CN110693896A

CN110693896A - Enterovirus small molecule inhibitor and application thereof

Info

Publication number: CN110693896A
Application number: CN201911113124.XA
Authority: CN
Inventors: 常俊标; 张文艳; 王升启
Original assignee: First Hospital Jinlin University; Henan Normal University
Current assignee: First Hospital Jinlin University; Academy of Military Medical Sciences AMMS of PLA; Henan Normal University
Priority date: 2019-11-14
Filing date: 2019-11-14
Publication date: 2020-01-17
Anticipated expiration: 2039-11-14
Also published as: CN110693896B

Abstract

The invention discloses an enterovirus small-molecule inhibitor and application thereof. The nucleic acid analogue small molecule FNC (2 ' -deoxy-2 ' -beta-fluoro-4 ' -azidocytosine) which has an inhibitory effect on human immunodeficiency virus HIV, hepatitis B virus HBV, hepatitis C virus HCV and the like has the characteristics of broad-spectrum inhibition of enteroviruses A71, D68, coxsackievirus A6, A16 and B3, and can obviously inhibit the replication of the viruses in RD cells. It has been found that FNC inhibits the synthesis of viral positive and negative strand RNA by inhibiting RNA polymerase activity dependent on enterovirus, thereby resisting the replication of the virus in cells. Therefore, the invention provides a medicine capable of inhibiting enterovirus in a broad spectrum.

Description

Enterovirus small molecule inhibitor and application thereof

Technical Field

The invention belongs to the field of biological medicines, and particularly relates to a small molecular compound inhibitor of enterovirus and application thereof.

Background

The enteroviruses include poliovirus, Coxsackie virus, enterocytopathic human orphan virus (ECHO) and novel enteroviruses. The enterovirus has small particles with 20-face body, diameter of 24-30 nm, no lipoid, single-stranded ribonucleic acid in the core, acid resistance to ether and other lipid solvents, and resistance to various antibiotics, antiviral drugs and detergents. Most viruses produce cytopathic effects in cell culture. Belongs to the family of picornaviridae, and is a naked virus, different enteroviruses can cause the same symptoms, and the same virus can cause different clinical manifestations. Enteroviruses are mostly seen in recessive infection and can cause symptoms such as slight upper infection, abdominal discomfort, diarrhea and the like. Occasionally invading the central nervous system, causing flaccid paralysis.

The hand-foot-and-mouth disease is a child infectious disease caused by enteroviruses and is a third infectious disease in China. The disease mainly infects infants of 0-6 years old, and is most common when children of 2-3 years old infect, herpes or ulcer is caused at the extremities and oral cavity of the sick children in the early stage of the hand-foot-and-mouth disease, and the sick children are mostly cured within 1-2 weeks. However, in a few cases, the disease progresses rapidly, meningitis, aseptic encephalitis, brainstem encephalitis, encephalomyelitis, pulmonary edema, severe respiratory disturbance, circulatory disturbance and the like appear in about 1 to 5 days of the disease, and the disease is critical in a few cases, so that death can be caused, and sequelae can be left in survival cases. The hand-foot-and-mouth disease outbreaks and epidemics in many areas of the world, especially in Asia, and the infection rate and death rate thereof are increased year by year, and the harm is very serious. From 1 month in 2008 to 12 months in 2013, over nine hundred thousand children were diagnosed with hand-foot-and-mouth disease and 2700 more deaths were observed in the continental region of china alone. According to the report of the world health organization, there are about 20 kinds of viruses causing hand-foot-and-mouth disease symptoms, wherein enterovirus A71 type (EV71) and coxsackievirus A16 type (CA16) are the most common viruses, and the number of cases caused by the infection of the two viruses accounts for more than 80% of the total cases. Other viruses that can cause hand-foot-and-mouth disease include mainly: coxsackievirus a

group

4, 5, 6, 7, 9 and 10, Echovirus (ECHO), and the like. At present, no specific medicine for directly targeting viruses exists, and a symptomatic treatment strategy is mainly adopted clinically; the broad-spectrum antiviral drug ribavirin has the risks of teratogenesis and growth inhibition when applied to infants.

The currently developed anti-enterovirus drugs mainly include the following: receptor binding blockers, viral capsid blockers, enzyme inhibitors, nucleoside analogs, and the like. The research finds that more than one receptor of the enterovirus EV71 includes a scavenger receptor B2(Human scavenger receptor class B, member 2, SCARB2), a P-selectin glycoprotein ligand (Human P-selectin glycoprotei ligand-1, PSGL-1/CD162) and the like. anti-SCARB 2 antibody and soluble SCARB2 binding agent were able to prevent entry of EV 71. Soluble PSGL-1 monoclonal antibody and purified sialoglycon also blocked EV71 infection. However, none of these receptor binding blockers was effective at inhibiting infection at higher EV71 titers, which may be associated with the presence of multiple cellular receptors for EV 71. Therefore, inhibitors directed against only one receptor do not completely inhibit viral infection. Plackonali (Pleconaril) is a viral capsid blocker, which can interfere with the adsorption and uncoating of viruses by binding to the viral protein capsid, and is a broad spectrum of anti-picornavirus drugs. The imidazolinone derivative can inhibit the pathological effect of EV71 in rhabdomyosarcoma cells and has low cytotoxicity. The protease is one of the specific proteases essential for the replication of picornavirus. Lupintrivir (Rupintrivir) is an antiviral substance designed according to the rhinovirus 3C structure. Kuo et al designed a series of derivatives from Lupintrivir and demonstrated that the derivatives act as EV71 protease 3C inhibitors. Finally, it was found that its derivative 10b is a promising inhibitor and has no significant cytotoxicity, but whether it still has antiviral activity in vivo is subject to further validation. With the intensive research of EV71 molecular biology, a plurality of antiviral drugs are designed aiming at different targets in the EV71 replication process, but the antiviral effect, adverse reaction and the like of the drugs in vivo are mostly required to be further tested and clinically verified.

The inventor often describes in detail the compound FNC (2 '-deoxy-2' -beta-fluoro-4 '-azidocytosine, 2' -deoxy-2 '-beta-fluoro-4' -azidocytidine) and its preparation method in US patent No. (patent No.: US8835615B2) marked as a small molecule inhibitor with inhibitory effect on Human Immunodeficiency Virus (HIV), and/or Hepatitis B Virus (HBV), and/or Hepatitis C Virus (HCV) virus in 2009 (patent No.: ZL 200710137548.0) and in US patent No. (patent No.: US8835615B 2). At present, no report that the compound FNC can inhibit enteroviruses and the application of the compound FNC in the caused hand-foot-and-mouth disease is found.

Disclosure of Invention

The invention aims to provide a small molecule inhibitor of enterovirus and application thereof.

A large number of experimental researches show that the small molecular compound FNC which has the effect of inhibiting human immunodeficiency viruses HIV, hepatitis B viruses HBV and hepatitis C viruses HCV also has the effect of inhibiting enteroviruses.

Accordingly, in a first aspect of the present invention, there is provided the use of FNC or a derivative thereof in the manufacture of an agent for inhibiting enteroviruses, wherein the FNC or a derivative thereof is capable of inhibiting the growth or reproduction of enteroviruses.

The use as described above, wherein FNC is 2 ' -deoxy-2 ' -beta-fluoro-4 ' -azidocytosine, having the formula:

the use as described above, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

Further preferably, the FNC derivative is a FNC phosphate derivative.

The use as described above, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the synthesis of enterovirus RNA.

The use as described above, wherein the inhibition of the growth or propagation of enterovirus is capable of inhibiting the activity of the 3D protein of enterovirus.

The use as described above, wherein the enterovirus comprises enterovirus type a71, D68, coxsackievirus type a6, a16 and B3.

According to the application, the reagent is prepared into any clinically-allowable dosage form by taking FNC as an active ingredient and matching with a pharmaceutically-acceptable carrier or auxiliary material.

The composition is used as described above, wherein the dosage form is tablets, capsules, granules, dispersing agents, injections or sprays.

And, therefore, the invention also provides a pharmaceutical preparation for inhibiting enterovirus, which comprises FNC or a derivative thereof and a pharmaceutically acceptable carrier or auxiliary material, wherein the FNC or the derivative thereof can inhibit the growth or reproduction of enterovirus.

The pharmaceutical formulation according to above, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

Further preferably, the FNC derivative is a FNC phosphate derivative.

The pharmaceutical preparation as described above, wherein the inhibition of the growth or propagation of enterovirus is capable of inhibiting the synthesis of enterovirus RNA.

The pharmaceutical preparation as described above, wherein the inhibition of the growth or propagation of enterovirus is capable of inhibiting the activity of the 3D protein of enterovirus.

The pharmaceutical formulation as defined above wherein the enteroviruses include enterovirus type a71, D68, coxsackievirus type a6, a16 and B3.

The preparation is any clinically-allowable preparation prepared by taking FNC as an active ingredient and matching with a pharmaceutically-acceptable carrier or auxiliary material.

The pharmaceutical preparation is a tablet, a capsule, a granule, a dispersant, an injection or a spray.

Based on the findings of the present invention, the present invention also provides a combined inhibitor for simultaneously inhibiting enterovirus, Human Immunodeficiency Virus (HIV), and/or Hepatitis B Virus (HBV), and/or Hepatitis C Virus (HCV).

Accordingly, in a second aspect, the present invention provides the use of FNC or a derivative thereof in the manufacture of an inhibitor for the combined inhibition of enterovirus and one or more further viruses, wherein the further viruses are Human Immunodeficiency Virus (HIV), and/or Hepatitis B Virus (HBV), and/or Hepatitis C Virus (HCV), wherein the FNC or derivative thereof is capable of inhibiting the growth or propagation of enterovirus.

The use as described above, wherein the other virus is any one, any two or all of Human Immunodeficiency Virus (HIV), Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV).

Further preferably, the FNC derivative is a FNC phosphate derivative.

Thus, the present invention also provides a combination inhibitor for inhibiting enterovirus, which comprises FNC or a derivative thereof capable of inhibiting the growth or reproduction of enterovirus and a pharmaceutically acceptable carrier or adjuvant, and one or more other viruses which are Human Immunodeficiency Virus (HIV), and/or Hepatitis B Virus (HBV), and/or Hepatitis C Virus (HCV).

The combined inhibitor as described above, wherein the other virus is any one, any two or all of Human Immunodeficiency Virus (HIV), Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV).

The combination inhibitor as described above, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

Further preferably, the FNC derivative is a FNC phosphate derivative.

The combination inhibitor as described above, wherein the inhibition of the growth or propagation of enterovirus is capable of inhibiting the synthesis of enterovirus RNA.

The combination inhibitor as described above, wherein the inhibition of the growth or propagation of enterovirus is capable of inhibiting the activity of the 3D protein of enterovirus.

The combination inhibitor as described above, wherein the enterovirus comprises enterovirus type a71, D68, coxsackievirus type a6, a16 and B3.

The combined inhibitor is prepared into any clinically allowable dosage form by taking FNC as an active ingredient and matching with a pharmaceutically acceptable carrier or auxiliary material.

The combined inhibitor is prepared into tablets, capsules, granules, dispersing agents, injections or sprays.

Through a large number of experimental researches, the FNC or derivatives thereof can inhibit cell diseases caused by enteroviruses A71, D68, coxsackieviruses A6, A16 and B3, inhibit virus replication, reduce the intracellular virus load, reduce or eliminate death of infected mice, prolong the life cycle and the like, thereby being used for treating hand-foot-and-mouth diseases caused by the enteroviruses.

Therefore, in a third aspect of the invention, the invention provides a medicament for treating or preventing hand-foot-and-mouth disease caused by enterovirus, which is characterized by comprising FNC or a derivative thereof and a pharmaceutically acceptable carrier or auxiliary material thereof.

The medicament as described above, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

Further preferably, the FNC derivative is a FNC phosphate derivative.

The medicament as described above, wherein the treatment or prevention of hand-foot-and-mouth disease is achieved by inhibiting the growth or reproduction of enteroviruses, more specifically, by inhibiting the synthesis of enterovirus RNA.

The medicament as described above, wherein the treatment or prevention of hand-foot-and-mouth disease is achieved by inhibiting the growth or reproduction of enteroviruses, more specifically, the activity of 3D protein capable of inhibiting enteroviruses.

The medicament as described above, wherein the enteroviruses include enterovirus A71, D68, Coxsackie A6, A16 and B3.

The medicament is any clinically allowable dosage form prepared by taking FNC as an active ingredient and matching with a pharmaceutically acceptable carrier or auxiliary material.

The medicament is a tablet, a capsule, a granule, a dispersing agent, an injection or a spray.

Therefore, the invention also provides application of the FNC or the derivative thereof in preparing a medicament for treating or preventing the hand-foot-and-mouth disease caused by the enterovirus, wherein the FNC or the derivative thereof can inhibit the growth or reproduction of the enterovirus.

The use as described above, wherein the FNC derivative is a FNC phosphate derivative.

The use as described above, wherein the hand-foot-and-mouth disease is a hand-foot-and-mouth disease caused by enteroviruses A71, D68, coxsackieviruses A6, A16 and B3.

According to the application, the medicament is any clinically-allowable dosage form prepared by taking FNC as an active ingredient and matching with a pharmaceutically-acceptable carrier or auxiliary material.

The experimental research shows that the expression of the enterovirus protein VP1 in cells and in cell secretion supernatant is detected by a western blot method, and the result shows that the FNC can obviously inhibit the expression of the enterovirus VP1 protein.

Accordingly, in a fourth aspect of the present invention, there is also provided a method of inhibiting the viability/activity of an enterovirus in vitro, characterised by the addition of FNC or a derivative thereof to a sample containing an enterovirus.

The experimental research shows that the content of the RNA of the enterovirus in the cells is detected by the RT-PCR method, and the result shows that the FNC can obviously inhibit the level of the RNA of the enterovirus.

Accordingly, in a fifth aspect of the present invention, there is also provided a method for inhibiting the total RNA level of enteroviruses in vitro, which comprises adding FNC or a derivative thereof to a sample containing enteroviruses.

The experimental research shows that the content of the positive strand RNA and the negative strand RNA in enterovirus infected cells is determined by an RT-PCR method, and the result shows that the FNC can effectively inhibit the level of the negative strand RNA synthesized by RNA polymerase dependent on the enterovirus.

Accordingly, in a sixth aspect of the present invention, there is also provided a method for inhibiting the RNA-dependent RNA polymerase activity of enteroviruses in vitro, which comprises adding FNC or a derivative thereof to a sample containing enteroviruses. Experimental research shows that the FNC is injected into the abdominal cavity of a 1-day-old virus attacking mouse, and compared with a control group, the drug adding group mouse shows prolonged survival time and reduced death rate.

Accordingly, in a seventh aspect of the present invention, there is also provided a method for in vitro inhibition of enteroviruses, which is characterized by adding FNC or a derivative thereof to a sample containing enteroviruses.

The FNC is a nucleic acid analogue molecule which takes ribose as a core skeleton and is characterized by 2 '-fluoro-4' -azide. FNC and a series of nucleic acid analog compounds characterized by 2 '-fluoro-4' -substitution thereof have been described in detail in structure, properties, chemical preparation methods and applications thereof by patent applicants in the 2009 national patent of invention (patent No.: ZL 200710137548.0), U.S. patent (patent No.: US8835615B 2). The FNC and its salts and phosphate derivatives of the present invention are consistent in structure, properties and synthetic methods with those of the prior patent disclosures.

The enteroviruses of the present invention are a group of viruses that are commonly parasitic to the human intestine, including polioviruses (poliovims), coxsackieviruses (coxsackieviruses), and enterocytopathic human orphan viruses (echoviruses). In 1970 the international committee for the nomenclature of viruses classified these viruses into the genus enterovirus of the picornaviridae. The enteroviruses found after 67 types of the named 3 enteroviruses are named according to the enterovirus ordinal number, such as novel enteroviruses 68, 69, 70, 71, 72 and the like. The enterovirus particles are small, 20-face bodies, 24-30 nm in diameter, free of lipoid bodies, single-stranded ribonucleic acid in the core, resistant to ether and other lipid solvents, acid-resistant and resistant to various antibiotics, antiviral drugs and detergents. Most viruses produce cytopathic effects in cell culture.

The enterovirus has similar genome and virus protein composition, the genome is composed of single strand positive strand RNA, only one open reading frame exists in the genome, the encoded polyprotein can be further hydrolyzed into P1, P2 and P33 precursor proteins, the P1 precursor protein encodes VP1, VP2, VP3 and VP 44 virus coat proteins; the P2 and P3 precursor proteins encode 7 nonstructural proteins (2A-2C and 3A-3D). The capsid of the virion is composed of 60 subunits, which are assembled into a pentamer-like structure from 4 capsid proteins (VP 1-VP 4). Of the 4 structural proteins, except that VP4 is embedded inside the viral particle shell and tightly connected with the viral core, the other 3 structural proteins are exposed on the surface of the viral particle, so that the antigenic determinants are basically located on VP 1-VP 3. Enteroviruses can be classified and typed according to the difference of nucleotide sequences of virus capsid protein VP 1. The 3D protein in the non-structural proteins of enteroviruses is an RNA-dependent RNA polymerase responsible for the synthesis of genomic RNA during viral replication. The 3D protein function of different enterovirus subtypes is relatively conserved.

The invention uses enterovirus group A71 (EV71), the virus strain is EV71cc063 vinblastic isolate; enterovirus group D68 (EVD68) with the strains USA/KY/14-18953, ATCC vr-1825D; coxsackievirus group A6 (CA6) and group A16 (CA16), the virus strains are Changchun046CHN2013 strain and CA16-EU262658.1_ shzh05-1 strain (GenBank accession number EU 262658); and coxsackievirus type B3(CVB 3), with the virus strain JX 312064.1.

The hand-foot-and-mouth disease is an infectious disease caused by enteroviruses, and the enteroviruses causing the hand-foot-and-mouth disease are more than 20 types, wherein the Coxsackie virus A16 type (CA16) and the enterovirus 71 type (EV71) are the most common. It is usually seen in children under 5 years old, with symptoms of stomachache, anorexia, low fever, small herpes or ulcer in the mouth, most children will heal themselves for about one week, and few children will cause complications such as myocarditis, pulmonary edema, aseptic meningoencephalitis, etc. The disease of some serious children will develop quickly and lead to death.

Research shows that pathogenic infection causing hand-foot-and-mouth disease can induce a plurality of apoptosis, including human malignant embryonal rhabdomyoma cells (RD), Jurkat cells, neuroepithelial tumor cells (SK-N-MC), human neuroblastoma cells, cells (SK-N-SH), glioblastoma cells (SF268), Vero cells, human microvascular endothelial cells, HeLa cells and the like. In practical research, RD cells have better sensitivity to viruses, so the method is commonly used for detecting the toxicity of drugs at a cellular level, antiviral activity of the drugs, antiviral mechanisms and the like.

Meanwhile, in the aspect of animal models, a mouse aged 1-7 days is sensitive to enteroviruses, symptoms such as milk refusal and weight loss appear 3-5 days after the mouse is inoculated with the viruses, obvious symptoms such as catalepsy appear in limbs 6-8 days, and the mouse can heal or die after 9-13 days according to different virus inoculation amounts. An infection model is established by counteracting toxic substances, and then medicines with different concentrations are injected into the abdominal cavity or the vein to study the protective effect of the medicines on infected mice. Therefore, the strain is often used as an animal model for researching the resistance to the hand-foot-and-mouth disease virus.

Advantageous effects of the invention

The invention finds that the nucleic acid analogue micromolecule FNC (2 ' -deoxy-2 ' -beta-fluoro-4 ' -azidocytosine) which has an inhibiting effect on human immunodeficiency virus HIV, hepatitis B virus HBV, hepatitis C virus HCV and the like has the characteristic of broad-spectrum inhibition of enteroviruses A71, D68, coxsackieviruses A6, A16 and B3, and can obviously inhibit the replication of the viruses in RD cells. Intensive studies revealed that FNC acts to inhibit the synthesis of viral positive and negative strand RNA by inhibiting the RNA-dependent RNA polymerase activity of enteroviruses, thereby counteracting the replication of the virus in cells. Therefore, the invention provides a medicine capable of inhibiting enterovirus in a broad spectrum.

Drawings

FIG. 1 cytotoxic Effect of FNC on RD cells.

FIG. 2 FNC inhibits the expression of various enterovirus VP1 proteins in vitro.

FIG. 3 FNC inhibits the expression of total RNA in various enterovirus cells in vitro.

FIG. 4 FNC inhibits the synthesis of positive and negative strand RNA in various enterovirus cells.

FIG. 5 FNC interacts with EV 713D protein.

FIG. 6 FNC has protective effect on enterovirus infected neonatal mice.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention. Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

RD (human rhabdomyoma) cells (purchased from American type culture Collection, ATCC) were cultured in DMEM medium containing 1% penicillin/streptomycin (P/S) and 10% Fetal Bovine Serum (FBS) at 37 ℃ in 5% CO₂Cultured in an incubator. The EV71 virus strain was the EV71cc063 vinblastic isolate. EVD68(USA/KY/14-18953, ATCC vr-1825d), CA6Changchun046CHN2013 strain, CA16-EU262658.1_ shzh05-1 strain (GenBank accession number EU262658), Coxsackie virus B3(CVB3-JX312064.1) can be purchased from American type culture Collection. The virus was amplified in human malignant embryonic rhabdomyosarcoma cells (RD), the supernatant was taken, split charged and stored at-80 ℃. RD cells were cultured in DMEM medium containing 10% fetal bovine serum, 100U/mL penicillin and 100U/mL streptomycin at 37 ℃ with 5% CO₂Culturing in an incubator, and subculturing every 2-3 days.

FNC used in the examples of the present invention was synthesized according to the method in the previously filed patent (patent No.: US8835615B2) and used by dissolving in DMSO.

All data were processed with SPSS19.0 statistical software, experimental data are expressed as mean. + -. standard error, and data comparisons between groups were performed using one-way analysis of variance. P <0.05 is statistically significant for differences.

Example 1: toxicity test of FNC to RD cells.

After culturing RD cells for 24-48h and basically full of monolayer, the culture solution is dumped, trypsinized, and transferred to a 96-well sterile cell culture plate with 100 mu L of each well. Culturing in cell culture box for 18-24 hr to make the cells grow into monolayer for use. After FNC stock solution was diluted by several times with cell culture solution to prepare six concentration gradients (1, 2, 4, 6, 8, 10. mu.M), drugs of different concentrations were added to cell culture wells from which supernatant was discarded, 100. mu.L of each well, 3 wells were repeated for each concentration, and simultaneously, cell control wells (without drug, only culture solution was added) were set up, 100. mu.L of cell culture solution was further added to each well, the wells were placed at 37 ℃ in a cell culture chamber, and after culturing for 48 hours, 20. mu.L of MTT solution (5mg/ml in PBS, pH 7.4) was added to each well. Incubation was continued for 4h, the culture was terminated, and the culture supernatant in the wells was carefully aspirated, after centrifugation was required for the suspension cells, and the culture supernatant in the wells was aspirated. Adding 150 μ L DMSO into each well, and shaking with a decolorizing shaker for 10min to completely melt the crystals.

Selecting a wavelength of 450nm, measuring the light absorption value of each pore on an enzyme-linked immunosorbent assay, recording the result, and according to a formula: cell viability (%) OD value of experimental wells/OD value of control wells × 100% cell viability was calculated to find the maximum non-toxic concentration range of drug to cells.

The results of the experiment are shown in FIG. 1. The experimental results show that: FNC has no obvious cytotoxicity to RD cells in the range below 1 μ M, and IC₅₀3.238 μ M. In addition, no pathological changes occur when cells are observed under a microscope, which shows that the FNC has better safety.

Example 2: inhibition effect experiment of FNC on enterovirus.

RD cells (8X 10)⁵) Inoculating into a six-hole plate antibiotic-free DMEM complete culture medium, culturing overnight, when the cells grow and are tiled for more than 90%, adding the RD cells into FNC treated cells with different concentrations of 0-200 nM shown in figure 3, and respectively adding viruses with MOI of 0.1 (specifically: EV71, EVD68, CA6, CA16 and CVB 3). And (3) incubating for 1h in an incubator, then changing to a normal culture medium to culture for a corresponding time, collecting cells, performing Western blotting experiment after cracking, and detecting the expression condition of the viral protein VP1 in the cells.

The cells of each group are collected after virus infection, are separated for 3min at 3000rpm, are washed once by PBS, are added with 100 mu L of cell lysate RIPA, and are preserved for standby at 20 ℃. A12% SDS-PAGE separation gel (30% acrylamide solution, 2.5mL Tris-HCIpH8.8100. mu.L 10% SDS, 100. mu.L 10% ammonium persulfate, 5. mu.L TEMED) was prepared, filled with gel, and polymerized at room temperature for 20min with water added to the top of the gel. The supernatant was decanted, 5% stacking gel (0.5mL of 30% acrylamide solution, 0.5m Tris-HCIpH6.8, 40. mu.L of 10% SDS, 50. mu.L of 10% ammonium persulfate, 5. mu.L of TEMED) was prepared, and comb teeth were inserted into the stacking gel and polymerized at room temperature for 20 min. After the gel is completely coagulated, the comb teeth are carefully pulled off. The harvested cell frozen samples were added to 5. mu.L of 5 Xloading buffer, and after boiling at 100 ℃ for 10min, electrophoresis was performed. Cutting off redundant gel blocks after electrophoresis is finished, stacking the gel blocks in a membrane transferring clamping plate in the sequence of respectively taking filter paper, glue, a nitrocellulose membrane and filter paper from the negative electrode to the positive electrode, putting the membrane transferring device, filling a new membrane transferring solution, inserting electrodes on ice or at 4 ℃ for membrane transferring, and transferring proteins on the gel to an NC membrane at 100V for 60 min. The transferred membrane was blocked with 5% skimmed milk powder, incubated on a horizontal shaker at 25rpm for 1h at room temperature. The membrane was soaked in 5% skimmed milk powder with appropriate dilution of the antibody, on a horizontal shaker at 25rpm, 4 ℃ overnight. After that, the membrane was washed 4 times with TBST 5 min/time on a horizontal shaker at 50 rpm. The wash solution was discarded, and the corresponding horseradish peroxidase-conjugated secondary antibody diluted 1:10000 was added and incubated at room temperature for 1 h. The secondary antibody is discarded, and the membrane is washed for 3 times and 10 min/time by TBST. The membrane was removed and developed on a color developing instrument using a hypersensitivity ECL chemiluminescence detection kit.

The results are shown in figure 2, FNC inhibits the expression of EV71, EVD68, CA6, CA16 and CVB3 five virus VP1 proteins in RD cells, and presents a dose-dependent relationship.

Example 3: effect of FNC on total RNA levels in enterovirus cells experiments.

RD cells (8X 10)⁵) Inoculating into six-well plate antibiotic-free DMEM complete medium, culturing overnight, when the cells grow and lay flat for more than 90%, adding different concentrations of FNC treated cells as shown in figure 3, and after 2h, respectively adding viruses (four viruses of EV71, CA6, CA16 and CVB3) with MOI of 0.1 for infection. After incubation for 1h in an incubator, cells were collected after changing to normal medium for a corresponding period of time, and the collected cell samples were subjected to total RNA extraction using Trizol reagent (Invitrogen) according to the instructions for the reagents, and then the RNA was dissolved in DEPC treated water and RNA content was determined using Nanodrop. The extracted RNA samples were stored at-70 ℃.

mRNA was reverse transcribed into cDNA using Roche reverse transcription kit and qRT-PCR amplified according to the protocol. The specific operation steps are as follows:

primer design the specific primers of each virus were designed according to the nucleotide full sequences of each virus strain provided in the NCBI database, based on the basic principle of Primer design, using software Primer premier 5.0. As in table 1.

TABLE 1 various viral qRT-PCR primers

The qRT-PCR procedure was as follows:

mu.L of SYBR Green, 0.5. mu.L of 10. mu.M primer, 2. mu.L of cDNA, 7. mu.L of ddH were added to 20. mu.L of the reaction₂O. reaction conditions: 95 ℃ for 2min, 95 ℃ for 15s, 57 ℃ for 15s, 68 ℃ for 20s, 40 cycles.

The results are shown in figure 3, FNC inhibited the amount of total RNA in infected RD cells by four viruses EV71, CA6, CA16 and CVB3, and presented a dose-dependent relationship.

Example 4: effects of FNC on levels of positive and negative strand RNA in enterovirus cells.

To examine the effect of drugs on viral plus and minus strand RNA during antiviral procedures, RD cells (8X 10)⁵) Inoculating into six-well plate antibiotic-free DMEM complete medium, culturing overnight, when the cells grow and lay flat for more than 90%, adding different concentrations of FNC treated cells as shown in figure 4, and after 2h, respectively adding viruses (four viruses of EV71, CA6, CA16 and CVB3) with MOI of 0.1 for infection. After incubation for 1h in an incubator, cells were collected after changing to normal medium for a corresponding period of time, and the collected cell samples were subjected to total RNA extraction using Trizol reagent (Invitrogen) according to the instructions for the reagents, and then the RNA was dissolved in DEPC treated water and RNA content was determined using Nanodrop. The extracted RNA samples were stored at-70 ℃. mRNA was reverse transcribed into cDNA using Roche reverse transcription kit and qRT-PCR amplified according to the protocol. The specific operation steps are as follows:

positive strand RNA reverse transcription system: mu.L of RNA,50 mu.M Oligo dT (plus strand RNA reverse transcription primer), and 6 mu.L of water, 13 mu.L in total, reacting in a PCR instrument at 65 ℃ for 10 min; after incubating the product on ice for 2min, 4. mu.L of 5 XBuffer, 0.5. mu.L of RRI, 2. mu.L of dNTP Mix (2.5mM each), 0.5. mu.L of Reverse Transcriptase, 20. mu.L in total, were added and the reaction was carried out in a PCR instrument according to the following procedure: 25 ℃ for 10min, 55 ℃ for 30min, 85 ℃ for 5min, 4 ℃ for forever.

Negative strand RNA reverse transcription system: mu.L of RNA,50 mu.M of reverse transcription primer (TTAAAACAGCCTGTGGGTTG) of viral negative strand RNA, 6 mu.L of water, and 13 mu.L in total, and reacting in a PCR instrument at 65 ℃ for 10 min; after incubating the product on ice for 2min, 4. mu.L of 5 XBuffer, 0.5. mu.L of RRI, 2. mu.L of dNTP Mix (2.5mM each), 0.5. mu.L of ReverseTranscriptase, 20. mu.L in total, were added and the reaction was carried out in a PCR instrument according to the following procedure: 25 ℃ for 10min, 55 ℃ for 30min, 85 ℃ for 5min, 4 ℃ for forever.

Taking a cDNA sample obtained by reverse transcription as a template, and carrying out qRT-PCR, wherein the operation steps are as follows:

As shown in FIG. 4, FNC was effective in inhibiting the replication of positive and negative strand RNA of EV71, CA6, CA16 and CVB3 in the infected RD, and showed a dose-dependent relationship.

Example 5: isothermal calorimetry titration (ITC) experiments in which FNC interacts with enterovirus 3D protein.

To demonstrate FNC as a nucleic acid analog, an ITC assay of FNC with EV 713D protein was performed by binding Enterovirus RNA-dependent RNA polymerase (3D protein) to inhibit the effect of Enterovirus plus and minus strand RNA synthesis. The method comprises the following specific steps:

the EV 713D protein gene is cloned to a pET28a vector and is subjected to inducible expression by an Escherichia coli BL21 strain. The harvested cells were resuspended in a buffer solution of 100mM NaCl at pH 7.5, 25mM HEPES, disrupted, and centrifuged at 12000 Xg for 30 minutes, and the supernatant was subjected to affinity chromatography using Ni-NTA column. The purified sample is further purified by ion exchange and molecular sieve chromatography. The purified 3D protein was subjected to titration experiments with FNC in MicroCal ITC200(MicroCal inc., north ampton, MA, USA).

As shown in FIG. 5, FNC has a strong interaction with EV 713D protein, and as a nucleic acid analog, it was confirmed that FNC can inhibit replication of virus in cells by binding 3D polymerase.

Example 6: protective effect of FNC on enterovirus-infected newborn mice

To demonstrate the protective effect of FNC on enterovirus infected mice, suckling mouse lethal models were constructed using EV71 and CA16 viruses: one-day-old SPF (specific-pathogen-free) grade ICR (purchased from Beijing sbefu) suckling mice are randomly divided into a control group, a toxin counteracting group and a drug application group, and each group contains 8-10 mice. The first day, the head of the challenge group and the drug group of the suckling mice were challenged respectively (EV 7110)^6.5CCID₅₀/mL，CA16 10^2.7CCID₅₀mL), and FNC was administered sequentially at 1h, 3 days, 5 days, 7 days, 9 days, and 12 days after challenge, respectively, at the dose: 1 mg/kg. In the period, the clinical symptoms and death conditions of the mice after the challenge are recorded, the mice are sacrificed 14 days after the challenge, and the virus load of each organ of the mice and the protective effect of FNC on the challenge mice are detected.

The results are shown in figure 6, FNC (1mg/kg) obviously inhibits the replication of EV71 and CA16 viruses in mice, reduces the death of the mice caused by the viruses, obviously prolongs the survival time of the mice to 39.1 percent and relieves the death of the mice caused by the viruses to different degrees.

Claims

1. Use of FNC or a derivative thereof in the preparation of an agent for inhibiting enteroviruses, wherein the FNC or the derivative thereof is capable of inhibiting the growth or reproduction of enteroviruses.

2. The use according to claim 1, wherein the FNC is 2 ' -deoxy-2 ' - β -fluoro-4 ' -azidocytosine having the formula:

3. the use according to claim 1, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

4. Use according to claim 3, wherein the FNC derivative is a FNC phosphate derivative.

5. The use according to claim 1, wherein said inhibition of the growth or propagation of enterovirus is capable of inhibiting the synthesis of enterovirus RNA.

6. The use according to claim 1, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the activity of the 3D protein of enterovirus.

7. The use of claim 1, wherein the enterovirus comprises enterovirus type a71, D68, coxsackievirus type a6, a16 and B3.

8. The use according to any one of claims 1 to 7, wherein the reagent is any one of clinically acceptable formulations prepared from FNC as an active ingredient in combination with a pharmaceutically acceptable carrier or adjuvant.

9. The use according to claim 8, wherein the dosage form is a tablet, capsule, granule, dispersion, injection or spray.

10. A pharmaceutical preparation for inhibiting enteroviruses, which comprises FNC or a derivative thereof and a pharmaceutically acceptable carrier or adjuvant, wherein the FNC or the derivative thereof can inhibit the growth or reproduction of the enteroviruses.

11. The pharmaceutical formulation according to claim 10, wherein the FNC is 2 ' -deoxy-2 ' - β -fluoro-4 ' -azidocytosidine having the formula:

12. the pharmaceutical formulation according to claim 10, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

13. The pharmaceutical formulation according to claim 12, wherein the FNC derivative is a FNC phosphate derivative.

14. The pharmaceutical formulation of claim 10, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the synthesis of enterovirus RNA.

15. The pharmaceutical preparation of claim 10, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the activity of the enterovirus 3D protein.

16. The pharmaceutical formulation of claim 10, wherein the enterovirus comprises enterovirus type a71, D68, coxsackievirus type a6, a16 and B3.

17. The pharmaceutical preparation according to any one of claims 10 to 16, wherein the preparation is any one of clinically acceptable dosage forms prepared by using FNC as an active ingredient and combining with a pharmaceutically acceptable carrier or adjuvant.

18. The pharmaceutical formulation of claim 17, wherein the dosage form is a tablet, capsule, granule, dispersion, injection, or spray.

19. Use of FNC or a derivative thereof in the manufacture of a medicament for the combined inhibition of enteroviruses and one or more other viral inhibitors, wherein the FNC or derivative thereof is capable of inhibiting the growth or reproduction of enteroviruses.

20. The use of claim 19, wherein the other virus is any one, any two or all of human immunodeficiency virus, hepatitis b virus and hepatitis c virus.

21. The use according to claim 19, wherein the FNC is 2 ' -deoxy-2 ' - β -fluoro-4 ' -azidocytosine having the formula:

22. the use according to claim 19, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

23. The use according to claim 22, wherein the FNC derivative is a FNC phosphate derivative.

24. The use of claim 19, wherein said inhibition of the growth or propagation of enterovirus is an inhibition of the RNA synthesis of enterovirus.

25. The use of claim 19, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the activity of the enterovirus 3D protein.

26. The use of claim 19, wherein the enterovirus comprises enterovirus type a71, D68, coxsackievirus type a6, a16 and B3.

27. The use according to any one of claims 19 to 26, wherein the reagent is any one of clinically acceptable dosage forms prepared by using FNC as an active ingredient and combining with a pharmaceutically acceptable carrier or adjuvant.

28. The use according to claim 27, wherein the dosage form is a tablet, capsule, granule, dispersion, injection or spray.

29. A combined inhibitor for inhibiting enterovirus and one or more other viruses, which comprises FNC or a derivative thereof capable of inhibiting the growth or reproduction of enterovirus and a pharmaceutically acceptable carrier or adjuvant.

30. The combination inhibitor of claim 29, wherein the other virus is any one, any two or all of human immunodeficiency virus, hepatitis b virus and hepatitis c virus.

31. The combination inhibitor of claim 29, wherein the FNC is 2 ' -deoxy-2 ' - β -fluoro-4 ' -azidocytosine having the formula:

32. the combination inhibitor according to claim 29, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

33. The combination inhibitor of claim 32, wherein the FNC derivative is a FNC phosphate derivative.

34. The combination inhibitor of claim 29, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the RNA synthesis of enterovirus.

35. The combination inhibitor of claim 29, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the activity of the enterovirus 3D protein.

36. The combination inhibitor of claim 29, wherein the enteroviruses comprise enterovirus type a71, D68, coxsackievirus type a6, a16 and B3.

37. The combined inhibitor according to any one of claims 29 to 36, wherein the preparation is any one of clinically acceptable dosage forms prepared by using FNC as an active ingredient and combining with a pharmaceutically acceptable carrier or auxiliary material.

38. The combination inhibitor as claimed in claim 37, wherein the dosage form is tablet, capsule, granule, dispersion, injection or spray.

39. A medicine for treating or preventing hand-foot-and-mouth disease caused by enterovirus is characterized by comprising FNC or derivatives thereof and pharmaceutically acceptable carriers or auxiliary materials thereof.

40. The medicament of claim 39, wherein said FNC is 2 ' -deoxy-2 ' - β -fluoro-4 ' -azidocytosine having the formula:

41. the medicament according to claim 39, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

42. The medicament according to claim 41, wherein the FNC derivative is a FNC phosphate derivative.

43. The medicament of claim 42, wherein the treatment or prevention of hand-foot-and-mouth disease is achieved by inhibiting the growth or reproduction of enteroviruses.

44. The medicament of claim 43, wherein the treatment or prevention of hand-foot-and-mouth disease is achieved by inhibiting the synthesis of enterovirus RNA.

45. The medicament of claim 42, wherein the treatment or prevention of hand-foot-and-mouth disease is achieved by inhibiting the activity of a 3D protein that is capable of inhibiting enteroviruses.

46. The medicament of claim 39, wherein the enteroviruses comprise enterovirus A71, D68, Coxsackie A6, A16 and B3.

47. The medicament according to any one of claims 39 to 46, wherein the medicament is any one clinically acceptable dosage form prepared by taking FNC as an active ingredient and matching with a pharmaceutically acceptable carrier or auxiliary material.

48. The medicament of claim 47, wherein the dosage form is tablet, capsule, granule, dispersion, injection or spray.

49. Use of FNC or its derivative in the preparation of a medicament for treating or preventing hand-foot-and-mouth disease caused by enterovirus, wherein the FNC or its derivative can inhibit the growth or reproduction of enterovirus.

50. The use according to claim 49, wherein the FNC is 2 ' -deoxy-2 ' - β -fluoro-4 ' -azidocytosine having the formula:

51. the use according to claim 49, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

52. The use according to claim 51, wherein the FNC derivative is a FNC phosphate derivative.

53. The use of claim 49, wherein said inhibition of the growth or propagation of an enterovirus is an inhibition of the RNA synthesis of an enterovirus.

54. The use according to claim 49, wherein the inhibition of the growth or propagation of enterovirus is an inhibition of the activity of the 3D protein of enterovirus.

55. The use of claim 49, wherein the enterovirus comprises enterovirus type A71, D68, coxsackievirus type A6, A16 and B3.

56. The use of claim 49, wherein the hand-foot-and-mouth disease is a hand-foot-and-mouth disease caused by enteroviruses type A71, D68, coxsackieviruses type A6, A16 and B3.

57. The use according to any one of claims 49 to 56, wherein the medicament is any one of clinically acceptable dosage forms prepared from FNC as an active ingredient in combination with a pharmaceutically acceptable carrier or adjuvant.

58. The use of claim 57, wherein the dosage form is a tablet, capsule, granule, dispersion, injection or spray.

59. A method for inhibiting the activity of enteroviruses in vitro, comprising adding FNC or a derivative thereof to a sample containing enteroviruses to inhibit the growth or reproduction of enteroviruses.

60. A method for inhibiting total RNA level of enteroviruses in vitro, comprising adding FNC or a derivative thereof to a sample containing enteroviruses to inhibit the growth or reproduction of enteroviruses.

61. A method for inhibiting in vitro the RNA-dependent RNA polymerase activity of enteroviruses, characterized in that FNC or a derivative thereof is added to a sample containing enteroviruses to inhibit the growth or propagation of enteroviruses.

62. A method for inhibiting enterovirus infection in vitro, comprising adding FNC or a derivative thereof to a sample containing enterovirus to inhibit the growth or reproduction of enterovirus.

63. The process of claims 59-62, wherein said FNC is 2 ' -deoxy-2 ' - β -fluoro-4 ' -azidocytosine having the formula:

64. the method of claims 59-62, wherein the FNC derivative is a pharmaceutically acceptable salt thereof.

65. The method of claim 64, wherein the FNC derivative is a FNC phosphate derivative.

66. The method of claims 59-62, wherein said inhibiting the growth or reproduction of an enterovirus is capable of inhibiting the synthesis of RNA from an enterovirus.

67. The method of claims 59-62, wherein said inhibiting the growth or reproduction of an enterovirus is capable of inhibiting the activity of a 3D protein of an enterovirus.

68. The method of claims 59-62, wherein the enterovirus comprises enterovirus type A71, D68, coxsackievirus type A6, A16 and B3.