CN110669860B

CN110669860B - Method for detecting strength of maize stalks and specific transposon thereof

Info

Publication number: CN110669860B
Application number: CN201911017281.0A
Authority: CN
Inventors: 林中伟
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2019-10-24
Filing date: 2019-10-24
Publication date: 2021-03-23
Anticipated expiration: 2039-10-24
Also published as: CN110669860A

Abstract

The invention discloses a method for detecting the strength of maize stalks and a specific transposon thereof. The invention provides application of a substance for detecting whether a promoter region of a maize gene Stiff1 contains a 27.2-kb Ty1/Copia transposon in identification or auxiliary identification of maize stalk strength to be detected; or, detecting whether a substance of 27.2-kb Ty1/Copia transposon is contained in the promoter region of the maize gene Stiff1 in the preparation of products for identifying or assisting in identifying the maize stalk strength to be detected; the nucleotide sequence of the 27.2-kb Ty1/Copia transposon is at positions 2156-29434 of the sequence 1. The invention discovers that the promoter region of the Stiff1 gene has a 27.3-kb Ty1/Copia transposon, and the transposon is related to the stalk strength. Therefore, the stalk strength of the maize can be judged by detecting the transposon in the promoter region of the Stiff1 gene.

Description

Method for detecting strength of maize stalks and specific transposon thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for detecting the strength of a corn stalk and a specific transposon thereof.

Background

In the 70 th 19 th century, along with the massive use of chemical fertilizers in agriculture, the semi-dwarf gene is widely applied all over the world, the lodging resistance of crops is greatly improved, the current rice and corn yield is doubled, and a potential grain crisis is effectively avoided. In the subsequent research, the Semi-Dwarf gene which is widely applied at the moment is related to Gibberellin (GA), namely Semi Dwarf-1(SD-1) in rice and Reduced height-1(Rht-1) in corn, and the disappearance or weakening of gibberellin signals can cause the reduction of the plant height of crops, and simultaneously can not cause other unfavorable forms and physiological properties, so that the mode of reducing the plant height by the gibberellin related gene to improve the lodging resistance of the crops is widely applied, and according to statistics, 72 percent of Semi-Dwarf rice seeds contain the SD-1 gene in the rice breeding process. With the continuous improvement of crop yield, the deficiency of a short stalk-lodging-high yield mode is gradually reflected, the short stalk can reduce the stalk-bending lodging of crops, but the disappearance or weakening of GA signals can reduce the plant height, but lead to the reduction of stalk thickness and lignin content in the stalks, and reduce the stalk strength and the crop biomass. Plants with high stalk strength can not only improve the lodging of the crop, but also improve the resistance of the crop to biotic and abiotic stresses, such as corn borer (Diatraea grandiosella D.), corn Gibberella zeae (Gibberella zeae), corn husky monascus (Diplodia zeae), nutrient stresses and the like. And theoretically, if the crop is not lodging, the high-stalk crop has higher biomass and yield, and the lower biomass of the short-stalk crop finally becomes a bottleneck of high yield. Therefore, the improvement of the stalk strength is an important strategy for improving the lodging resistance of crops in the future.

Corn, as a typical high-yielding C4 crop, can provide more than 30% of food calories for humans, and plays an important role in global food safety. The yield loss of the corn caused by lodging is about 5-20% every year worldwide, and the lodging resistance of the corn is increasingly required along with the development of the corn breeding towards the direction of close planting.

Disclosure of Invention

In order to detect or screen the corn with high stalk strength, the invention provides the following technical scheme:

it is an object of the present invention to provide the following applications:

the invention provides an application of substance identification or auxiliary identification of corn stalk strength to be detected for detecting whether a promoter region of a corn gene Stiff1 contains 27.2-kb Ty1/Copia transposon;

or, the invention provides the application of the substance for detecting whether the promoter region of the maize gene Stiff1 contains 27.2-kb Ty1/Copia transposon in the preparation of products for identifying or assisting in identifying the maize stalk strength to be detected;

the promoter region of the maize gene Stiff1 is a region 300bp-35kb upstream of the start codon of the maize gene Stiff 1.

In an embodiment of the invention, the nucleotide sequence of the promoter region of the maize gene Stiff1 is sequence 1 or sequence 2 or a derivative thereof;

the sequence 1 or the sequence 2 or the derivative thereof is a DNA molecule obtained by substituting and/or deleting and/or adding 1 or several nucleotides to the sequence 1 or the sequence 2.

The promoter region of the B73Stiff1 gene is a DNA molecule shown as a sequence 1 in the sequence table, wherein the 2156-position 29434 is a transposon sequence); the nucleotide sequence of the B73Stiff1 gene is a sequence 9. The Ki11stiff1 promoter sequence is a DNA molecule shown in sequence 2 in the sequence table.

The 27.2-kb Ty1/Copia transposon is a DNA molecule shown in the following (a1) or (a2) or (a3) or (a 4):

(a1) the nucleotide sequence is a DNA molecule at the 2156-29434 site of the sequence 1 in the sequence table;

(a2) a DNA molecule which has 75% or more identity with the nucleotide sequence defined in (a1) and encodes the same protein;

(a3) and (b) a DNA molecule which hybridizes with the nucleotide sequence defined in (a1) under stringent conditions and has the same function.

The invention provides an application of a substance for detecting whether a promoter region of a maize gene Stiff1 contains a 27.2-kb Ty1/Copia transposon in breeding high stalk strength maize;

or, the invention provides the application of the substance for detecting whether the promoter region of the maize gene Stiff1 contains 27.2-kb Ty1/Copia transposon in the preparation of high stalk strength maize products;

the nucleotide sequence of the promoter region of the maize gene Stiff1 is sequence 1 or sequence 2 or a derivative thereof;

In the above application, the substances for detecting whether the 27.2-kb Ty1/Copia transposon is contained in the promoter region of the maize gene Stiff1 include the following 1) or 2):

1) directly sequencing the required reagents or instruments;

2) amplifying the primers of the 27.2-kb Ty1/Copia transposon or a PCR reagent or kit containing the primers.

In the application, the primer consists of the following primers I1, I2 and I3;

the I1 primer consists of a DNA molecule or derivative shown in a sequence 3 and a DNA molecule or derivative shown in a sequence 4;

the I2 primer consists of a DNA molecule or derivative shown in a sequence 5 and a DNA molecule or derivative shown in a sequence 6;

the I3 primer consists of a DNA molecule or derivative shown in a sequence 7 and a DNA molecule or derivative shown in a sequence 8.

The derivative of each DNA molecule in the primer is a DNA molecule obtained by substituting and/or deleting and/or adding 1 or several nucleotides to each DNA molecule.

It is another object of the present invention to provide a method of:

the invention provides a method for identifying or assisting in identifying the strength of maize stalks to be detected, which comprises the following steps: detecting whether a promoter region of a maize gene Stiff1 to be detected contains a 27.2-kb Ty1/Copia transposon; the stalk strength of the corn to be detected containing the transposon is higher than that of the corn to be detected not containing the transposon;

The invention also provides a method for breeding the corn with high stalk strength, which is used for detecting whether the promoter region of the corn gene Stiff1 to be detected contains 27.2-kb Ty1/Copia transposon; breeding the corn to be detected containing the fragment to obtain the corn with high stalk strength;

the nucleotide sequence of the promoter region of the maize gene Stiff1 is sequence 1 or sequence 2;

In the method, the method for detecting whether the promoter region of the maize gene Stiff1 to be detected contains 27.2-kb Ty1/Copia transposon comprises the following steps: the primers are used for amplifying the corn to be detected,

if the I1 primer has an amplification product (2kb amplification product) and neither the I2 primer nor the I3 primer has an amplification product, the maize to be tested does not contain the 27.2kb Ty1/Copia transposon;

if the I1 primer has no amplification product and the I2 primer and the I3 primer both have amplification products (the amplification product of the I2 primer is 1k, and the amplification product of the I3 primer is 1.4k fragments), the maize to be tested contains 27.2kb Ty1/Copia transposon.

The 3 rd object of the present invention is to provide a product.

The product provided by the invention is a substance for detecting whether the promoter region of the maize gene Stiff1 contains 27.2-kb Ty1/Copia transposon;

the product has the following functions of 1) or 2):

1) identifying or assisting in identifying the strength of the corn stalks;

2) breeding high stalk strength corn;

the 3 rd object of the present invention is to provide a DNA fragment, which is a DNA molecule represented by (a1) or (a2) or (a3) or (a4) below:

(a2) a DNA molecule having 75% or more identity to the nucleotide sequence defined in (a1) and encoding the same amino acid residues;

The application of the DNA fragment in the identification or auxiliary identification of the corn stalk strength is also within the protection scope of the invention.

Experiments prove that the Stiff1 gene promoter region has a 27.3-kb Ty1/Copia transposon, and the transposon is related to stalk strength. Therefore, the stalk strength of the maize can be judged by detecting the transposon in the promoter region of the Stiff1 gene.

Drawings

FIG. 1 is a graph of transposon insertion sites correlated with stalk strength (BS).

FIG. 2 shows the results of population principal component analysis.

FIG. 3 shows verification of transposon insertion for PAV (present and present variation) of different primers.

FIG. 4 shows the stem strength measurements of backcross progeny 52220-178, 52220-zheng58, 52220-chang 72.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Inbred lines B73 and Ki11 were all conventional inbreds.

Example 1 discovery of transposon in promoter region of maize stalk strength gene Stiff1 and its correlation with stalk strength

First, discovery of transposon in promoter region of maize stalk strength gene Stiff1

Compared with the Kill inbred line, the Stiff1 gene (sequence 9) promoter region (sequence 1) of the typical hard stalk inbred line B73 has a 27.3kb Ty1/Copia transposon insertion at a position which is-1094-bp upstream from the initiation codon.

The nucleotide sequence of the 27.3kb Ty1/Copia transposon is at position 2156-29434 of the sequence 1 in the sequence table.

Taking a Ki11 inbred line as a standard, and taking a sequence of a Ki11stiff1 promoter region as a DNA molecule shown in a sequence 2 in a sequence table; it does not contain this transposon, and the hardness is not as high as B73.

Correlation analysis of insertion and shoot Strength of two, 27.3kb Ty1/Copia transposon

A set of 265 inbred corn lines from the world was used, containing 34 hard-stalk maize inbreds (stiff talk, SS), 75 Tropical inbreds (Tropical, tro),137 non-hard-stalk inbreds (NSS) and 19 background indeterminate inbreds. A3.3 kb fragment of these inbred lines was determined using pro primers (Forward TGGCTCTGCAACTACATTGT Reverse TTGTCTGCGCTTGTTTCC) including a 1.5-kb promoter region and a 1.8-kb ORF and 3' -UTR. This 3.3kb fragment does not contain 27.3kb and is used to detect mutations in the region immediately adjacent to the 27.3kb insertion site, for a total of 57 mutation sites. It was found by candidate association analysis that the insertion and deletion of this transposon had the highest correlation with stalk strength (BS) among the insertion and deletion variants and the other 57 variants (P ═ 1.19 × 10)^-5As in fig. 1, red arrow).

Next, a principal component analysis was performed on the population using genome-wide random SNPs, and it can be seen from the figure that the population can be clearly divided into three subgroups SS, NSS, and TRO. The proportion of transposon insertion events in the SS subpopulation was maximal, approximately 50%, compared to the other two subpopulations, which accounted for only 3.6% (NSS) and 16% (TRO). The above analysis showed that the transposon insertion was highly correlated with maize stalk strength. (FIG. 2+ represents lines containing transposon insertions-represents lines not containing transposon insertions).

The average stalk tension of the corn (+) with the transposon is 57.5N, the average stalk tension of the corn (-) without the transposon is 34.2N, and the significance is that P is 1.19 multiplied by 10^-5。

The result shows that the 27.2kb Ty1/Copia transposon is related to the corn stalk strength, and can be used for detecting the stalk strength of the corn to be detected, and the specific method comprises the following steps: and detecting whether the promoter region of the maize Stiff1 gene to be detected contains a 27.2kb Ty1/Copia transposon, wherein the strength of the maize stalk to be detected containing the transposon is higher than that of the maize to be detected not containing the transposon.

Thirdly, design and synthesis of transposon specific primer in promoter region of corn stalk strength gene Stiff1

Primers I1, I2 and I3 shown in Table 1 below were designed based on the position of the 27.2kb transposon:

the front primer and the back primer of I1 are respectively positioned at two sides of the insertion site of the 27.2kb transposon, the front primer of the I2 primer is positioned at the upstream of the insertion site of the 27.2kb transposon, the back primer is positioned on the 27.2kb transposon, the front primer of the I3 primer is positioned on the 27.2kb transposon, and the back primer is positioned at the downstream of the insertion site of the 27.2kb transposon. Transposon insertion was verified using PAV (present and present variation) of different primers (see FIG. 3).

TABLE 1

The I1, I2 and I3 primers corresponded to amplification product sizes of 2kb, 1kb and 1.4 kb.

Fourth, application of primer of promoter region transposon of corn stalk strength gene Stiff1 in identification of corn stalk strength

Genomic DNAs of maize inbred lines B73 and Ki11 were extracted as templates, and PCR amplification was performed using the above primers I1, I2, and I3.

The PCR amplification system is shown in the following Table 2:

TABLE 2

The KOD FX and 2 XKOD buffers described above were purchased from KOD FX TOYOBO Bio-Technology, CO., LTD.

The procedure for the PCR amplification is shown in Table 3 below:

TABLE 3

Detecting the PCR amplification product,

if the I1 primer has an amplification product of 2kb and neither the I2 primer nor the I3 primer has an amplification product, the 2 homologous chromosomes of the corn to be detected do not contain 27.2kb Ty1/Copia transposon;

if the I1 primer has no amplification product, and the amplification products of the I2 primer and the I3 primer are respectively 1k fragment and 1.4k fragment, the 2 homologous chromosomes of the corn to be detected all contain 27.2kb Ty1/Copia transposon;

if the I1 primer, the I2 primer and the I3 primer have amplification products of 2kb, 1kb and 1.4kb respectively, the corn 1 homologous chromosome to be detected contains 27.2kb Ty1/Copia transposon, and the other homologous chromosome does not contain 27.2kb Ty1/Copia transposon, and is a hybrid.

The strength of the stem of the maize to be tested containing the 27.2kb Ty1/Copia transposon is higher than that of the maize to be tested not containing the transposon.

The amplification product size of the I1 primer is 2kb (position 715-30779 of SEQ ID NO: 1), the amplification product size of the I2 primer is 1kb (position 1166-2260 of SEQ ID NO: 1), and the amplification product size of the I3 primer is 1.4kb (position 28181-29528 of SEQ ID NO: 1).

Example 2 application of 27.2kb Ty1/Copia transposon in promoter region of maize stalk Strength Gene Stiff1

Application of 27.2kb Ty1/Copia transposon in promoter region of maize stalk strength gene Stiff1

1. Transposon specific primer for identifying stem strength of corn to be detected

Genomic DNA of a maize inbred line 52220(https:// plants. usda. gov/core/profileymbol ═ ZEMA), a maize inbred line 178(Wei et al, A new alloy of the Brachytic2 gene in mail knowledge model architecture. Heredity,121,75-86 (2018.), zheng58 and chang72(Wei et al, A new alloy of the Brachytic2 gene in mail knowledge model architecture. Heredity,121,75-86 (2018.)) was extracted, respectively.

The genomic DNA of each inbred line was used as a template, and PCR amplification was performed using the primers I1, I2, and I3, respectively.

If the I1 primer has an amplification product and the I2 primer and the I3 primer have no amplification product, the 2 homologous chromosomes of the corn to be detected do not contain 27.2kb Ty1/Copia transposon;

if the I1 primer has no amplification product and the I2 primer and the I3 primer have amplification products, the 2 homologous chromosomes of the corn to be detected all contain 27.2kb Ty1/Copia transposon;

if the I1 primer, the I2 primer and the I3 primer all have amplification products, the maize 1 homologous chromosome to be tested contains 27.2kb Ty1/Copia transposon, and the other homologous chromosome does not contain 27.2kb Ty1/Copia transposon, and the maize is a hybrid.

The strength of the corn stalk to be detected containing the transposon is higher than that of the corn to be detected not containing the transposon.

As a result, the maize inbred line 52220 sample I1 had no amplification product, and I2 and I3 amplified 1kb and 1.4kb fragments, indicating that maize inbred line 52220 contains 27.2-kb Ty1/Copia transposon; the maize inbred lines 178, zheng58 and chang72 sample only amplified a 2kb fragment from I1, while I2 and I3 did not have amplified products, indicating that the maize inbred lines 178, zheng58 and chang72 samples do not contain 27.2-kb Ty1/Copia transposon; thus, the stalk strength of maize inbred line 52220 is greater than maize inbred line 178, zheng58 or chang 72.

2. Actual detection of stalk strength of corn to be detected

The force required for bending the corn by 20 degrees at a fixed height of 50cm by using a tension meter ELECALL, YLK-500, namely the stalk strength (BS) of the corn. 10-15 plants of each inbred line, and the experiment was repeated 3 times, and the results were averaged.

The stalk strength of maize inbred lines 52220, 178, zheng58 and chang72 are as follows: 63.48N,52.12N,47.38N, 40.27N.

It can be seen that the stem strength of maize inbred line 52220 is greater than 178, zheng58 and chang7, consistent with transposon specific primer identification results.

Second, application of transposon in promoter region of maize stalk strength gene Stiff1

1. Backcrossing

After hybridizing the maize inbred line 52220 containing 27.2kb transposon insertion as a female parent with maize inbred lines 178, zheng58 and chang72 which do not contain 27.2-kb transposon insertion, backcrossing for 1 generation to obtain backcross progeny 52220 and 178, 52220-zheng58 and 52220-chang 72.

2. Transposon specific primer for identifying stem strength of corn to be detected

Genomic DNAs of 70 backcross progenies 52220-178, 75 52220-zheng58 and 65 52220-chang72 were extracted as templates, and PCR amplification was performed using the primers I1, I2 and I3.

As a result, it was found that,

in the backcross progeny 52220-178, 15 strains contain 27.2-kb Ty1/Copia transposon, 18 strains do not contain 27.2-kb Ty1/Copia transposon, and 37 strains are heterozygous;

in the backcross progeny 52220-zheng58, 19 strains contained the 27.2-kb Ty1/Copia transposon, 17 strains did not contain the 27.2-kb Ty1/Copia transposon, and 39 strains were heterozygous;

in the backcross progeny 52220-chang72, 16 strains contained the 27.2-kb Ty1/Copia transposon, 15 strains did not contain the 27.2-kb Ty1/Copia transposon, and 34 strains were heterozygous.

Thus, in each backcross progeny, the stem strength of the strain containing the 27.2-kb Ty1/Copia transposon was higher than that of the strain not containing the 27.2-kb Ty1/Copia transposon.

3. Detection of stalk strength

Detecting the stem strength of backcross progeny 52220-.

As a result, as shown in fig. 4, it can be seen that,

the stem strength of the backcross progeny 52220-178 of the 15 strains containing the 27.2-kb Ty1/Copia transposon is higher than that of the backcross progeny 52220-178 of the 15 strains not containing the 27.2-kb Ty1/Copia transposon;

the stem strength of the backcross progeny 52220-zheng58 of the 15 strains containing the 27.2-kb Ty1/Copia transposon is higher than that of the backcross progeny 52220-zheng58 of the 15 strains not containing the 27.2-kb Ty1/Copia transposon;

the stem strength of the backcross progeny 52220-chang72 of the 15 strains containing the 27.2-kb Ty1/Copia transposon is higher than that of the backcross progeny 52220-chang72 of the 15 strains not containing the 27.2-kb Ty1/Copia transposon.

SEQUENCE LISTING

<110> university of agriculture in China

<120> a method for detecting the strength of maize stalks and a specific transposon thereof

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 31174

<212> DNA

<213>Zea mays Lin.

<400> 1

tttgatgaag ttttgaaatg agaggaaatg tgctgctctc ggccagcagc gcgtctgttt 60

ttataggcct ccgtagctcg gcaccaagat atgtggggcc gagctacgag gccgcgttgg 120

cgctgcgtaa gtgccatgtc agccctaggc gcagggagcc attactgcca catcatatct 180

cggcgccata gactgtggcg ccgaggtgtt acctcagcgc cacagcctat ggcgccgagt 240

atcgggtcca aacttgcata taaaatttct agggggtcca aacgtaaata tttttcaaaa 300

gtacgactga aaaagaaaaa attcggtgtc gcagccaggg cgtccgcatc ggcttcaaaa 360

ctaggttcaa tagagcacaa gagcagagct tcggtgaaca agcacaagaa cttagctata 420

ggttcagaga acaaaagctt ctaacgttat gtatttcttt ggatcctaaa tctttattcg 480

gttcacagaa aaatgacgat gcatactctc tagcttgtaa agttctatcc tattgtttca 540

gagcaagaaa gaagcaccct ctaggaggct tcacttgtaa tattattatg cacatcttca 600

cgtgcctaca atttctattt ttcagaattt aacaacttac tgatctttat cgtcgactag 660

tagaaactag gaaatcaaat agataaggat cgtttgctcc cttatatttt attttggctc 720

tgcaactaca tattgtttta taatttaatg aaagagagca tgttatttta tgtttttgat 780

agaagagtta tgaaagctat ctcttgatga agagttagta tattatacac acactctgaa 840

atcatatgat gttgtatatg caactattca tattatgagt catgtgtaaa tgagttgaga 900

cttatccaat atcattcagt attagtgtag atacttttat gaagtgctta aattagttag 960

accgctgata tagtacttgt tcttgatttt gtcctagtgt tacaagtgag gattagacac 1020

tcttatccct tcggtgcttg cacacataat tgtattagtt gtacaaaatg agctcgtaat 1080

cttgcaggat cacatcaact aagtttatcg tgtggatgtc agcgtgtact ggaggaaatg 1140

agacatatgg caatttgagc agaaaatcat gcgcaacaca aaagcacact actagagaat 1200

ataccatcgg tgccagtagg gaactggtta tagtatcgga tttccaacca gtactatgca 1260

atagatacta aagactaaag tatcgaaaag gtaaccagag agggtgaatg ggagccaatc 1320

aaattctgtt gcttaaaaac tggaacttga gcacttaact tcaatggaga tgaagaattc 1380

gctcaaaaca aaaacacatc aaccaaccag tggtcacatg tttcaaaaat gttcctagga 1440

ctcacgcgag acgatcaaaa tatatggatc gcaaatcgga caccaaaaag tctaaatcgg 1500

tccaaaacct tgtcgatatc tagttttcat caactaaaaa tttagttttt gaatgcgaaa 1560

ctaaaccaaa cggacttcga ttgagctgaa attttgcaca cacctttaca aatgagtctc 1620

caaggtctcc acaaaacttt aactcaaccg aatttataaa tcaatcgcag ataagaaaac 1680

ataaactaga tcggggctta gttggggttt tcaaaatgtg ttcagatcag atcacaacta 1740

caaactgctc aaaccaaatg attgcagtgg tctagagagt gatatttatc ccaagacaat 1800

ccccaactca ggaaatcaag gattattcaa aaatctaagg tagagaggaa acaagcgcag 1860

agacaaaatc gaataaaaaa ctttagcaca tacaaaactg agcacacgat ttgacgaact 1920

ctatggatgg atctggccac cccttccttt aaatgatgcg atgaagaata caaaagcaca 1980

tacatcgtgt tcaaaatcat ttgtggatct caggctaaac tagggaaata gaaactagtt 2040

ttctaaacga aacacaaatg agctagctaa agagatagtt gtccacaaca acccacccat 2100

ctatttatag agcgttattt cactagtcca aactacccct agagatacat agagcatatc 2160

tgaaagtcgc ctagaggggg ggtggatagg cggaaactga aatttacaaa ctttaagcac 2220

actacaagcc ggggttagcg ttagaatgaa atctgagtcc gggagagagg ggaaaacaaa 2280

tcaacaaaga aaataaagcg gatgacacgg tgatttgttt taccgaggtt cggttctaag 2340

aaacctagtc cccgttgagg tggtcacaaa gaccgggtct ctttcaaccc tttccctctc 2400

tcaaacggtc acctagaccg agtgagcttt ctccttaatc aaacgggtca cttagacccc 2460

acaagtacca ccacacactt ggtgtctctt gttttgatta caagtcactt agagaacaag 2520

aatgaggaag aagaacgcca accaagcaac aagagcaaca aggaaacaca agaaatgatc 2580

ctctcacaag tcctaaagac tagagttgaa ttggggactt tgatcagatt gaaggctttg 2640

atttgtgtct tggagtgttg tgttttgctc ttgtattgag tggagagtag tgaatgcttg 2700

gattgttgga gtggaggtgg ttgtggggta tttatagccc ccaaccacca attcaaccat 2760

tgggggtggc tgctgtcgat aggtgcaccg gacagtccgg tgcgccactg gacactgtcc 2820

ggtgcgccag ccacgtcacc caaccgttag ggttctggcg gtttcgaccg ttggagcttt 2880

gtcttctagt ggcactggac agtccggtgc cgcatcggac agacactgtt cactgtccgg 2940

tgcgcctctg gtggctgctc tgacttctgc gcgaactgtc cacgcattgt agtgttgtag 3000

gcgaccgttg cagccgaccg ttgcgctgtt agtcgttact ccacttggtg caccggacag 3060

tccggtgaca caccgtacag tctggtgaat tatagcggag cgacgcctga gaaacctgaa 3120

agtgaagagt ttggagtcgt atggccctgg tgcaccggac actgtcggtg gcacaccgga 3180

cagtcaggtg cgccctcttc ggtttctttt gctcctttct tttgaaccct aacttgatct 3240

ttatatcggt ttgtgttgaa cctttagcat ctgtagagta tataatctag agcaaactag 3300

ttagtacaat tatttgtgtt gggcattcaa ccaccaaaat tatttatagg aaaaggttaa 3360

cccctatttc cctttcaatc tccccatttt ggtgattgat gccaacacaa accaaagcaa 3420

acatataagt gcagaattga actagtttgc ataaggtaag tgcaaaggtt gcttggaatt 3480

aaaccaattt atatttttac tagatatgca tggttgcttt cttttgttta acattttgga 3540

ccacgcttgc atcacttgtt ttgtttttgc aaattctttt ggaaagcctt ttcaaagtct 3600

ttttgcaaaa tagtcaaagg tatatgaata agatttcgag aagcattttc aagatttgaa 3660

attttctccc cctgtttcaa attattttcc tttgacttta acaaaactcc ccctgaataa 3720

aattctcctc ttagtcttca agagggtttt agtaaatacc aattggaact tatacttagg 3780

tacaagtttt gaaattatac cagttgaaaa tcatcatacc catttgaaat atcttaacta 3840

aaagttttca tcataagata ccaactgaag agacaaacat aaatcatcat ttcgaaactt 3900

ttgaaggttg gtggtgcggt ccttttgctt tgggcttaat atttctcccc ctttggcatt 3960

aatcgccaaa aacggaggct tttgagagcc cttttttact ttctccccca ttggtacaag 4020

taaatatgag tgaaagatta taccaattta agagtgatgt ggagtgatga cgaagggtaa 4080

atgataccga tagagtggag tggaagcctt gtcttcaccg aagactccat ttccctttca 4140

atctacgact tagcatagaa atcacttgaa aacacattag tcgtaatcat aaaagagata 4200

tgatcaaagg tatattaatg agctatgtat gcaaagtttt aatcaaagtt ccgagaatca 4260

agtatatttg gctcattcct aagtttgcta aaagttttct catctaatgg tttggtaaag 4320

atatcggcta attgttgttt ggtgctaaca taagctatct cgatatcccc cctttgttgg 4380

tgatccctca aaaagtgata ccgaatgtct atgtgcttag tgcggctgtg ttcaacggga 4440

ttattgaaag ggaaatgtgc ccttgggcca tttctaagta ttttggtgat tgagtgccaa 4500

cacaagtgct taaatgtgaa tctatgctca tggatgaaca aagtgcaaat cacaagtaag 4560

gtatgtttct aagccttagt acattggttt tgtgtactaa tatacttgtc taagtgttag 4620

aaacagagag aagaagaaag aagaagagtt ggctgtgtac agccaaaagg ctgcttcggt 4680

ctggggcacc ggactgtccg gtggtgcacc ggacagtgtc cggtgcgcca ggctgccttg 4740

acctgaagac gccgctctcg ggaatttgcc gacggcgtac ggctaaaatt caccggactg 4800

tccggtgtgc accggactgt ccggtgagcc aacggtcggc agggccaacg gtcggccgcg 4860

caatctgcgc gagacacgtg gccgagccaa cggtcagaag ggggcaccgg actgtccggt 4920

gtgcaccgga catgtccggt gcgccatcgg ctcccagatc ttcaacggtc tgcaacggtc 4980

gactgcgctg tttaaggaaa taaatcgggc accggacagt gtccggtgtg caccggactg 5040

tccggtgcgc ccgacgacag aaggcaagga tggccttcca gatttgttct caacggctcc 5100

tagctgcctt ggggctataa aagggacccc taggcgcatg gaggagcaca ccaagcattc 5160

ctacaacctt tctaagcacc aagacattga tctcgcgcat tcgtttcatt gtgatagcat 5220

atagagctct tgtggggttg tgaactcttt gagttgtgtt gcgagctctt gttgctgctt 5280

gtgtgcgtgt tgttactctg attttgagtc ttgtgtgcgt tgctagttcc ctccttactt 5340

cgtatttctt tgtgaatctc aagtgtaagg gcgagaggct ccaaagttgt ggagattcct 5400

cgcaaacggg atattgagaa gaaaagcata acactgtggt attcaagttg atcattggat 5460

cacttgagag gagttgagtg caactctcgt ccgttgggac gccacaacgt ggagtaggca 5520

agtttttgta cttggccgaa ccacgggata aatcactgtg tcttctctgt gttgaacttc 5580

ttgtgattat cgttgtgtgc aagatcttcg ctctagccac ttggcatcaa ctgtgctaac 5640

acttaacaag tttttgtggc tataagttta agttttacag gatcacctat tcaccccccc 5700

ctctaggtgc tctcaattgg tatcaaaggc gttctcttca agaaagggac taaccgcccg 5760

aagagatgga tcctaagggg aagggaatca tgatcaacga taaggagaag gagtccttcg 5820

tcaacgagcc caaagaagac aagcctaccg actccggctc gggccataga cggaaggaag 5880

ggaagaagaa gaagacaagg cgcatcaagg agatcgtcta ctacgacgac agcgacgaat 5940

cttcctcttc ccaaaaggac aacgactatg acaaacaaaa gacggttaac tcaaactttt 6000

cttttgatta ttcgcgcatt ccgcatagtt caaatgctca tttgctcccc attccacttg 6060

gcaagcctcc tcactttgat ggagaggact acggattttg gagtcacaaa atgcgtactc 6120

acctattttc tctccatcca agcatttggg agattgtgga aagtggaatg aagtttgata 6180

gctcggatag tccttcattt attaatgaac agattcataa aaatgcacaa gctactactg 6240

tgttgctagc gtctttgtgc agggacgagt atcacaaggt gagcggcttg gacaatgcca 6300

agcagatttg ggacaccctc aagatctctc atgaggggaa tgatgtcacc ttactcacca 6360

agatggagtt ggtggagggc gagctcggac gattcgcgat gataaggggc gaggagccga 6420

cacaaacata caaccggctc aagatcctta tcaacaaaat aaggagctac ggaagcacgc 6480

gatggacgga tcacgacgtc gtccgcctaa tgctaaggtc atttaccgtt cttgatcctc 6540

acttggtgaa caatattcgt gaaaatccta ggtacatcaa gatgtcgccc gaggaaattc 6600

ttggaaaatt tgtaagcggg cggatgatga tcaaggaggc gaggtacgtg gacgacgcgt 6660

tgaatggccc aattcatgag cctcaaccca ttgctctcaa ggcaacaagg agcaaggagg 6720

cgctgcccag caaggtggcg caaattgagg cggccggtct taatgatgaa gagatggctc 6780

tcatcatcaa aagattcaag acggcactaa aaggtcgcaa gggacagcca agcaagacta 6840

agaccaaggg aaaacgatca tgcttcaaat gcggtaagct tggtcatttt attgctaact 6900

gtcccgacaa tgatagtgac caggaacacg ggagcaagag ggaaaagaag aagcattaca 6960

agaaggccaa gggcgaggca catatcggaa aggagtggga ttcggattgc tcctcctctg 7020

actccgacaa tgaaggactc gccgccactg ccttcaacaa gtcatccctc ttcccccacg 7080

agtgtcacac atgccttatg gcaagggaga agaaggtatg caatcaaaac aatgtcacct 7140

atgattcttc cagtgatgat gagtctagtg atgatgaaat agattactct agtttgttca 7200

agggattgga tagaactaaa gtagataaaa ttaatgaatt gattgatgcc ttgaatgaaa 7260

aagatagact cttagaaaaa caagaggacc ttttgtatga agagcatgac aaatttgtag 7320

aagcacaaaa atcttatgct ttagaagtta aaagaaatga agtgctttct agtgaactat 7380

cttcttgtca taaaaccatt gctactttaa agagtgttaa tgatgacttg aatgctaaac 7440

tagaagtagc tagtaaatct aagtcttgtg tagaacatgt tgagatttgc actaggtgta 7500

aagatttcga tgttgatgct tgtagtgatc atttagtttc aatttccaaa ttaactgagg 7560

atttggctag tcttaatgcc caacttaaga ctagcaagaa tgaatttgat aaactaaaat 7620

ttgcaagaga tgcctatacg atcggtagac acccctcaat taaggatggg cttggcttca 7680

agagggaagc caagaactta acaagccata aggctcccat ctccgccaag gagaaaggga 7740

aggcccctat ggcaagtagc actaaaagga atcattcttt tatatatcat gataggagac 7800

aaactagaaa tgcttatagg agttataatg catatgatga ttttaactct catgccatgt 7860

ttgcttctag ttcttccttt atgcatagta gaaatatgtc taggaaaaat gctatgccta 7920

gaaagaatat tactcatgct cctaggaaaa tagtgaatga accttctaca atttattgtg 7980

ctttaaatgc ttcctttgct atttgtagaa aggataagaa aattgttgct aggaagatag 8040

gggcaaaatg caagggagac aaaacttgca tttgggtccc taaggacatt tgcactaacc 8100

ttgtaggacc caacatgagt tgggtaccta agtcccaagc ctaaatttgc cttgcaggtt 8160

tatgcatccg ggggttcaag ctggattatc gacagcggat gcacaaacca tatgacgggg 8220

gagaagaaga tgttcacctc ctacgtcaag aataaggatt cccaagattc aattgtattc 8280

ggtgatggga atcaaggcaa ggtaaaaggg ttaggtaaaa ttgcaatttc taatgagcac 8340

tctatttcta atgtgttttt agtagagtct cttggttata atttgctatc tgttagtcaa 8400

ttatgcaata tgggatataa ttgtcttttt acaaacgtag atgtgtctgt ctttagaaga 8460

agtgatggtt cactagcttt taagggtgta ttagacgaca aactttattt agttgatttt 8520

gcaaaagaag aggccggtct agatgcatgc ttaatagcta agactagcat gggctggctg 8580

tggcatcgcc gcttagcaca tgtggggatg aagaaccttc acaagcttct aaagggagaa 8640

cacgtgatag gtttgagtaa cgttcaattc gaaaaagata gaccttgtgc agcttgtcaa 8700

gcaggtaaac aagtgggagg agcacatcac agcaagaatg tgatgaccac ttcaagaccc 8760

ctggagctgc tgcatatgga cctcttcgga cccgtcgcct atctgagcat aggagggagt 8820

aagtatggtc tagttattgt agatgatttt tcccgcttca cttgggtgtt ctttttgcag 8880

gataagtctg aaacccaagg gaccctcaag cgcttcctca ggagggctca aaatgagttt 8940

gagctcaagg tgaagaagat aaggagcgac aacgggtccg agttcaagaa ccttcaagtg 9000

gaggaatttc ttgaggagga agggatcaag cacgagttct ccgctcccta cacaccacag 9060

caaaatggtg tggtagagag gaagaacagg acgctaatcg acatggcaag gacaatgctt 9120

ggagaattca agacccccga gcgtttttgg tcggaagccg tgaacacggc ttgccatgcc 9180

atcaacaggg tctaccttca ccgcctcctc aagaagactt cgtatgagct gctaaccggt 9240

aacaaaccca atgtatctta ttttcgtgta tttgggagca agtgctacat tctagtgaag 9300

aaaggtagaa attctaagtt tgctcccaaa gcagtagaag ggtttttatt aggttatgac 9360

tcaaatacaa aggcgtatag agtcttcaac aaatcatcgg gtttggttga agtctcaagc 9420

gacgttgtat ttgatgagac taatggctct ccaagagagc aagttgttga ttgtgatgat 9480

gtagatgaag aagatgttcc aacggccgct atgcgcacca tggcaattgg tgatgtgcga 9540

ccacaggaac acttggagca agatcaacct tcttcctcaa ctatggtgca tcccccaact 9600

caagacgatg aacaggttca tcaacaggag gcgtgtgatc aagggggagc acaagctgat 9660

catgtgatgg aggaagaagc gcagccggca cctccaaccc aagttcgagc gatgattcaa 9720

agggatcatc tcgtcgacca aattctgggt gacattagca agggagtaac tactcgatct 9780

cgattagtta atttttgtga gcattactcc tttgtctctt ctattgagcc tttcagggta 9840

gaggaggcct tgctagatcc ggactgggtg ttggccatgc aggaggaact caacaacttc 9900

aagaggaatg aagtttggac actggtgcct cgtccgaagc aaaatgttgt gggaaccaag 9960

tgggtgttcc gcaacaaaca ggacgagcac ggggtggtga cgagaaacaa ggctcgactt 10020

gtggcaaaag gttatgccca agtcgcaggt ttggatttcg aggagacttt tgctcctgtg 10080

gctaggctag aatcaattcg tatcttgcta gcatatgccg ctcatcattc tttcaggttg 10140

taccaaatgg atgtgaagag cgcattcctc aacgggccaa tcaaggagga ggtgtacgtg 10200

gagcaacccc ctggcttcga ggatgaacgg taccccgacc atgtgtgtaa gctctctaag 10260

gcgctctatg gacttaagca agccccaaga gcatggtatg aatgccttag agactttata 10320

attgttaatg ctttcaaggt tgggaaagcc gatccaactc tttttacaaa gacatgtgat 10380

ggtgatttgt ttgtgtgcca aatttatgtc gatgacataa tatttggttc tactaaccaa 10440

aagtcttgtg aagagtttag cagggtgatg acgcagaaat tcgagatgtc aatgatgggc 10500

gagttgaact acttccttgg gttccaagtg aagcaactca aggacgacac cttcatctcc 10560

caaacgaagt acacgcaaga tctgctaaag cgatttggga tgaaggacgc caagcccgca 10620

aagactccga tgggaaccga cgggcacacc gacctcaaca aaggaggtaa gtccgttgat 10680

caaaaagcat accggtcaat gatagggtca ttactttatt tatgtgctag tagaccagat 10740

attatgctta gcgtatgcat gtgtgctaga tttcaatccg atcctaagga gtgtcactta 10800

gtggcggtga agcgaattct gagatattta gttgctacgc cttgcttcgg gctctggtat 10860

ccaaaggggt ctacctttga cttggttgga tactcagatt ccgactatgc tggatgtaag 10920

gtcgatagga agagtacatc ggggacgtgc caattcttag gaaggtccct ggtgtcgtgg 10980

aactctaaga aacaaacctc cgttgcccta tccaccgctg aggccgagta cgttgccgca 11040

ggacagtgtt gcacgcaact actttggatg aggcaaaccc tccgggactt tggctacaat 11100

ctgagcaaag tcccactcct atgtgacaat gagagtgcta tccgcatggc ggaaaatcct 11160

gttgagcaca gccgcacaaa gcacatagac atccggcatc actttttgag agaccaccag 11220

caaaaggggg atatcgaagt gttccatgtt agcaccgaga accagctagc cgatatcttt 11280

accaagcctc tagatgagaa gaccttttgc aggctgcgta gtgagctaaa tgtcttagat 11340

tcgcggaact tggattgact tgtagcatac atgtgtttat gcctttgatc atgttcattc 11400

tgcattttgt tgcttattgt ggtgctcaag ttgtataaac actccctgga cctcacaagt 11460

ccgttgctaa gtgatgcaca tgtttagggg gagatgtgtt acaacttgac cctttgagac 11520

taactatgta gttgagtttg cttgatttag tctcaaagga gaattgaaag ggaaaggtgg 11580

acttggacca tgaaagactt ccactgcact ccgatgagag ggtaacgtat tccaagtcat 11640

ccaatgaact cttattgcca tttgctctta attggagatt ttggtgaggc aaaggggtta 11700

aaagggccaa agttgatccc attttggtgc ttgatgccaa agggggagaa aataaaggcc 11760

aaagcaataa atggatcagc taccacttga gaaattttga aaatagtgaa atagaacttt 11820

ttgttttgtc aaaactctct tattatctct ttgtcaaaag ttggcttcct gtggggagaa 11880

gtagtgatta tgggaaaaag ggggagtttt tgaaatcttt gatcaatctc ttttgaaatg 11940

actctcttta tgcttcaaca tgtgtgtttg acttagagat agagatttga gtttgatttg 12000

caaaaacaaa ccaagtggtg gcaaaggatg atccatatat gccaaaattg aataaaactc 12060

aaatttgttt tatttgaagt gattttgcac ttgttctagt tgccttatgt tgtgttggca 12120

taaatcacca aaaaggggga gattgaaagg gaaatgtgcc cttgggccat ttctaagtat 12180

tttggtgatt gagtgccaac acaagtgctt aaatgtgaat ctatgctcat ggatgaacaa 12240

agtgcaaatc acaagtaagg tatgtttcta agccttagta cattggtttt gtgtactaat 12300

atacttgtct aagtgttaga aacagagaga agaagaaaga agaagagttg gctgtgtaca 12360

gccaaaaggc tgcttcggtc tggggcaccg gactgtccgg tggtgcaccg gacagtgtcc 12420

ggtgcgccag gctgccttga cctgaagacg ccgctctcgg gaatttgccg acggcgtacg 12480

gctaaaattc accggactgt ccggtgtgca ccggactgtc cggtgagcca acggtcggca 12540

gggccaacgg tcggccgcgc aatctgcgcg agacacgtgg ccgagccaac ggtcagaagg 12600

gggcaccgga ctatccggta tgcaccggac atgtccggtg cgccatcggc tcccagatct 12660

tcaacggtct gcaacggtcg actgcgctgt ttaaggaaat aaatcgggca ccggacagtg 12720

tccggtgtgc accggactgt ccggtgcgcc cgacgacaga aggcaaggat ggccttccag 12780

atttgttctc aacggctcct agctgccttg gggctataaa agggacccct aggcgcatgg 12840

aggagcacac caagcattcc tacaaccttt ctaagcacca agacattgat ctcgcgcatt 12900

cgtttcattg tgatagcata tagagctctt gtggggttgt gaactctttg agttgtgttg 12960

cgagctcttg ttgctgcttg tgtgcgtgtt gttactctga ttttgagtct tgtgtgcgtt 13020

gctagttccc tcctttcttc gtatttcttt gtgaatctca agtgtaaggg cgagaggctc 13080

caaagttgtg gagattcctc gcaaacggga tattgagaag aaaagcataa cactgtggta 13140

ttcaagttga tcattggatc acttgagagg agttgagtgc aactctcgtc cgttgggacg 13200

ccacaacgtg gagtaggcaa gtttttgtac ttggccgaac cacgggataa atcactgtgt 13260

cttctctgtg ttgaacttct tgtgattatc gttgtgtgca agatcttcgc tctagccact 13320

tggcatcaac tgtgctaaca cttaacaagt ttttgtggct ataagtttaa gttttacagg 13380

atcacctatt cacccccccc ccctctaggt gctctcaatt atccaccatg cggattgcac 13440

tctcattgtc acataggaga gggactttgc tcaatttgta gccatagtcc ctgagggttt 13500

gcctcatcca atgtaattgt gcacagcaat ggcctgcggc aatatactcg gcttcggcgg 13560

tagaaagagc tactgagttt tgtttctttg aagcccaaga cactagggat cttcccagaa 13620

actgacaagt ccctgatgtg ctctttctat caattttaca ccctgcccaa tcagcatctg 13680

aatatcttat taagtcaaaa gtggatccct tggggtacca aagtccaaac ttaggagtat 13740

aaactaaata tttcatgatt cttttcacgg ccctaaggtg aacttcctta ggattggctt 13800

ggaaccttgc acacatgcat atagaaagca taatatttgg tcgagatgca cataaataga 13860

gtaaagatcc tattatcgac cggtatacct tttgatctac ggatttacct cccgtgtcga 13920

ggccgagatg cccatttgtt cccatgggtg tcttgatggg tttggcatcc ttcatttcaa 13980

acttgttaag tatatcttga atgtactttg tttggctgat gaaggtgtca tcttggagtt 14040

gcttgacttg aaagcctagg aaatacttca actcccccat catagacatc tcgaatttct 14100

aaatcaggat cctacttgaa agggaaatag ggtcaaacct tttcctaaat gattttggtg 14160

gttgaattgc ccaacacaaa taattggact aactaatttg ctccagatta taagttctat 14220

aggtgctaaa ggttcaacac aaaccaataa aaagtctaag atagtgttca aaaagaaagg 14280

agcaaaacca gcagaaggct gccctggtct ggcgcaccag acagtgtccg gtgcaccagg 14340

gagatcaact ctgaactgct cagcttcgag tttttggaga gccactccgc tataattcac 14400

tggactatcc ggtgtagcac cggactgtcc ggtgtgccat gcggagcaac ggctactgcg 14460

ccaatggtcg tctgcaaaag tgaacagtga acgctacagt gcgtggacag ttcgcgcaga 14520

gttagagcag gcgccagaag gcgcaccaga cattgaacag tacctgtccg gtgcaccacc 14580

agactgtccg gtggccccag ctgtcagagc tccaacggtc aaaccctaac ggttgggtca 14640

cgtggctggc gcaccggaca gtgtccggtg gcgcaccaga ctgtccggtg cgcccatcga 14700

cagacagcct ccccaacgac cattttggtg gttggggcta taaatacccc caaccaccac 14760

acttcaaggc atccaagttt tcaaccattg cattcaatac aagagctcta gactttactc 14820

caagacacaa atcaaaagat caaatcctct ccaagttcca aactcattcc aaagacttag 14880

tggcttgtga gagagagaca ttcctgttca tttgagttct tgtcgcttgg atcgcttttc 14940

ttcttcctcc attcttgttc tcaagcaact tgtaatcaag caagagacac caagttgtgg 15000

tggaccttgt aagggtctaa gtaacccgtt gattaaggag aaaagctcac tcggtctagg 15060

tgaccgtttg agagagggaa agggttgaaa gggacccagt ctttatgacc acctcaacgg 15120

ggagtaggtt tgcaagaacc gaacctcggt aaaacaaatc accgtgtcat ccgccttatt 15180

tgcttgtgat ttgttttcgc cctctctttt ggacttgact ttatttctaa tgttaacccc 15240

ggcttgtagt tgtgcttaaa gtttataaat ttcagatttg cctattcacc cccctctagg 15300

cgactttcaa ttggtatcag agcccgatac ttcattagaa cctaaccgct cgaagtgatg 15360

tcgggagatt acgccaagaa ggagatggtg accggcgaga agcccgccac aagccacggg 15420

aaagctccat cggggcagtc tggtaacaag gtgaagggat ccccttcaca caacaagtcg 15480

catcggagcg gcgagaagaa aaagaagatg aagaaagtgg tcttctacga gaccgactct 15540

tcgtcgccat ccacctctgg ctccgacgcg ccgttcgtca cttctaagcg ccatgtgcgc 15600

aagaagttta gtaagatcca cctacgctac cctcgcattt ctaaacatac tcctttactt 15660

tccatcccat taggcaaacc actagtcttt aatggtgaag attatagtag gtggagtgat 15720

atgatgaggt atcacctcac ctcactccac acaagcatat gggacattgt tgaatttgga 15780

gcacaggtac catccgtagg ggatgaagat tatgatgcgg acaaagtcgc ccaaatccga 15840

cacttcaatt cccaagcaac tactatactc ctcacctctc taagtcgaga ggagtataat 15900

aaggtgcaag ggttgaagag tgccaaagag atttgggaca tactaaagac cgcacacgaa 15960

ggagacgagg tgaccaagat caccaagagg gaaacgatcg agggggagct cgatcggttc 16020

atgctcaacc aaggagaggt gccacaagct atgtacaact ggctcaagat cttggtcaac 16080

caagtgcgca acctcgggag cacaaaatgg gatgaccatg aaatggtcaa ggttattcta 16140

agatcacttg tttttcttaa tcctacacaa gtacaattaa ttcgtggtga tcctagatac 16200

aagctaatgt ctcccgagga agttataggg aagtttgtga ggcttgaatt gatgatcaaa 16260

ggctccaaac aaatcatcga gtgaggcgcc acctccacac ccgaggtgca acccgtcgca 16320

ttcaaagcga cggaggagaa gaaagaagag tctatgtcaa gtaggctccc catcgacgcc 16380

tccaagctcg acaacaagga gatggcgcta atcatcaaaa gctttcgcta aatccttaag 16440

caaaggaggg ggaaggatta caagccccgc ttcaagaaag tttgctacaa gtgtggtaag 16500

cctggtcatt ttattgctaa atgtccatta tcaagtgata gtgacagggg cgacgacaag 16560

aacagaaaga ggagggaaaa gaagagatac tacaagaagg gcggcgatgc ccatgtttgt 16620

cgggagtggg actccgacga gagctccatc gactcctcct ccgacgagga tgccgccaac 16680

atcgccgtca acaagggtct ccttttcccc aacgtcggcc acaagtgcct catggcaaaa 16740

gacggcaaaa ataagaaggt aaaatctaga gcttccacta aatatgcaac atctagtgat 16800

gagcctagct ctagtgatga tgaggatgat ttgcttacac tttttgccaa ccttaacatg 16860

caacaaaatg agaaattgaa tgaattgatt agtgctattc atgagaagga tgaactcttg 16920

gatagccaag aggacttgct tattaaagaa aaacaagaaa catgttaaag taaaaaatga 16980

ctatgctcag gaagtagaaa aatatgaaaa attaactagt gagcttagca tttgccatga 17040

cactatctct aaccttagaa ttgaaaatgc caaattaatt gctaaggttg agaaattaaa 17100

tgtttttgat aactctcttg tcaaccttaa aaatgataat gctagtttga ttgctaagat 17160

tgacaagttg aatgaatcac tttctagcct taagagtgag aatgataaat taatgtctaa 17220

ggctaaagat ttaaatgttt gcaatgtttc tatttccaat cttaagaatg aaaatgctat 17280

tttacatgct aagattgatg aattaaatgc atgtaaaccc tctacatcta ctattgatca 17340

tgtctccatt tgtactagat gtagagacat taatgttgat gctatccatg atcacctagc 17400

tttaattaaa caacaaaatg atcacatagc tcaacttagt gctaaaatta atgagcttga 17460

cttagaaaat gaaattttta aatttgctag aagtatgctc tatagtggga gacaccctgg 17520

cattaaggat ggcattggct tccaacagga aggcaatgcc aagcttaata cccctaagaa 17580

attatctaac tttgttaagg gcaaagatcc catggttcag gataacgagg gctatatttt 17640

atatcctact ggttatcccg aacacaagat taggagaatt cattctagga agtctcactc 17700

aagctctcat catgctttta tgtataagag tgaggcatct agttctagtc aatccactca 17760

tgttaaattg cctaaaaaga aaactcttac tgcaccaaat gagcctattg tttcatttaa 17820

gacttttgat gcttcatatg ttttaactaa caaatcaggt aaaatagttg ccaaatatgt 17880

tggggccaaa cacaagggct caaaaacttg tgtttgggta cccaaggtgc ttgtttctaa 17940

tgtcaaagga accaagaccg tttgggtacc taagaacaag gcctaaactt gttttgtagg 18000

tttatgcatc cgggggctca agttggataa ttaatagcgg gtgcacaaac cacatgactg 18060

gggagaaaag gatgttctcc tcttacaaga aaaatgaaga tccccaaaga gctatcacat 18120

tcggggatgg aaatcaaggt ttggtcaaag gacttggtaa aattgctata tcacctgacc 18180

attccatttc caatgttttt cttatagatt ctttatatta caatttgctt tttgtttctc 18240

aattatgcaa aatgggttac aactgtcttt ttacagatat aggtgttact gtctttagaa 18300

gaagtgatga ttcagtagca tttaagggag tattagaggg tcagctatac gtagttgatt 18360

ttaatagagc tgaactcgat acttgtttaa ttgctaagac taatatgagt tggctctgtc 18420

atcgccgact agcccatgtt gggatgaaga atcttcacaa gcttctaaag gaagaacaca 18480

ttttgggact aaccaatgtt cattttgaga aagacagggt ttgtagcgca tgccaagtag 18540

gaaagcaagt tggtgttcat catccacata agaacatcat gacgaccgac aggccacttg 18600

agctactcca catggaccta ttcggcccaa tagcttacat aagcatcggc gggagtaagt 18660

attgtcttgt tattgtgaat gattattctc gcttcacttg ggtgttcttt ttgcaggata 18720

aatctcaaac ccaagagacc ttaaagggat tcttgagacg ggctcaaaat gagtttgact 18780

tgaggatcaa aaagattaca agcgacaatg ggacggagtt caagaactct caaattgaag 18840

gctttcttga ggacgagggc atcaagcatg agttctcttc tccctacaca ccacaacaaa 18900

atggtgtagt ggagaggaag aatagaactc tatttgacat ggcgaggacc atgcttgatg 18960

agtacaagac ttcggaccgg ttttgggcgg aagcaatcaa caccgcttgc tacgccatca 19020

accgtctcta ccttcaccga atcctcaaga agacatccta tgaactccta aacagtaaaa 19080

agcccaatgt ttcatatttt agagtctttg gtagcaaatg ttttattctt attaaaagag 19140

gtagaaaatc taaatttgct cctaaggctg tagaaggctt tttacttggt tacgactcaa 19200

acacaagggc atatagagtc tttaacaagt ccactggact agttgaagtt tcttgtgaca 19260

ttgtgtttga tgagactaat ggctctcaag tagagcaagt tgatcttgat gagttagatg 19320

atgaagaggc tccatgcgcc tcactaagga acatgtccat cggggatgtg tgtcctaagg 19380

aatccgaaga gcctccacaa gcacaagatc atccttcatc ttccatgcaa gcatctccac 19440

caaaccaaga tgaggatcaa gctcaagatg atgaaaaaga agatcaagag gagccacctc 19500

aagaggagga caatgatcaa gggggagatg ctaatgatca agacaaggaa gatgatcagg 19560

gtccaagacc gcctcaccca agactccacc aagcaataca acgagatcac cccgtgaact 19620

ccatcctcgg cgatattcat aagggggtaa ccactcgatc tcgtgtcgct catttttgtg 19680

aacattactc ttttatgtct tctattgagc catacagggt ggaagactca ttaagagatt 19740

cagattgggt gttggcaatg caagaggaac tcaacaactt cacgaggaat gaggtatggc 19800

atcttgttcc acgtcctaat caaaatgttg taggaaccaa gtgggtcttc cacaataagc 19860

aagatgaaca tggtgtggtg acaaggaaca aagcccgact tatggccaag ggatattaac 19920

aagtcgaagg tttggatttc ggtgaaacct atgcacccgt agctaggctt gagtcaattc 19980

gcatattact tgcctatgct aattaccatg gctttaagct ttaccaaatg gacgtgaaaa 20040

gtgccttcct caatggacca atcaaggaag aggtctatgt tgagcaacct cctagctttg 20100

aagatagtga gtaccctaat catgtctata aactctcaaa ggcgctttat gggctcaagc 20160

aagccccaag agcatggtat gaatgcctga gagattttct tatcactaat ggcttaaaag 20220

tcggcaaagc cgatcctact ctctttacta aaaccattgc aaatgatttg tttgtatgcc 20280

aaatttatgt tgatgatatc atatttggat ctactaacaa atctacttgt gaagagttta 20340

gtaggattat gattcaaaaa tttgagatgt ctatgatggg ggagttgaag tacttcctag 20400

gatttcaagt gaagcaactc caagagggca ccttcattag ccaaacgaag tatattcaag 20460

acatactcac taagtttgga atgaaggatg ccaagcccat catgacaccc atgggaacca 20520

atgggcatct cgacctcgac acgggaggta aatccgtaga tcaaaaggta tatcggtcga 20580

tgataggatc tttactctat ttatgtgcat ctcgaccgga cattatgctt tccgtatgca 20640

tgtgtgcaag atttcaagcc gatcctaagg aagttcacct tacggccatg aaaagaatct 20700

tgagatattt agttcataca cttaaatttg gtctttggta ccccaaggga tccacctttg 20760

atttaatagg ttattcatat gctgattggg cagggtgtaa gattgataga aagagcacat 20820

cagggacttg tcagttcttg ggaagatccc tggtgtcttg ggcttcaatg aaacaaaatt 20880

cagtagctct ttctaccgcc gaagccgagt acattgccgt aggccattgt tgcgcgcaat 20940

tgctttggat gaggcaaacc cttagggact atggctacaa attaaccaaa gtccctctcc 21000

tatgtgataa tgagagtgca atctgcttgg cggataatcc cgttgagcac agccgcacta 21060

agcacatagc cattcggtat cactttttga gggatcaaca acaaaggggg gatatcgaga 21120

ttgcttatgt tagcaccaaa taacaattag ccgatatctt taccaaacca ctagatgaga 21180

aaacctttac caaacttagg aatgagctaa acattcttga ttctcggaat tttgattgat 21240

actttgcaca catagctcat ttatatacct ttgatcatat ctctttcatg tgctatgact 21300

aatgtgttgt tcaagtgtat ttcatgctaa gtcatagatt gaaagggaaa tggagtcttc 21360

ggcgaagaaa aggcttccac tccactctac cggtattatt tacccttcgc cgtcactcca 21420

catcgctctc caacattggt ataatccttc actcatatat tatttgccaa agggggagag 21480

aatttcataa gggctctaaa gactccgttt ttggcgatta atgccaaagg gggagagagt 21540

attagcccaa agcaaaagga tcgcaccacc acaccaattt caaaaatttt cgaaacaaag 21600

ttgttttcaa ttgatatctt tgaaattagt attcctctaa gaaattctat ctgatttgta 21660

tctatatttt aaggaggagt ttttcaaaat tggtatctaa aatacttgat cttctttcaa 21720

tttgtaaaac cctcttgaac actaagagga gaatttcatt aaggggagtt ttgtttagtc 21780

aaaggaaaaa catttgaaac agggggagaa aatttcaaat cttgaaaatg cttctcgaaa 21840

tcttattcat atacctttga ctatttgcaa aagactttga aaaagaattt ccaaaagaat 21900

ttgcaaaaac aaaacaagtg gtgcaaatgt ggtccaaaat gttaaaagga agaaagcaat 21960

ccatgcatat cttatagaag tttaaattgg tttaattcca agcaaccttt gcacttacct 22020

tatgcaaact agttcaattc tgcacttata tatttgcttt ggtttgtgtt ggcatcaatc 22080

accaaaaagg gggagattga aagggaaata gggtcaaacc ttttcctaaa tgattttggt 22140

ggttgaattg cccaacacaa ataattggac taactagttt gctctagatt ataagttcta 22200

caggtgccaa aggttcaaca caaaccaata aaaagtccaa gatagggttc aaaaagaaag 22260

gagcaaaacc aaccgaaggc tgccctggtc tggcgcaccg gactgtccgg tgtgccaccg 22320

gacagtgtcc ggtgcactag ggagatcaac tctgaactgc tcagcttcgg gtttttggag 22380

agccactccg ctataattca ccggactgtc cggtgtgcca tgcggagcaa cgactactgc 22440

gccaacggtc gtctgcaaaa gtgaacagtg aatgctatag tgtgcagaca gttcgcgcag 22500

agtcagagct ggcgccagaa ggcgcaccag acagtgaaca gtacctgtcc ggttcaccac 22560

cggactgtcc ggtgtggccc cagttgtcag agctccaacg gtcgaatcct aacggttggg 22620

tgacatggct gtcgcaccgg acaatgttcg gtggtgcacc ggactgtccg gtgcgcccat 22680

cgacagacag cctccccaac ggccattttg gtggttgggg ctataaatac ccctcaacca 22740

ccacacttca aggcatccaa gtttttcaac cattgcattc aatacaagag ctctagactt 22800

tactccaaga cacaaatcaa aagatcaaat cctctccaag tcccaaactc attccaaaga 22860

cttagtggct tgtgagagag agacattcgt gttcatttga gttcttgtcg cttggatcgc 22920

ttttcttctt cctccattct tgttctcaag caacttgtaa tcaagcaaga gacaccaagt 22980

tgtggtgatc cttgtaaggg gtctaagtga cccgttgatt aaggagaaaa gctcactcgg 23040

tctaggtgac cgtttgagag agggaaaggg ttgaaagaga cccggtcttt atgaccacct 23100

caacggggag taggtttgca agaaccgaac ctcggtaaaa caaatcactg tgtcatccgt 23160

cttatttctt gtgatttgtt ttcgccctct ctttcgaact cgactttatt tctaatgcta 23220

acctcggctt gtagttgtgc ttaaagttta taaatttcag atttgcctat tcactcccct 23280

ctaggcgact ttcactacta aactcttcac aagttgattt gttagtagac ccaaatatga 23340

tatcatcaac ataaatttgg catacaaaca aatcttttgc aatagtttta gtaaagagag 23400

taggatcgac tttaccgact ttgaagccgt tagtgataag aaaatcacgc aggcattcat 23460

accatgctct tgaggcttgc ttgagcccat aaagcgcctt tgagagttta taaacatggt 23520

tagggtactc actatcttca aagtcgggag gttgctcaac atagacctct tccttgattg 23580

gtccattgag gaagacactt ttcacgtcca tttgataaag cttaaagcca tggtaagtag 23640

cataggcaag taatatacga attgactcaa gcctagctac gggtgcatag gtttcaccaa 23700

aatccaaacc ttcgacttgt gaatatccct tggccacaag tcgggctttg ttccttgtca 23760

ccacaccatg ctcatcttgc ttgttgcgga atacccactt ggttcctaca acattttggt 23820

taggacatgg aactaaatgt catacctcat ttattgtgaa gttgttgagc tcctcttgca 23880

ttgccaacac ccaatctgaa tctcttagtg catcctccac cctgtatggc tcaatagagg 23940

acacaaagga gtaatgttca caaaaatgag cgactcgaga tcgagtggtt acccccttat 24000

gaatgtcacc gagaattgag ttcacggggt gatctctttg aatcgcttgg tggactcttg 24060

ggtgtggagg tctttgaccc taatcatctt ccttgtcttg atcaacttca tctccccctt 24120

gatcattgtc ctcctcttga ggtggctcat cctattgatc ctcatcttca ttgtcttgag 24180

cttgatcctc atcttcagtt tgtggagatg attgattgga agatgatggt tgatcttgtg 24240

cttgtgtggg ctcttcgaat tctttaggac acacatcccc aatggacatg ttccttagtg 24300

cgacacatgg agcctcttca tcatctagct catcaagatc aacttgctcc atttaggagc 24360

cattagtctc atcaaacaca atgtcacaag aaacctcaac taatccagtg tatttgttaa 24420

gactctaaat gcccttgtgt ttgagtcata accaagtaaa aagccatcta cagccttagg 24480

agcaaattta ggttttctac ctcttttaac aagaataaaa catttgctac caaagactgt 24540

aaaatatgaa acattgggct ttttaccggt gaggagttca taagatgtct tcttgaggat 24600

tcggtgaagg tagagccggt tgatggagta gcaggcgctg ttaatcgcct cagcccaaaa 24660

tcggtccgga gtcttgtact catcaagcat ggtcctcgcc atgtccaata gagttctatt 24720

cttcctctcc actacaccat tttgttgagg tgtgtaggga gaagagaact catgcttgat 24780

gccctcttcc tcaacaaagc cttcaatttg atagttcttg aactccgtcc cattgtcgct 24840

tcttatcttc ttgatcctta atccgaactc atttagagct catctcaaga atccctttaa 24900

ggtctcttgg gtctgagatt tttcttgtaa aaagaatacc caagtgaagc gagaataatc 24960

atccacaatt acaagccagt acttactcct gccgatgctt atgtaagcta tcaagccgaa 25020

taaatccatg tggagtaact ctagtggcct gtctgacgtc atgatgtttt tgtgtggatg 25080

atgtgtgcca acttgctttt ctgcttggca tgcgctacaa accctgtctt tctcaaaatg 25140

aacatttgtt agtcccaaaa tatgctctcc ctttagaaga ttgtgaagat tcttcatccc 25200

aacatgggct agtcggcgat gccagagcca acccatatta gtcttagcaa ttaagcaagt 25260

atcgagttca gctctattaa aataaactaa gtatagttga ccctctaata ctcccttaaa 25320

tgctactgaa tcatcacctc ttctaatgac agtaacacct atatccgtaa aaagacagtt 25380

gtagcccatt ttgcataatt gataaactga aaccaaattg taatctaaag aatctacaag 25440

aaaaacattg gaaatagaat ggtcaggtga tatagcaatt ttaccaagtc ctttgaccaa 25500

actttgattt ccatccccga atgtgatagc tctttgggga tcatcgtttt tctcatagga 25560

gaagaacatc cttttctccc ctgtcatgtg gtttgtgcat ccactatcaa taatccaact 25620

tgagcccccg aatccataaa cctgcaaaac aatttatgcc ttgttcttag gtacccaaac 25680

ggtcttgggt ccattcacat tagaaataag caccttgggt acccaaacac aagtcttgga 25740

gcccttgtgt ttgcccccaa catatttggc aactactttg cctgatttgt tagttaaaac 25800

ataagaagca tcaaaagtct taaatgaaat gttatgatca tttgatgcag taggagtttt 25860

ctttttaggc attttaacat gtgtagaatg cctagagcta gatgcctcat tcttatacat 25920

aaaagcatgg tgagaaacag aatgagacct ctcagcatga actctcctaa ttttgtgttc 25980

gggataacca acatgatata aaatatagcc ctcgttatcc tgaaccatgg gagccttgcc 26040

cttaacaaaa ttagacaatc ttttaggggc agtaagtttg acattgcttc cctgttggaa 26100

accaatgcca tccttgatgc cagggcgtct cccattatag agcatgcttc tagcaaattt 26160

aaaattttca ttttctatct catgctcctt gattttagca gttaattgag ctatatgatc 26220

attttgttgt ttaattaaag caaggtgatc atgaatagca tcaatattaa tgtctctaca 26280

tctagtacaa atagtaacat gatcaacact agaactagag ggattgcaaa catttaattc 26340

ttctatctta gcatttaata tgacattctc atctctaaga catgaaatag aatcattgta 26400

aacatttaaa tccttagcgt tggaaatcaa gctagcattt tcggtcctaa ggctagaaat 26460

tgattcattc aacttatcaa tcttagcaat taaagtagca ttatcatttc taagattgac 26520

aattgaatca tggcaaattc taagctcttt agtcagattt tcatttttct ctacttcctg 26580

agcataagca ttcttcacct taacatgatt tttattttcc ttaataagga atttctcttg 26640

gctatccaag agttcatcct tctcatgaat agctcctatc aattcattta atttttcttt 26700

ttgttgcatg ttaaggttgg caaaaagggt aagcaaatta tcttcatctt cactagagct 26760

accctcatca ctagatgttg tatatttagt gaaggctcta gattttacct tcttcctttt 26820

gccatcctta gccatgaggc actgtggccg acatttgaga agagaagtcc cttgttgaca 26880

gcgatgttgg cggtgtcctc gtcggaggag tcggtggagc tcatgtcgga gtcccattcc 26940

cggcacacgt gggcatcgcc gcccttcttc ttgtagtact tcttcttttc ctttctcttt 27000

cccctcttgt catcgcccct gtcactatca cttgacatag gacatttaac aatgaaatga 27060

ccgggcttac cacacttgta gcaccccctt ttagagcggg gtttgtagtc cttccccctc 27120

ctttgcttga ggatttggcg gaagctcttg atgatgagcg ccatctcctc gttgtcgagc 27180

ttggaggcgt cgatggggag cctacttgat gtagactctt ctttcttttc ctccgtcgct 27240

ttgaatgcga cgggttgcac ctcggtgttg tttggagcct ttgatcatca attcaaagct 27300

cacaaacttt cctataacct cctcgggaga cattagctta tatctaagat caccacgtat 27360

taattgaact tgcgtactat tacaaaaaat gagtgatctt agaataacat tgaccatttc 27420

atggtcatcc catttggtgc tcccgaggtt gcgcacttga ttcaccaagg tcttgagccg 27480

gttgtacata gcttgtggct cctctccttg attgaggacg aaacgaccga gctccccctc 27540

gatcgtctcc cgtttggtga tcttggtcac ctcatctccc tcgtgcgcgg tcttgagcac 27600

gtcccaaatc tccttggcac tcttcaaccc ttgcacctta ttatactcct ctcaacatag 27660

agaggcgatg agtatggtag tggcttggga gttgaagtgc cagatttggg tgacctcgtc 27720

cgagtcgtag ccctcgtccc ctacggatgg tacctgcgct ccaaactcaa caatgtccca 27780

tatacttgcg tggagtgagg ttaggtgatg cctcatttta tcactccaca tacaatagtc 27840

ttcaccatca aaaccggtgg tttgcctatt gggacaaaaa gtaaaggagt gcgtttagaa 27900

atgcggggat agcgtagggc gatcttacta aacttcttgc gctcatggca cttagaagtg 27960

acggacggag cgtcggagcc ggaggtggag ggcgacgaag aatcggtctc gtagtagacc 28020

actttcttca tctttttctt tttgtcgcca ctccggtgtg acttgacgcg ggaggtgatt 28080

cctcccttcc tttggtgtcg gactcccttg atggagcctt cccgtggctt gtgcccgttt 28140

ccatctccct cttggcggat cctcccgaca tcacttcgag tggttagact ctaatgaagt 28200

atcgcctttg ataccaattg aaagtcgcct agagggggtg gataggcgga aactgaaatt 28260

tacaaacttt aagcacacta caagctgtgg taagcgttag aatgaaatcc gagtccggga 28320

gagaggggaa aataaatcaa ccaacaaaat aaagcggatg acacggtgat ttgttttacc 28380

gaggttcggt tctaaggaac ctagtccccg ttgaggtggt cacaaagact gggtctgttt 28440

caaccctttc cctctctcaa acggtcacct agaccgagtg agctttctcc ttaatcaaac 28500

gggtcactta gaccccacaa ggaccaccac acacttggtg tctcttgttt tgattacaag 28560

tcacttagag aacaagaatg agaaagaaga aagccaacca agcaacaaga gcaacaagga 28620

aacataagaa acaatcctct cacaagtcct aaagactata attgaattgg ggactttgat 28680

cggatcaaag gctttgattt gtgtcttgga gtgttgtgtt ttgcttttgt attgaatgga 28740

gggtagtgaa tgtttggatt gttggagtgg aggtggttgt ggggtattta tagcccccaa 28800

ccaccaattc aaccgttggg ggtggctgct atcgatgggc gcaccggata gtccggtgtg 28860

ccaccggaca ctgtcaggtg cgccagccac gtcacccaac cgttagggtt ctggcggttt 28920

cgaccgttgg agctttgtct tctagtggca ccggacagtc cggtgccgca ccggacaggc 28980

actgtttact gtccggtgcg cctctggtgg ttgctctgac ttctgcgcga actgtccgcg 29040

cactgtagtg ttgcaggcga ccgttgcaag cgaccgttgc gttgttagcc gttgctccgc 29100

ttggtgcacc ggacagtcgg gtggcacacc ggacagtcca gtgaattata gcggagcgac 29160

gcctgagaaa cctgaaagtg aagagtttgg agtcgtacgg ccctggtgca ccggacactg 29220

cccggtggca caccggacag tccggtgcac cctcttcagt ttcttttgct cctttctttt 29280

gaaccctaac ttgatcttta tatcggtttg tgttgaacct ttagcacctg tagagtatat 29340

aatctagagc aaactagtta gtccaattat ttgtgttggg cattcaacca ccaaaattat 29400

ttataggaaa aggttaaccc ctatttccct ttcactatcc acttagctga ggcaaaatgg 29460

accaattcct atgattttga tctgacgacc acacactcta cacgaagttt tttcgcctcg 29520

acgcaccctt ttcgatgatg ccacgtgtcg catctgattc ttgttggaac cgcactaccg 29580

agttttgagg tccaaactca gcaaaattag caattgggtg atattgaggc tcaaccactg 29640

aaaccaccgt gagtagcgca ctgcatgcac gtcccacttc atagacacgt gtcccccagt 29700

ccttgaccgc gccagcaaca tgatttgctc tgccacgttc tcacgcaccc gtgtcgtgcg 29760

tgccttaggt gtcagccacc gcgcgactag tttcttggct tctctggtcc cttagtcaag 29820

tcccagcact cgtactttgc cactcccggt tcatcggcac gaatccgcat gaccttcata 29880

ttctgcgtca accatatcgt ccctgtggtc cacacctcca cttcataagc cgacagacat 29940

ggttgtacaa cacaagctct cgtactctgg ttagttcaag actcacagca aaacaatacc 30000

tgttggcaat ctctcattat caaaccgaat ctcaagggat aagtacgtca accttgtgtt 30060

cgcaaagacg tccaccttta ttcccgatta tatgatccga tactagaaat gacttttagt 30120

acttgttctt ggcttgaacc tgttggtgtt ttcaaccgca ctaagggctt gttcgttttt 30180

gcgttaatcc atgtggattg ggtgggattg agtcggatta aatccatagc aaatcaaaat 30240

ccatcccaat cccacccaat acacttcaat ccacatggaa tatcaataac cgaacaaggc 30300

ctaaagagtt gaaattcatt actggttcgt tactagaagt ctagaaccag tactgatgat 30360

atctgtgcat atttagtact ggttagtgtc tccaaccggt actaaagact taatattact 30420

agcacttgat gagggacact aataagtact aatgtactct atatggactc cggtctgcat 30480

ttaaaatcgg tgttgatgcc tatatgaata tgggttttaa aacaactcga ataaggggat 30540

gtttggtttc tagggactaa tgtttagtcc ctatatttta ttccatttta gttccaaaat 30600

tgctaaatat agaaactaaa actttatttt agtttctata tttagcaatt tatagactaa 30660

aaaggaataa aatgaaggga ctaaacatta gtccctagaa accaaacacc ccctaaatgt 30720

tgatgtagga agcctagttc tcttgccgtg gcgtttacag aaaaaaaaag actaaagtaa 30780

agtagcattc tccattatcg gtcgaattta gaagagaatg tgcagactca tttatcgctg 30840

tttgctaaga ttgggatctc aatcatattc gtttccgttc caagcagctt ttgccccggc 30900

cgtttggctg caaccttgca gggctcacat gaaatccctc agcatcctgc tgcatatcat 30960

ttgctacctt catggcttca gtccacactt cacacctgca ggcttgtagc tagctggatt 31020

ctcacacact ccccagctcc cacacgtcct ccgatccgat ccgatcccga tcctccagaa 31080

gaggggcgag ctgcaagcgt agggcggcag catgatgcac tcgcaccacc ctcactacca 31140

tccgcgtttc cacccgccgt cgtcctcctc gtct 31174

<210> 2

<211> 2477

<212> DNA

<213>Zea mays Linn.

<400> 2

attcatatta tgagccatgt gtaaatgagt tgagacttat ttccagtagc tatagacacc 60

taagtgctca aagatcattc aatattagtg tagatacttt tatgaagtgc ttagattagt 120

tagaccgctg ctatagcact tgttcttgat tttgtcctag tgttacaagt gaggattaga 180

cactcatatc cctttggtgc ttgcacacat aactatatta gttgtaccaa atgggcccat 240

aatcttgcaa gatcacatca actatgttta tggtgtggat gtcagcggtg tattggagga 300

aatgagacat atggcatttc gagcagaaaa tcatgtgcaa cacaaaagca cactactaga 360

gaatatatca tcggtgccgg ttgggaactg gttatagtat cagatttcca accggtacta 420

agcaacatat actaaagact gaagtatcga aaaggtaacc agagggggtg aatgggtgcc 480

aatcaaatta tgttgcttaa aaactggaac ttgagcactt aacttcaatg gagatgaaga 540

attcgctcaa aacaaaagaa catcaaccaa ccggtgtctt atatttcaaa aacgttccta 600

ggattcacgc gagaccaaca aaataaacgg atcgcaaatc ggacaccaaa aagtctaaat 660

cagtccaaaa ccatgtcgat atctagtgtt gttttcagta actcgaattt cagttttcga 720

atgcgaaact aaaccaaacg ggctctgatt gagctgaaat ttggcacaca cctttacaaa 780

tgagtctcca aggtctccac aaaattttaa ctcaaccgga tttataaatc aatcacagat 840

cagaaaacat agactagatc ggggcttagt tggggttttc aaaatgagtt cggatcggat 900

cacaaccata aactgctcaa accagatgat tgtagtggtc tagagagtga tatttatccc 960

aatacaacaa tccccaactc aataaatcaa ggattattcc aaaatctaag agaggaaacg 1020

agcgcggaga caaaatcgaa taaaaaactt cagcacatac aaactgagca cgcgatttgc 1080

caaatcctat ggatggatct ggccaccctt ccttaaagtg atgcgatgaa gaatacaaaa 1140

gcacagacat cgtgttcaaa tcatctatgg atctcacgct aaactaggga aatagaaact 1200

agagttttct aaatgaagca caaatgagct agctaaagag atagttgtcc acaataaccc 1260

acctatttat ttatagaggg ttatttcact agtctaaact acacctagaa atacatagag 1320

cctatccact tagccgaggc aaaatgaacc aactcttggg attttgatct gatgaccacg 1380

cgctgcacac gaaattgctt cgcctcgacg cacccttttt gatgatgtca cgtgccacat 1440

ctgattcttg ttggaacgac actatcgaga tttgaggtcc aaactcagca aaaccagcag 1500

ttgggtggtt ttgaggctca accaccgaaa gtttgaaacc accatgagta gcgcaccgaa 1560

tgcgcgtccc cgcgtcctgg acacatgtcc ccgagtcctt attgggctgg cgacatgatc 1620

tactctgcca cgttctcacg tgtccatgcg tgcctcaggt gtcagccacc acgactagtt 1680

tctcagcttc tctagctagt cctttagtca agttccagca ctcgtcattc gctgctcccg 1740

gtccatcggc actaacccgc atgaccttca ccttcggcgt caaccatatc gtccttgtgg 1800

tccacacctc cacttcataa gctgacatgc atggttgcac aacacaagct atcgtactct 1860

ggttagttca agacttacac caaagtaata cctgttgaca actctcgtta ttaacccaaa 1920

ccataaggga taagtcaacc ttgtgttcgc aaagatgtcc acaagattgg gatgaatata 1980

tgatgaatat atgaatatga atagatttga aaacaactcg aataaatgtt gatgtacgaa 2040

agcctagtta tcccgtagtg gcgttacaga aaataaaaaa aggactaaag taaagtagca 2100

ttctccatta tcggtcgaat ttggaagaaa atgtgcaaac tcatttatcg ctgtttgcta 2160

agattgggat ctcaatcata ttcgtttccg ttacaagcag cttttccccg tttggctgca 2220

actgcaacct tgcagggctc acatgaaatc cctcagcatc gtcctgctgc atatcatttg 2280

ctaccttcat ggcttcagtc cacacttcac acctgcaggc ttgtagctag ctggattctc 2340

acacactccc cagctcccac acgtcctccg atccgatcct ccagaagagg agcgagctgc 2400

aagcgtaggg cagcatgatg cactcgcacc accctcacta ccatccgcgt ttccacccgc 2460

cgtcgtctga ggaagtg 2477

<210> 3

<211> 30

<212> DNA

<213>Artificial sequence

<400>3

tggctctgca actacatatt gttttataat 30

<210> 4

<211> 28

<212> DNA

<213>Artificial sequence

<400> 4

ttcgaccgat aatggagaat gctacttt 28

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<400> 5

atcatgcgca acacaaaagc 20

<210> 6

<211> 20

<212> DNA

<213>Artificial sequence

<400>6

ttgttttccc ctctctcccg 20

<210> 7

<211> 25

<212> DNA

<213>Artificial sequence

<400> 7

ggttagactc taatgaagta tcgcc 25

<210> 8

<211> 22

<212> DNA

<213>Artificial sequence

<400> 8

gacacgtggc atcatcgaaa ag 22

<210> 9

<211> 1311

<212> DNA

<213>Artificial sequence

<400> 9

atgatgcact cgcaccaccc tcactaccat ccgcgtttcc acccgccgtc gtcctcctcg 60

tctgaggcgg tggacatgga cccccgcgtg tggagccggc tgccgcagcc gctggtggac 120

cgcgtgctgg cgtgcctacc gacgccatcc ttcctccgtc tccgggccgc ctgccgccgc 180

ttcggcaacc tcatctactc gtcgccgttc ctccactccc acctcctcct ctcgccgcac 240

ctccccttct tcgccttcgc cgtcccttcc gcggggtacc cgtacctcct cctgctcgac 300

cccaccacgc aggcgcccgc gccctcctgg tcccgcctcc cgctgccgct gccggccgcg 360

cccggcgccg tgcaggcggc gttctccccg gcggccgcgt cggcgggcct gctcgcgttc 420

ctgtcggacg cgtccggcca caagacgctg ctcctcgcca accccatcac gcgcctcctc 480

gcgccgctgc cgctctgccc caccgcgcgc ctctccccca ccgtcggcct cgccgcggga 540

cccacctcct tcatcgccgt cgttgccggc gacgacctcg tgtccccctt cgcggtcaag 600

aacatctccg cggacacgtt cgtcgccgac gccgcctccg tcccgccctc cggtttctgg 660

gcctcgagtt ccatcctgcc ccgcctctcc tccctcgacc cccgcgccgg catggctttc 720

gcctctggaa ggttctactg catgagctcg tcgccgttcg cggtgcttgt gttcgacgtg 780

gcaaccaacg tgtggagcaa ggtgcagccg ccgatgagga ggttcctgcg gtcgccggcg 840

ctcgtggagc tcggcggcgg gagggagcgc gaggcggtgg tggcgctggt ctccgccgtc 900

gaaaagagcc gcctcagcgt gccgcggagc gtgcgcgtgt ggacgctgcg aggcgagcac 960

ggagctgctg ccggcggaag caacggcggc ggagcgtgga ctgaggtggc gcggatgcca 1020

cccgacgtgc acgcgcagtt cgcggcggcc gagggcgggc gcgggttcga gtgcgcggcg 1080

cacggcgact tcgtggtgct ggcgccacgc gggcccgcga gccccgtgct cgtgttcgac 1140

tcgcgccacg acgagtggcg gtgggcgccg ccgtgcccgt acccgtaccc gtacgccgcg 1200

ggaggcgcgg ggttcagggt gttcgcctac gagccccgcc ttgcgacgcc ggccatcggt 1260

ctcctggacg ccacggcgcc ggcggccttt ttgcatggga tgcagggcta g 1311

Claims

1. Detecting whether a substance containing 27.2-kb Ty1/Copia transposon exists in a promoter region of a maize gene Stiff1 to identify the maize stalk strength to be detected;

the 27.2-kb Ty1/Copia transposon is a DNA molecule at position 2156-29434 of the sequence 1 in the sequence table.

2. Detecting whether a substance containing 27.2-kb Ty1/Copia transposon exists in a promoter region of a maize gene Stiff1 in the application of preparing and identifying a maize stalk strength product to be detected;

3. Detecting whether a substance of 27.2-kb Ty1/Copia transposon is contained in a promoter region of a maize gene Stiff1 or not in the application of breeding high stalk strength maize;

4. Use according to any one of claims 1 to 3, characterized in that:

the substances for detecting whether the promoter region of the maize gene Stiff1 contains the 27.2-kb Ty1/Copia transposon include the following 1) or 2) or 3):

1) directly sequencing the required reagents or instruments;

2) amplifying the primers of the 27.2-kb Ty1/Copia transposon;

3) PCR reagents containing the primers;

the primers consist of the following primers I1, I2 and I3;

the I1 primer consists of a DNA molecule shown in a sequence 3 and a DNA molecule shown in a sequence 4;

the I2 primer consists of a DNA molecule shown in a sequence 5 and a DNA molecule shown in a sequence 6;

the I3 primer consists of a DNA molecule shown in a sequence 7 and a DNA molecule shown in a sequence 8.

5. A method for identifying the strength of corn stalks to be detected comprises the following steps: detecting whether a promoter region of a maize gene Stiff1 to be detected contains a 27.2-kb Ty1/Copia transposon; the stalk strength of the corn to be detected containing the transposon is higher than that of the corn to be detected not containing the transposon;

6. A method for breeding corn with high stalk strength comprises the steps of detecting whether a promoter region of a corn gene to be detected Stiff1 contains a 27.2-kb Ty1/Copia transposon; breeding the corn to be detected containing the fragment to obtain the corn with high stalk strength;

7. The method according to claim 5 or 6, characterized in that:

the method for detecting whether the promoter region of the maize gene Stiff1 to be detected contains 27.2-kb Ty1/Copia transposon comprises the following steps: amplifying the maize to be tested with the primers of claim 4,

if the I1 primer has an amplification product and the I2 primer and the I3 primer have no amplification product, the maize to be detected does not contain the 27.2kb Ty1/Copia transposon;

if the I1 primer has no amplification product and the I2 primer and the I3 primer have amplification products, the maize to be tested contains 27.2kb Ty1/Copia transposon.

8. The application of the DNA fragment shown in the 2156-th 29434 site of the sequence 1 in the sequence table in the identification of the corn stalk strength.