
Reference is made to GB/T25165-2010. The primer probe can be used as an internal reference primer probe to test the quality of the extracted DNA.
The invention provides a primer and a probe for detecting thelenota ananas, wherein the sequences of the primer and the probe comprise:
TA-F:GCTCAACCAGGATCCCTTCT
TA-R:CCGGCTCCTCTTTCTACTCC
TA-P：FAM-CCTTCCCCCGAATGAACAAC-Eclipse。
further, the primers and probes further comprise internal reference primers and probes, and the sequences of the internal reference primers and probes are respectively:
18SrRNA-F：CCTGAGAAACGGCTACCAT
18SrRNA-R：CGTGTCAGGATTGGGTAAT
18SrRNA-P：FAM-TGCGCGCCTGCTGCCTTCCT-Eclips。
further, the concentration ratio of the primer to the probe is as follows: TA-F TA-R TA-P ═ 1:1
The invention also provides a PCR identification method for detecting thelenota ananas, which comprises the following steps:
(1) preprocessing a sample;
(2) extracting DNA in the sample treated in the step (1);
(3) performing fluorescence PCR amplification on the DNA extracted in the step (2) by using primers TA-F and TA-R and a probe TA-P;
(4) determining the category;
the primer and probe sequences include:
TA-F:GCTCAACCAGGATCCCTTCT
TA-R:CCGGCTCCTCTTTCTACTCC
TA-P：FAM-CCTTCCCCCGAATGAACAAC-Eclipse。
further, the fluorescent PCR amplification conditions are as follows: (1)95 ℃ for 10 sec; (2)95 ℃ for 5 sec; 60 ℃, 23 sec; 50 cycles.
Further, the final judgment conditions of the method are as follows: when the Ct value is less than or equal to 43, the result is positive, and when the Ct value is more than 43, the result is negative.
Compared with the prior art, the invention has the following advantages and effects: the Real-time fluorescent quantitative PCR technology (RQ-PCR) has higher sensitivity and specificity, and can carry out Real-time detection on the amplified product. The invention designs the species specific primers and probes of thelenota ananas on the basis of analyzing and comparing a large amount of gene information of thelenota ananas, and establishes the fluorescent quantitative PCR identification and detection method of thelenota ananas specificity. The invention does not need to rely on the external form and the anatomical features of the sea cucumber for judgment, can meet the detection requirement only by a very small amount of samples, and has simple operation. And the judgment is made through the specific DNA information of the thelenota ananas, so that the identification process is objective and accurate. The method overcomes the defect that the traditional identification method mainly depends on a morphological and anatomical characteristic identification method, well meets the requirements of various related departments on the rapid screening and identification of thelenota ananas, and has important significance in promoting the protection and utilization of species resources.
Detailed Description
The invention will be further illustrated with reference to the following specific examples. The invention is not to be thus limited to the specific embodiments described. The conditions and methods not described in the examples are generally those routinely employed by the experimenter of the art: such as the fourth edition of "the molecular biology laboratory Manual of Olympic and Kingston, eds", or the procedures and conditions as suggested by the commercial instructions.
Example 1 was carried out: design of primers and probes
Based on the mitochondrial COI gene sequence (GenBank: AF486424.1) of thelenota ananas with high species specificity, a pair of specific amplification primers TA-F and TA-R is screened out, a specific probe TA-P is set in the amplification region of the primer pair, and a fluorescent signal is marked on the probe to realize real-time fluorescent detection. The specific amplification primers and probe sequences of thelenota ananas are respectively as follows:
TA-F:GCTCAACCAGGATCCCTTCT
TA-R:CCGGCTCCTCTTTCTACTCC
TA-P：FAM-CCTTCCCCCGAATGAACAAC-Eclipse。
and according to GB/T25165-2010, preparing primers 18SrRNA-F and 18SrRNA-R for detecting eukaryotes and a probe 18SrRNA-P, wherein the primers can be used as internal reference primers and probes for detecting the quality of extracted DNA. The sequences of the internal reference primer and the probe are respectively as follows:
18SrRNA-F：CCTGAGAAACGGCTACCAT
18SrRNA-R：CGTGTCAGGATTGGGTAAT
18SrRNA-P：FAM-TGCGCGCCTGCTGCCTTCCT-Eclipse。
example 2 was carried out: sample DNA extraction
After 2g of the tissue of thelenota ananas foamed in cold water for 12 hours was sufficiently ground, DNA extraction was performed using a DNA extraction Kit (dneasyconic Food Kit, QIAGEN) according to the instructions, and the extracted DNA was dissolved in 30 μ L to 100 μ L of water (adjusted as required in concentration). The extraction process sets other species of sea cucumber without thelenota ananas as negative control.
Example 3 of implementation: detection of sample and judgment of result by real-time fluorescence PCR, and preparation of detection kit
And (3) carrying out real-time fluorescence PCR amplification reaction. The primer probe sequences are shown in Table 1, and the real-time fluorescent PCR reaction system is as follows: mu.L of Premix Ex Taq (Takara), 0.4. mu.L of the forward primer (10 pmol/. mu.L), 0.4. mu.L of the reverse primer (10 pmol/. mu.L) and 0.4. mu.L of the probe (10 pmol/. mu.L), 2. mu.L of the above-mentioned extracted DNA solution was taken, and the volume was made up to 20. mu.L with water. Performing reaction by using a real-time fluorescent PCR instrument lighting cycle480(Roche) with the reaction program of (1)95 ℃ and 10 sec; (2)95 ℃ for 5 sec; 60 ℃, 23 sec; 50 cycles.
In the detection process, in addition to the sample, a positive control (namely a DNA sample of thelenota ananas, the sample with the DNA concentration of more than or equal to 60 ng/mu L is set as the positive control as far as possible so as to meet the condition that the Ct value is less than or equal to 35 and ensure that the obtained positive is obvious), a negative control (DNA samples of other sea cucumbers without thelenota ananas DNA) and water are used as blank controls. And respectively detecting by using a detection primer probe and an internal reference primer probe of thelenota ananas.
If the detection result shows that the blank control and the negative control have no FAM fluorescent signal, and the Ct value of the positive control is less than or equal to 43, the fluorescent PCR reaction can be judged to be effective, otherwise, the reaction is invalid. Under the premise that the fluorescence PCR reaction is effective, the Ct value of a sample obtained by detecting with an internal reference primer probe is less than or equal to 35 (under the premise that certain concentration and purity of extracted DNA are ensured), and when an obvious amplification curve appears, the DNA extraction is effective, otherwise, the DNA is extracted again until the Ct value is less than or equal to 35. Under the condition that the fluorescent PCR reaction is effective and the extracted DNA is also effective, when the Ct value obtained by the detection of the specific primer probe of thelenota ananas is less than or equal to 43, the sample is judged to be positive, and if the Ct value is more than 43, the sample is judged to be negative.
A detection kit for detecting thelenota ananas comprises qPCR amplification reaction liquid, a positive control, a negative control and a blank control.
Wherein the qPCR amplification reaction solution comprises a thelenota ananas specific amplification primer and a probe, which are respectively as follows:
TA-F:GCTCAACCAGGATCCCTTCT
TA-R:CCGGCTCCTCTTTCTACTCC
TA-P：FAM-CCTTCCCCCGAATGAACAAC-Eclipse。
and eukaryotic internal reference amplification primers and probes, respectively:
18SrRNA-F：CCTGAGAAACGGCTACCAT
18SrRNA-R：CGTGTCAGGATTGGGTAAT
18SrRNA-P：FAM-TGCGCGCCTGCTGCCTTCCT-Eclipse
positive control: extracting the DNA from thelenota ananas.
Negative control: DNA extracted from other sea cucumbers without thelenota ananas.
Blank control: ddH2O。
Example 4 of implementation: real-time fluorescent PCR specificity verification
The specificity verification of the primer probes is carried out on 8 common high-grade or medium-grade sea cucumbers such as thelenota ananas, the apostichopus japonicas, the jalappa mexicana, the acaudina molpadioides and the stichopus japonicas, 4 fishes and other common 5 species of livestock and poultry, and 17 species (shown in table 2) in total, and the reaction system and the reaction program are as described in example 3. As shown in Table 2, only the sample of thelenota ananas obtained positive results and all other species showed negative results when the specific primer probe of thelenota ananas was used for detection. When the universal primer probe for eukaryote is used for detection, positive results are obtained except water samples. The results show that the DNA extracted from all species has good quality, the fluorescent PCR reaction is effective, and on the basis, the primers and probes of thelenota ananas designed by the invention can be judged to have good species specificity.
TABLE 2 real-time fluorescent PCR specificity verification results
All experiments were averaged for 3 replicates;
and Undert, the Ct value is lower than the detection limit.
Example 5 was carried out: real-time fluorescent PCR sensitivity verification
The extracted thelenota ananas DNA (the concentration is 60 ng/. mu.L) is diluted by 4 times of gradient, and the sensitivity of a primer probe is detected. The reaction system and reaction procedure are as described in example 3. As a result, it was found that when the DNA concentration was 0.02 ng/. mu.L (sample 7 in Table 3), the Ct value was 43.24. + -. 0.19. When the DNA continued to be diluted, i.e.at a concentration of 0.005 ng/. mu.L (sample 8 in Table 3), the value detected had exceeded the detection limit, i.e.the Ct value was greater than 50 (the number of cycles set was 50). Therefore, the lower limit of the concentration of the test sample in the method is 0.02 ng/. mu.L according to the result of the test, and the maximum possible Ct value is 43.43(43.24+0.19 is 43.43) according to the average value of the Ct values and the SD value, and the test result is positive when the Ct value is less than or equal to 43 and negative when the Ct value is more than 43.
TABLE 3 verification of sensitivity of real-time fluorescent PCR method
Concentration actually measured with Nanodrop 1000 (Thermo);
4 x 4 times the concentration calculated by gradient dilution;
the Ct value is lower than the detection limit;
all experiments were averaged for 3 replicates.
Example 6: sensitivity comparison of different detection methods in deep processing of different sea cucumber mixed samples
Preparation of deep processing mixed sample and DNA extraction of the mixture:
the deep processing mixed sample is prepared by using Apostichopus japonicus (Apostichopus japonicus), Thelenota ananas and Apostichopus japonicus (Isostichopus japonicus) as materials. Soaking Stichopus japonicus in cold water for 12 hr, and stewing in boiling water for 20 min. The stewed sea cucumbers are mixed according to the proportion in the table 4, and the total weight of each mixed sample is 10g, so that 7 samples are prepared. 10g of the sample mixed in the above ratio was sufficiently mixed and ground into fine powder by a shaking grinder (precell Evolution, Bertin), a DNA extraction lysate (DNeasy nericon Food Kit, QIAGEN) was added to degrade the mixture into a liquid, 2ml of the degraded mixture was taken, DNA extraction (DNeasy nericon Food Kit, QIAGEN) was continued, and the DNA concentration was measured.
The detection method comprises the following steps:
the method comprises the following steps: namely the method of the present invention, Real-time PCR method. The sample of each concentration is repeatedly detected for 3 times, two of the 3 results are positive, namely the Ct value of two of the 3 results is less than or equal to 43, namely positive, which is represented by "+" indicating that the thelenota ananas of the percentage content can be detected, or "-" indicating that the thelenota ananas of the percentage content cannot be detected.
The method 2 comprises the following steps: refer to patent CN101942510B, multiplex PCR. Performing multiplex PCR of 4 pairs of primers and single PCR of thelenota ananas primers, performing gel electrophoresis on the products obtained by the multiplex and single PCR, obtaining fragments (301bp) with the size of a target band by electrophoresis, and indicating the electrophoresis result by "+", or else indicating by "-"; and sequencing the band obtained by electrophoresis, wherein the sequencing result is thelenota ananas, and the sequencing result is represented by "+" or "-" otherwise. The samples at each concentration are detected 3 times, wherein the final sequencing result at one time shows that the sequencing result is positive, namely the thelenota ananas with the percentage content can be detected.
The method 3 comprises the following steps: refer to patent CN103014175A, PCR-RFLP method; performing gel electrophoresis on the obtained PCR product to obtain a fragment with the size of a target band, wherein the electrophoresis result is represented by "+", and otherwise, the electrophoresis result is represented by "-"; and sequencing the band obtained by electrophoresis, wherein the sequencing result is thelenota ananas, and the sequencing result is represented by "+" or "-" otherwise. The samples at each concentration are detected 3 times, wherein the final sequencing result at one time shows that the sequencing result is positive, namely the thelenota ananas with the percentage content can be detected.
The method 4 comprises the following steps: see patent CN108018360A, DNA barcode method. Performing gel electrophoresis on the obtained PCR product to obtain a fragment with the size of a target band, wherein the electrophoresis result is represented by "+", and otherwise, the electrophoresis result is represented by "-"; sequencing detection is carried out on the band obtained by electrophoresis, and if the sequencing result is thelenota ananas, the sequencing result is shown as "+". Otherwise, it is represented by "-". The samples at each concentration are tested for 3 times, wherein one time shows positive, which indicates that the thelenota ananas of the percentage content can be detected.
To avoid different results of different detection methods due to the use of different DNAs, all methods in one iteration use the same DNA.
And (3) detection results:
the method comprises the following steps: as shown in Table 4, all the samples 1-6 obtained Ct values less than 43, so the test results were all positive; in sample 7, when the percentage content of the target thelenota ananas is reduced to 0.1%, the Ct value of one time in 3 times of detection is greater than 43, and the other two times are less than 43, so that the thelenota ananas with the mass percentage of 0.1% can still be detected by the method.
TABLE 4 Real-time PCR detection of thelenota ananas in deep-processed mixed sea cucumber products
The method 2 comprises the following steps: the multiplex PCR results showed (Table 5), bands of the size of the target fragment could be detected by electrophoresis in samples 1 and 2, and the sequencing results were BLAST (https:// BLAST. ncbi. nlm. nih. gov/BLAST. cgi) showing 100% homology to the thelenota ananas sequence. From sample 3, the gel electrophoresis result is only the target band of the apostichopus japonicus (212 bp, the primer sequence of the multiplex PCR contains the primer of the apostichopus japonicus, the result is slight), and the target band of the thelenota ananas (301bp) cannot be detected. The result of the single PCR, that is, the PCR is performed only by using primers of thelenota ananas, shows (Table 5) that the target band (301bp) can be detected in samples 1-6, and the sequencing result is consistent with the sequence of thelenota ananas, but when the content of the thelenota ananas is reduced to 0.1% (sample 7), the target species cannot be detected by the method.
TABLE 5 detection of Thelenota ananas in deep-processed Mixed sea cucumber products by ordinary PCR
The multiplex PCR and the single PCR are repeated for 3 times, and the result of one of the 3 times is positive (the detected target band 301bp of thelenota ananas or the sequence similarity of the sequencing result and the thelenota ananas reaches 98% or more), which is indicated by plus, and the result of 3 times is negative which is indicated by minus; the final result is based on the sequencing result, and the fact that the sequencing result is positive indicates that the percentage of thelenota ananas can be detected by the method.
The method 3 comprises the following steps: the method comprises the steps of carrying out PCR by using a universal primer, carrying out enzyme digestion on a PCR product, and detecting different sea cucumbers according to different enzyme digestion sites and sizes of fragments after enzyme digestion. According to the method, the product obtained after PCR is 690bp, the product obtained after enzyme digestion is 47bp, 99bp and 546bp, but the result shows (Table 6), the bands obtained by electrophoresis of samples 1-7 are all about 690bp (not shown in the figure), the PCR product is subjected to EcoR V enzyme (the endonuclease aiming at the sequence site of thelenota ananas), the band obtained after electrophoresis of the enzyme digestion product is still about 690bp (not shown in the figure), which shows that the enzyme digestion is not successful, the PCR product which is not subjected to enzyme digestion is sequenced, the sequences with more than 90 percent of homology after BLAST show the apostichopus japonicus, and the sequence with less than 90 percent of homology also shows the result of the thelenota ananas.
TABLE 6 detection of thelenota ananas in deep-processed mixed sea cucumber products by PCR-RFLP method
PCR, enzyme digestion and sequencing are repeated for 3 times, and the result of one time of the 3 times is positive (namely, the electrophoresis detects that a target strip is 690bp, the EcoR V enzyme digestion detects 47bp, 99bp and 546bp, or the sequence similarity of the sequencing result and the sequence of thelenota ananas reaches 98% or more), the result is indicated by "+", and the result is negative for 3 times is indicated by "-"; however, the final result is based on the sequencing result, and the positive sequencing result indicates that the method can detect the thelenota ananas with the percentage content.
The method 4 comprises the following steps: the method is a DNA bar code method, namely PCR is carried out by using a universal primer, and then sequencing is carried out on a PCR product. According to this method, the PCR product was 257bp, and fragments of about 250bp were obtained in samples 1 to 7 after electrophoresis (Table 7, not shown). Further sequencing tests on the samples show that the PCR product sequences of the samples 1-3 are not matched with any species after BLAST, and the matched sequences are all the apostichopus japonicus shown by BLAST results of the PCR product sequences of the samples 4-7.
TABLE 7 DNA Bar code method for detecting thelenota ananas in deep-processing mixed sea cucumber products
Repeating the PCR and the sequencing for 3 times, wherein the result of one time in the 3 times is positive (namely, the electrophoresis detects that a target band is about 250bp, the sequence similarity of the sequencing result and the sequence of thelenota ananas reaches 98% or more), the result is indicated by plus, and the result is negative for 3 times is indicated by minus; however, the final result is based on the sequencing result, and the positive sequencing result indicates that the method can detect the thelenota ananas with the percentage content.
And (4) detection conclusion: the mixture was tested for thelenota ananas by 4 different methods, and the results were still positive when the thelenota ananas content in the mixture was as low as 0.1% by the method of the present invention (method 1, table 8). In the method 2, if multiple PCR is used for detection, the result is positive when the content of thelenota ananas is 10 percent, and the result is negative when the content is as low as 5 percent; when the single PCR detection is performed, the content of 0.5% can be detected, and 0.1% is negative. Methods 3 and 4 are less suitable for the detection of a certain target species in a mixture, especially when the content of the target species in the mixture is low. Compared with the 4 detection methods, the method disclosed by the invention has good specificity and sensitivity for detecting the target species in the mixture.
TABLE 8 comparison of thelenota ananas in deep-processing mixed sea cucumber products by four methods
Sequence listing
<110> scientific and technical research institute for inspection and quarantine in Zhejiang province
Fluorescent PCR (polymerase chain reaction) detection method of <120> thelenota ananas as well as primer and probe thereof
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Synthesis (Artificial Synthesis)
<400>1
gctcaaccag gatcccttct 20
<210>2
<211>20
<212>DNA
<213> Artificial Synthesis (Artificial Synthesis)
<400>2
ccggctcctc tttctactcc 20
<210>3
<211>20
<212>DNA
<213> Artificial Synthesis (Artificial Synthesis)
<400>3
ccttcccccg aatgaacaac 20
<210>4
<211>19
<212>DNA
<213> Artificial Synthesis (Artificial Synthesis)
<400>4
cctgagaaac ggctaccat 19
<210>5
<211>19
<212>DNA
<213> Artificial Synthesis (Artificial Synthesis)
<400>5
cgtgtcagga ttgggtaat 19
<210>6
<211>20
<212>DNA
<213> Artificial Synthesis (Artificial Synthesis)
<400>6
tgcgcgcctg ctgccttcct 20
Claims (6)
1. The primer and the probe for detecting thelenota ananas are characterized in that the sequences of the primer and the probe comprise:
TA-F:GCTCAACCAGGATCCCTTCT
TA-R:CCGGCTCCTCTTTCTACTCC
TA-P：FAM-CCTTCCCCCGAATGAACAAC-Eclipse。
2. the primers and probes as claimed in claim 1, further comprising internal reference primers and probes, the sequences of which are:
18SrRNA-F：CCTGAGAAACGGCTACCAT
18SrRNA-R：CGTGTCAGGATTGGGTAAT
18SrRNA-P：FAM-TGCGCGCCTGCTGCCTTCCT-Eclips。
3. the primers and probes as claimed in claim 1, wherein said primers and probes are used in a concentration ratio of: TA-F TA-R TA-P ═ 1:1
4. A PCR identification method for detecting thelenota ananas comprises the following steps:
(1) preprocessing a sample;
(2) extracting DNA in the sample treated in the step (1);
(3) performing fluorescence PCR amplification on the DNA extracted in the step (2) by using primers TA-F and TA-R and a probe TA-P;
(4) determining the category;
characterized in that the primer and probe sequences comprise:
TA-F:GCTCAACCAGGATCCCTTCT
TA-R:CCGGCTCCTCTTTCTACTCC
TA-P：FAM-CCTTCCCCCGAATGAACAAC-Eclipse。
5. the method of claim 4, wherein the fluorescent PCR amplification conditions are: (1)95 ℃ for 10 sec; (2)95 ℃ for 5 sec; 60 ℃, 23 sec; 50 cycles.
6. The method according to any one of claims 4 to 5, characterized in that the final decision conditions of the method are: when the Ct value is less than or equal to 43, the result is positive, and when the Ct value is more than 43, the result is negative.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910947886.3A CN110699461A (en) | 2019-09-30 | 2019-09-30 | Fluorescent PCR detection method of thelenota ananas, primers and probes thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910947886.3A CN110699461A (en) | 2019-09-30 | 2019-09-30 | Fluorescent PCR detection method of thelenota ananas, primers and probes thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110699461A true CN110699461A (en) | 2020-01-17 |
Family
ID=69196723
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910947886.3A Pending CN110699461A (en) | 2019-09-30 | 2019-09-30 | Fluorescent PCR detection method of thelenota ananas, primers and probes thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110699461A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021147450A1 (en) * | 2020-10-16 | 2021-07-29 | 中国科学院南海海洋研究所 | Specific primers, identification method and kit for rapid stichopus monotuberculatus sex determination |
| CN113718055A (en) * | 2021-10-22 | 2021-11-30 | 南京海关动植物与食品检测中心 | Method and kit for identifying Magasjialong tree |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942510A (en) * | 2010-07-15 | 2011-01-12 | 中国海洋大学 | Multiple PCR method for rapidly identifying four varieties of sea cucumbers |
| CN103014175A (en) * | 2013-01-22 | 2013-04-03 | 中国海洋大学 | PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for identifying seven sea cucumber species |
| CN109234424A (en) * | 2017-07-06 | 2019-01-18 | 大连长生岛集团有限公司 | For identifying the real-time fluorescence PCR primer detection method and application of the Liao Dynasty's ginseng |
-
2019
- 2019-09-30 CN CN201910947886.3A patent/CN110699461A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942510A (en) * | 2010-07-15 | 2011-01-12 | 中国海洋大学 | Multiple PCR method for rapidly identifying four varieties of sea cucumbers |
| CN103014175A (en) * | 2013-01-22 | 2013-04-03 | 中国海洋大学 | PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) method for identifying seven sea cucumber species |
| CN109234424A (en) * | 2017-07-06 | 2019-01-18 | 大连长生岛集团有限公司 | For identifying the real-time fluorescence PCR primer detection method and application of the Liao Dynasty's ginseng |
Non-Patent Citations (2)
| Title |
|---|
| TAO ZUO ET AL.: ""Rapid identification of sea cucumber species with multiplex-PCR"", 《FOOD CONTROL》 * |
| 朱水芳主编: "《实时荧光聚合酶链反应（PCR）检测技术》", 31 July 2003, 中国计量出版社 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021147450A1 (en) * | 2020-10-16 | 2021-07-29 | 中国科学院南海海洋研究所 | Specific primers, identification method and kit for rapid stichopus monotuberculatus sex determination |
| CN113718055A (en) * | 2021-10-22 | 2021-11-30 | 南京海关动植物与食品检测中心 | Method and kit for identifying Magasjialong tree |
| CN113718055B (en) * | 2021-10-22 | 2023-05-26 | 南京海关动植物与食品检测中心 | Method and kit for identifying Gastrodia elata |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117677B (en) | PCR primer combination and detection method for passion fruit cucumber mosaic virus | |
| CN111235294B (en) | DNA bar code and primer for screening high-quality Tibetan brown mushrooms and application of DNA bar code and primer | |
| CN110699461A (en) | Fluorescent PCR detection method of thelenota ananas, primers and probes thereof | |
| Javanmardi et al. | Identification of Safflower as a fraud in commercial Saffron using RAPD/SCAR | |
| Pappalardo et al. | A COIBar-RFLP strategy for the rapid detection of Engraulis encrasicolus in processed anchovy products | |
| CN110066880A (en) | A kind of method of four large Chinese carp fish product of fast qualitative detection | |
| Ye et al. | Identification of four squid species by quantitative real-time polymerase chain reaction | |
| CN114410844A (en) | Method for determining RCR negative and positive in CAR-T cell product by detecting GALV and ALB copy number through multiple qPCR (quantitative polymerase chain reaction) | |
| Taha et al. | Identification and differentiation of poultry meat and products using PCR-RFLP technique | |
| CN113481306B (en) | Method for rapidly detecting 13 longli fish-derived components by using real-time fluorescence PCR (polymerase chain reaction) means | |
| KR100215084B1 (en) | Classification of the korean ginseng by radp analysis | |
| CN110643714A (en) | Fluorescent PCR detection method for dark stichopus japonicus and primer and probe thereof | |
| WO2023087789A1 (en) | Dna barcode for screening floccularia luteovirens having high antioxidant activity | |
| CN110564869A (en) | Primer, probe and method for identifying naked-cap fish based on 16S rRNA gene | |
| CN112210609B (en) | Real-time fluorescent PCR (polymerase chain reaction) primer, probe, kit and method for identifying puffer fish and application of real-time fluorescent PCR primer, probe, kit and method in grilled fish fillet | |
| Wen et al. | Use of species-specific PCR for the identification of 10 sea cucumber species | |
| CN105779642A (en) | Real-time fluorescent PCR primer, probe, kit and detection method for identifying component of promicrops lanceolatus | |
| CN113337618B (en) | Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting Scomber japonicus | |
| Kumar et al. | A PCR Assay for Identification of Buffalo Origin of Tissue by Amplification of the mt. D-loop Gene | |
| CN114457167B (en) | Method for detecting bivalve shellfish source components by fluorescence quantitative PCR | |
| CN104404143B (en) | The method of fluorescent PCR detection shark derived component | |
| CN109680077B (en) | Method for detecting and identifying Haliotis discus hannai by fluorescent quantitative PCR (polymerase chain reaction) | |
| CN114941034B (en) | COI primer pair, kit and identification method for identifying copper fish with round mouth | |
| CN117265130B (en) | Qualitative and quantitative identification method for balsa-derived components in fish meal | |
| KR102584621B1 (en) | Genetic markers for discriminating fish species of Lagocephalus and identification method using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |