CN110669860B - Method for detecting strength of maize stalks and specific transposon thereof - Google Patents
Method for detecting strength of maize stalks and specific transposon thereof Download PDFInfo
- Publication number
- CN110669860B CN110669860B CN201911017281.0A CN201911017281A CN110669860B CN 110669860 B CN110669860 B CN 110669860B CN 201911017281 A CN201911017281 A CN 201911017281A CN 110669860 B CN110669860 B CN 110669860B
- Authority
- CN
- China
- Prior art keywords
- transposon
- sequence
- maize
- primer
- copia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8226—Stem-specific, e.g. including tubers, beets
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a method for detecting the strength of maize stalks and a specific transposon thereof. The invention provides application of a substance for detecting whether a promoter region of a maize gene Stiff1 contains a 27.2-kb Ty1/Copia transposon in identification or auxiliary identification of maize stalk strength to be detected; or, detecting whether a substance of 27.2-kb Ty1/Copia transposon is contained in the promoter region of the maize gene Stiff1 in the preparation of products for identifying or assisting in identifying the maize stalk strength to be detected; the nucleotide sequence of the 27.2-kb Ty1/Copia transposon is at positions 2156-29434 of the sequence 1. The invention discovers that the promoter region of the Stiff1 gene has a 27.3-kb Ty1/Copia transposon, and the transposon is related to the stalk strength. Therefore, the stalk strength of the maize can be judged by detecting the transposon in the promoter region of the Stiff1 gene.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a method for detecting the strength of a corn stalk and a specific transposon thereof.
Background
In the 70 th 19 th century, along with the massive use of chemical fertilizers in agriculture, the semi-dwarf gene is widely applied all over the world, the lodging resistance of crops is greatly improved, the current rice and corn yield is doubled, and a potential grain crisis is effectively avoided. In the subsequent research, the Semi-Dwarf gene which is widely applied at the moment is related to Gibberellin (GA), namely Semi Dwarf-1(SD-1) in rice and Reduced height-1(Rht-1) in corn, and the disappearance or weakening of gibberellin signals can cause the reduction of the plant height of crops, and simultaneously can not cause other unfavorable forms and physiological properties, so that the mode of reducing the plant height by the gibberellin related gene to improve the lodging resistance of the crops is widely applied, and according to statistics, 72 percent of Semi-Dwarf rice seeds contain the SD-1 gene in the rice breeding process. With the continuous improvement of crop yield, the deficiency of a short stalk-lodging-high yield mode is gradually reflected, the short stalk can reduce the stalk-bending lodging of crops, but the disappearance or weakening of GA signals can reduce the plant height, but lead to the reduction of stalk thickness and lignin content in the stalks, and reduce the stalk strength and the crop biomass. Plants with high stalk strength can not only improve the lodging of the crop, but also improve the resistance of the crop to biotic and abiotic stresses, such as corn borer (Diatraea grandiosella D.), corn Gibberella zeae (Gibberella zeae), corn husky monascus (Diplodia zeae), nutrient stresses and the like. And theoretically, if the crop is not lodging, the high-stalk crop has higher biomass and yield, and the lower biomass of the short-stalk crop finally becomes a bottleneck of high yield. Therefore, the improvement of the stalk strength is an important strategy for improving the lodging resistance of crops in the future.
Corn, as a typical high-yielding C4 crop, can provide more than 30% of food calories for humans, and plays an important role in global food safety. The yield loss of the corn caused by lodging is about 5-20% every year worldwide, and the lodging resistance of the corn is increasingly required along with the development of the corn breeding towards the direction of close planting.
Disclosure of Invention
In order to detect or screen the corn with high stalk strength, the invention provides the following technical scheme:
it is an object of the present invention to provide the following applications:
the invention provides an application of substance identification or auxiliary identification of corn stalk strength to be detected for detecting whether a promoter region of a corn gene Stiff1 contains 27.2-kb Ty1/Copia transposon;
or, the invention provides the application of the substance for detecting whether the promoter region of the maize gene Stiff1 contains 27.2-kb Ty1/Copia transposon in the preparation of products for identifying or assisting in identifying the maize stalk strength to be detected;
the promoter region of the maize gene Stiff1 is a region 300bp-35kb upstream of the start codon of the maize gene Stiff 1.
In an embodiment of the invention, the nucleotide sequence of the promoter region of the maize gene Stiff1 is sequence 1 or sequence 2 or a derivative thereof;
the sequence 1 or the sequence 2 or the derivative thereof is a DNA molecule obtained by substituting and/or deleting and/or adding 1 or several nucleotides to the sequence 1 or the sequence 2.
The promoter region of the B73Stiff1 gene is a DNA molecule shown as a sequence 1 in the sequence table, wherein the 2156-position 29434 is a transposon sequence); the nucleotide sequence of the B73Stiff1 gene is a sequence 9. The Ki11stiff1 promoter sequence is a DNA molecule shown in sequence 2 in the sequence table.
The 27.2-kb Ty1/Copia transposon is a DNA molecule shown in the following (a1) or (a2) or (a3) or (a 4):
(a1) the nucleotide sequence is a DNA molecule at the 2156-29434 site of the sequence 1 in the sequence table;
(a2) a DNA molecule which has 75% or more identity with the nucleotide sequence defined in (a1) and encodes the same protein;
(a3) and (b) a DNA molecule which hybridizes with the nucleotide sequence defined in (a1) under stringent conditions and has the same function.
The invention provides an application of a substance for detecting whether a promoter region of a maize gene Stiff1 contains a 27.2-kb Ty1/Copia transposon in breeding high stalk strength maize;
or, the invention provides the application of the substance for detecting whether the promoter region of the maize gene Stiff1 contains 27.2-kb Ty1/Copia transposon in the preparation of high stalk strength maize products;
the nucleotide sequence of the promoter region of the maize gene Stiff1 is sequence 1 or sequence 2 or a derivative thereof;
the sequence 1 or the sequence 2 or the derivative thereof is a DNA molecule obtained by substituting and/or deleting and/or adding 1 or several nucleotides to the sequence 1 or the sequence 2.
The 27.2-kb Ty1/Copia transposon is a DNA molecule shown in the following (a1) or (a2) or (a3) or (a 4):
(a1) the nucleotide sequence is a DNA molecule at the 2156-29434 site of the sequence 1 in the sequence table;
(a2) a DNA molecule which has 75% or more identity with the nucleotide sequence defined in (a1) and encodes the same protein;
(a3) and (b) a DNA molecule which hybridizes with the nucleotide sequence defined in (a1) under stringent conditions and has the same function.
In the above application, the substances for detecting whether the 27.2-kb Ty1/Copia transposon is contained in the promoter region of the maize gene Stiff1 include the following 1) or 2):
1) directly sequencing the required reagents or instruments;
2) amplifying the primers of the 27.2-kb Ty1/Copia transposon or a PCR reagent or kit containing the primers.
In the application, the primer consists of the following primers I1, I2 and I3;
the I1 primer consists of a DNA molecule or derivative shown in a sequence 3 and a DNA molecule or derivative shown in a sequence 4;
the I2 primer consists of a DNA molecule or derivative shown in a sequence 5 and a DNA molecule or derivative shown in a sequence 6;
the I3 primer consists of a DNA molecule or derivative shown in a sequence 7 and a DNA molecule or derivative shown in a sequence 8.
The derivative of each DNA molecule in the primer is a DNA molecule obtained by substituting and/or deleting and/or adding 1 or several nucleotides to each DNA molecule.
It is another object of the present invention to provide a method of:
the invention provides a method for identifying or assisting in identifying the strength of maize stalks to be detected, which comprises the following steps: detecting whether a promoter region of a maize gene Stiff1 to be detected contains a 27.2-kb Ty1/Copia transposon; the stalk strength of the corn to be detected containing the transposon is higher than that of the corn to be detected not containing the transposon;
the nucleotide sequence of the promoter region of the maize gene Stiff1 is sequence 1 or sequence 2 or a derivative thereof;
the sequence 1 or the sequence 2 or the derivative thereof is a DNA molecule obtained by substituting and/or deleting and/or adding 1 or several nucleotides to the sequence 1 or the sequence 2.
The 27.2-kb Ty1/Copia transposon is a DNA molecule shown in the following (a1) or (a2) or (a3) or (a 4):
(a1) the nucleotide sequence is a DNA molecule at the 2156-29434 site of the sequence 1 in the sequence table;
(a2) a DNA molecule which has 75% or more identity with the nucleotide sequence defined in (a1) and encodes the same protein;
(a3) and (b) a DNA molecule which hybridizes with the nucleotide sequence defined in (a1) under stringent conditions and has the same function.
The invention also provides a method for breeding the corn with high stalk strength, which is used for detecting whether the promoter region of the corn gene Stiff1 to be detected contains 27.2-kb Ty1/Copia transposon; breeding the corn to be detected containing the fragment to obtain the corn with high stalk strength;
the nucleotide sequence of the promoter region of the maize gene Stiff1 is sequence 1 or sequence 2;
the 27.2-kb Ty1/Copia transposon is a DNA molecule shown in the following (a1) or (a2) or (a3) or (a 4):
(a1) the nucleotide sequence is a DNA molecule at the 2156-29434 site of the sequence 1 in the sequence table;
(a2) a DNA molecule which has 75% or more identity with the nucleotide sequence defined in (a1) and encodes the same protein;
(a3) and (b) a DNA molecule which hybridizes with the nucleotide sequence defined in (a1) under stringent conditions and has the same function.
In the method, the method for detecting whether the promoter region of the maize gene Stiff1 to be detected contains 27.2-kb Ty1/Copia transposon comprises the following steps: the primers are used for amplifying the corn to be detected,
if the I1 primer has an amplification product (2kb amplification product) and neither the I2 primer nor the I3 primer has an amplification product, the maize to be tested does not contain the 27.2kb Ty1/Copia transposon;
if the I1 primer has no amplification product and the I2 primer and the I3 primer both have amplification products (the amplification product of the I2 primer is 1k, and the amplification product of the I3 primer is 1.4k fragments), the maize to be tested contains 27.2kb Ty1/Copia transposon.
The 3 rd object of the present invention is to provide a product.
The product provided by the invention is a substance for detecting whether the promoter region of the maize gene Stiff1 contains 27.2-kb Ty1/Copia transposon;
the product has the following functions of 1) or 2):
1) identifying or assisting in identifying the strength of the corn stalks;
2) breeding high stalk strength corn;
the 3 rd object of the present invention is to provide a DNA fragment, which is a DNA molecule represented by (a1) or (a2) or (a3) or (a4) below:
(a1) the nucleotide sequence is a DNA molecule at the 2156-29434 site of the sequence 1 in the sequence table;
(a2) a DNA molecule having 75% or more identity to the nucleotide sequence defined in (a1) and encoding the same amino acid residues;
(a3) and (b) a DNA molecule which hybridizes with the nucleotide sequence defined in (a1) under stringent conditions and has the same function.
The application of the DNA fragment in the identification or auxiliary identification of the corn stalk strength is also within the protection scope of the invention.
Experiments prove that the Stiff1 gene promoter region has a 27.3-kb Ty1/Copia transposon, and the transposon is related to stalk strength. Therefore, the stalk strength of the maize can be judged by detecting the transposon in the promoter region of the Stiff1 gene.
Drawings
FIG. 1 is a graph of transposon insertion sites correlated with stalk strength (BS).
FIG. 2 shows the results of population principal component analysis.
FIG. 3 shows verification of transposon insertion for PAV (present and present variation) of different primers.
FIG. 4 shows the stem strength measurements of backcross progeny 52220-178, 52220-zheng58, 52220-chang 72.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Inbred lines B73 and Ki11 were all conventional inbreds.
Example 1 discovery of transposon in promoter region of maize stalk strength gene Stiff1 and its correlation with stalk strength
First, discovery of transposon in promoter region of maize stalk strength gene Stiff1
Compared with the Kill inbred line, the Stiff1 gene (sequence 9) promoter region (sequence 1) of the typical hard stalk inbred line B73 has a 27.3kb Ty1/Copia transposon insertion at a position which is-1094-bp upstream from the initiation codon.
The nucleotide sequence of the 27.3kb Ty1/Copia transposon is at position 2156-29434 of the sequence 1 in the sequence table.
Taking a Ki11 inbred line as a standard, and taking a sequence of a Ki11stiff1 promoter region as a DNA molecule shown in a sequence 2 in a sequence table; it does not contain this transposon, and the hardness is not as high as B73.
Correlation analysis of insertion and shoot Strength of two, 27.3kb Ty1/Copia transposon
A set of 265 inbred corn lines from the world was used, containing 34 hard-stalk maize inbreds (stiff talk, SS), 75 Tropical inbreds (Tropical, tro),137 non-hard-stalk inbreds (NSS) and 19 background indeterminate inbreds. A3.3 kb fragment of these inbred lines was determined using pro primers (Forward TGGCTCTGCAACTACATTGT Reverse TTGTCTGCGCTTGTTTCC) including a 1.5-kb promoter region and a 1.8-kb ORF and 3' -UTR. This 3.3kb fragment does not contain 27.3kb and is used to detect mutations in the region immediately adjacent to the 27.3kb insertion site, for a total of 57 mutation sites. It was found by candidate association analysis that the insertion and deletion of this transposon had the highest correlation with stalk strength (BS) among the insertion and deletion variants and the other 57 variants (P ═ 1.19 × 10)-5As in fig. 1, red arrow).
Next, a principal component analysis was performed on the population using genome-wide random SNPs, and it can be seen from the figure that the population can be clearly divided into three subgroups SS, NSS, and TRO. The proportion of transposon insertion events in the SS subpopulation was maximal, approximately 50%, compared to the other two subpopulations, which accounted for only 3.6% (NSS) and 16% (TRO). The above analysis showed that the transposon insertion was highly correlated with maize stalk strength. (FIG. 2+ represents lines containing transposon insertions-represents lines not containing transposon insertions).
The average stalk tension of the corn (+) with the transposon is 57.5N, the average stalk tension of the corn (-) without the transposon is 34.2N, and the significance is that P is 1.19 multiplied by 10-5。
The result shows that the 27.2kb Ty1/Copia transposon is related to the corn stalk strength, and can be used for detecting the stalk strength of the corn to be detected, and the specific method comprises the following steps: and detecting whether the promoter region of the maize Stiff1 gene to be detected contains a 27.2kb Ty1/Copia transposon, wherein the strength of the maize stalk to be detected containing the transposon is higher than that of the maize to be detected not containing the transposon.
Thirdly, design and synthesis of transposon specific primer in promoter region of corn stalk strength gene Stiff1
Primers I1, I2 and I3 shown in Table 1 below were designed based on the position of the 27.2kb transposon:
the front primer and the back primer of I1 are respectively positioned at two sides of the insertion site of the 27.2kb transposon, the front primer of the I2 primer is positioned at the upstream of the insertion site of the 27.2kb transposon, the back primer is positioned on the 27.2kb transposon, the front primer of the I3 primer is positioned on the 27.2kb transposon, and the back primer is positioned at the downstream of the insertion site of the 27.2kb transposon. Transposon insertion was verified using PAV (present and present variation) of different primers (see FIG. 3).
TABLE 1
The I1, I2 and I3 primers corresponded to amplification product sizes of 2kb, 1kb and 1.4 kb.
Fourth, application of primer of promoter region transposon of corn stalk strength gene Stiff1 in identification of corn stalk strength
Genomic DNAs of maize inbred lines B73 and Ki11 were extracted as templates, and PCR amplification was performed using the above primers I1, I2, and I3.
The PCR amplification system is shown in the following Table 2:
TABLE 2
The KOD FX and 2 XKOD buffers described above were purchased from KOD FX TOYOBO Bio-Technology, CO., LTD.
The procedure for the PCR amplification is shown in Table 3 below:
TABLE 3
Detecting the PCR amplification product,
if the I1 primer has an amplification product of 2kb and neither the I2 primer nor the I3 primer has an amplification product, the 2 homologous chromosomes of the corn to be detected do not contain 27.2kb Ty1/Copia transposon;
if the I1 primer has no amplification product, and the amplification products of the I2 primer and the I3 primer are respectively 1k fragment and 1.4k fragment, the 2 homologous chromosomes of the corn to be detected all contain 27.2kb Ty1/Copia transposon;
if the I1 primer, the I2 primer and the I3 primer have amplification products of 2kb, 1kb and 1.4kb respectively, the corn 1 homologous chromosome to be detected contains 27.2kb Ty1/Copia transposon, and the other homologous chromosome does not contain 27.2kb Ty1/Copia transposon, and is a hybrid.
The strength of the stem of the maize to be tested containing the 27.2kb Ty1/Copia transposon is higher than that of the maize to be tested not containing the transposon.
The amplification product size of the I1 primer is 2kb (position 715-30779 of SEQ ID NO: 1), the amplification product size of the I2 primer is 1kb (position 1166-2260 of SEQ ID NO: 1), and the amplification product size of the I3 primer is 1.4kb (position 28181-29528 of SEQ ID NO: 1).
Example 2 application of 27.2kb Ty1/Copia transposon in promoter region of maize stalk Strength Gene Stiff1
Application of 27.2kb Ty1/Copia transposon in promoter region of maize stalk strength gene Stiff1
1. Transposon specific primer for identifying stem strength of corn to be detected
Genomic DNA of a maize inbred line 52220(https:// plants. usda. gov/core/profileymbol ═ ZEMA), a maize inbred line 178(Wei et al, A new alloy of the Brachytic2 gene in mail knowledge model architecture. Heredity,121,75-86 (2018.), zheng58 and chang72(Wei et al, A new alloy of the Brachytic2 gene in mail knowledge model architecture. Heredity,121,75-86 (2018.)) was extracted, respectively.
The genomic DNA of each inbred line was used as a template, and PCR amplification was performed using the primers I1, I2, and I3, respectively.
If the I1 primer has an amplification product and the I2 primer and the I3 primer have no amplification product, the 2 homologous chromosomes of the corn to be detected do not contain 27.2kb Ty1/Copia transposon;
if the I1 primer has no amplification product and the I2 primer and the I3 primer have amplification products, the 2 homologous chromosomes of the corn to be detected all contain 27.2kb Ty1/Copia transposon;
if the I1 primer, the I2 primer and the I3 primer all have amplification products, the maize 1 homologous chromosome to be tested contains 27.2kb Ty1/Copia transposon, and the other homologous chromosome does not contain 27.2kb Ty1/Copia transposon, and the maize is a hybrid.
The strength of the corn stalk to be detected containing the transposon is higher than that of the corn to be detected not containing the transposon.
As a result, the maize inbred line 52220 sample I1 had no amplification product, and I2 and I3 amplified 1kb and 1.4kb fragments, indicating that maize inbred line 52220 contains 27.2-kb Ty1/Copia transposon; the maize inbred lines 178, zheng58 and chang72 sample only amplified a 2kb fragment from I1, while I2 and I3 did not have amplified products, indicating that the maize inbred lines 178, zheng58 and chang72 samples do not contain 27.2-kb Ty1/Copia transposon; thus, the stalk strength of maize inbred line 52220 is greater than maize inbred line 178, zheng58 or chang 72.
2. Actual detection of stalk strength of corn to be detected
The force required for bending the corn by 20 degrees at a fixed height of 50cm by using a tension meter ELECALL, YLK-500, namely the stalk strength (BS) of the corn. 10-15 plants of each inbred line, and the experiment was repeated 3 times, and the results were averaged.
The stalk strength of maize inbred lines 52220, 178, zheng58 and chang72 are as follows: 63.48N,52.12N,47.38N, 40.27N.
It can be seen that the stem strength of maize inbred line 52220 is greater than 178, zheng58 and chang7, consistent with transposon specific primer identification results.
Second, application of transposon in promoter region of maize stalk strength gene Stiff1
1. Backcrossing
After hybridizing the maize inbred line 52220 containing 27.2kb transposon insertion as a female parent with maize inbred lines 178, zheng58 and chang72 which do not contain 27.2-kb transposon insertion, backcrossing for 1 generation to obtain backcross progeny 52220 and 178, 52220-zheng58 and 52220-chang 72.
2. Transposon specific primer for identifying stem strength of corn to be detected
Genomic DNAs of 70 backcross progenies 52220-178, 75 52220-zheng58 and 65 52220-chang72 were extracted as templates, and PCR amplification was performed using the primers I1, I2 and I3.
If the I1 primer has an amplification product and the I2 primer and the I3 primer have no amplification product, the 2 homologous chromosomes of the corn to be detected do not contain 27.2kb Ty1/Copia transposon;
if the I1 primer has no amplification product and the I2 primer and the I3 primer have amplification products, the 2 homologous chromosomes of the corn to be detected all contain 27.2kb Ty1/Copia transposon;
if the I1 primer, the I2 primer and the I3 primer all have amplification products, the maize 1 homologous chromosome to be tested contains 27.2kb Ty1/Copia transposon, and the other homologous chromosome does not contain 27.2kb Ty1/Copia transposon, and the maize is a hybrid.
The strength of the corn stalk to be detected containing the transposon is higher than that of the corn to be detected not containing the transposon.
As a result, it was found that,
in the backcross progeny 52220-178, 15 strains contain 27.2-kb Ty1/Copia transposon, 18 strains do not contain 27.2-kb Ty1/Copia transposon, and 37 strains are heterozygous;
in the backcross progeny 52220-zheng58, 19 strains contained the 27.2-kb Ty1/Copia transposon, 17 strains did not contain the 27.2-kb Ty1/Copia transposon, and 39 strains were heterozygous;
in the backcross progeny 52220-chang72, 16 strains contained the 27.2-kb Ty1/Copia transposon, 15 strains did not contain the 27.2-kb Ty1/Copia transposon, and 34 strains were heterozygous.
Thus, in each backcross progeny, the stem strength of the strain containing the 27.2-kb Ty1/Copia transposon was higher than that of the strain not containing the 27.2-kb Ty1/Copia transposon.
3. Detection of stalk strength
Detecting the stem strength of backcross progeny 52220-.
As a result, as shown in fig. 4, it can be seen that,
the stem strength of the backcross progeny 52220-178 of the 15 strains containing the 27.2-kb Ty1/Copia transposon is higher than that of the backcross progeny 52220-178 of the 15 strains not containing the 27.2-kb Ty1/Copia transposon;
the stem strength of the backcross progeny 52220-zheng58 of the 15 strains containing the 27.2-kb Ty1/Copia transposon is higher than that of the backcross progeny 52220-zheng58 of the 15 strains not containing the 27.2-kb Ty1/Copia transposon;
the stem strength of the backcross progeny 52220-chang72 of the 15 strains containing the 27.2-kb Ty1/Copia transposon is higher than that of the backcross progeny 52220-chang72 of the 15 strains not containing the 27.2-kb Ty1/Copia transposon.
SEQUENCE LISTING
<110> university of agriculture in China
<120> a method for detecting the strength of maize stalks and a specific transposon thereof
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 31174
<212> DNA
<213>Zea mays Lin.
<400> 1
tttgatgaag ttttgaaatg agaggaaatg tgctgctctc ggccagcagc gcgtctgttt 60
ttataggcct ccgtagctcg gcaccaagat atgtggggcc gagctacgag gccgcgttgg 120
cgctgcgtaa gtgccatgtc agccctaggc gcagggagcc attactgcca catcatatct 180
cggcgccata gactgtggcg ccgaggtgtt acctcagcgc cacagcctat ggcgccgagt 240
atcgggtcca aacttgcata taaaatttct agggggtcca aacgtaaata tttttcaaaa 300
gtacgactga aaaagaaaaa attcggtgtc gcagccaggg cgtccgcatc ggcttcaaaa 360
ctaggttcaa tagagcacaa gagcagagct tcggtgaaca agcacaagaa cttagctata 420
ggttcagaga acaaaagctt ctaacgttat gtatttcttt ggatcctaaa tctttattcg 480
gttcacagaa aaatgacgat gcatactctc tagcttgtaa agttctatcc tattgtttca 540
gagcaagaaa gaagcaccct ctaggaggct tcacttgtaa tattattatg cacatcttca 600
cgtgcctaca atttctattt ttcagaattt aacaacttac tgatctttat cgtcgactag 660
tagaaactag gaaatcaaat agataaggat cgtttgctcc cttatatttt attttggctc 720
tgcaactaca tattgtttta taatttaatg aaagagagca tgttatttta tgtttttgat 780
agaagagtta tgaaagctat ctcttgatga agagttagta tattatacac acactctgaa 840
atcatatgat gttgtatatg caactattca tattatgagt catgtgtaaa tgagttgaga 900
cttatccaat atcattcagt attagtgtag atacttttat gaagtgctta aattagttag 960
accgctgata tagtacttgt tcttgatttt gtcctagtgt tacaagtgag gattagacac 1020
tcttatccct tcggtgcttg cacacataat tgtattagtt gtacaaaatg agctcgtaat 1080
cttgcaggat cacatcaact aagtttatcg tgtggatgtc agcgtgtact ggaggaaatg 1140
agacatatgg caatttgagc agaaaatcat gcgcaacaca aaagcacact actagagaat 1200
ataccatcgg tgccagtagg gaactggtta tagtatcgga tttccaacca gtactatgca 1260
atagatacta aagactaaag tatcgaaaag gtaaccagag agggtgaatg ggagccaatc 1320
aaattctgtt gcttaaaaac tggaacttga gcacttaact tcaatggaga tgaagaattc 1380
gctcaaaaca aaaacacatc aaccaaccag tggtcacatg tttcaaaaat gttcctagga 1440
ctcacgcgag acgatcaaaa tatatggatc gcaaatcgga caccaaaaag tctaaatcgg 1500
tccaaaacct tgtcgatatc tagttttcat caactaaaaa tttagttttt gaatgcgaaa 1560
ctaaaccaaa cggacttcga ttgagctgaa attttgcaca cacctttaca aatgagtctc 1620
caaggtctcc acaaaacttt aactcaaccg aatttataaa tcaatcgcag ataagaaaac 1680
ataaactaga tcggggctta gttggggttt tcaaaatgtg ttcagatcag atcacaacta 1740
caaactgctc aaaccaaatg attgcagtgg tctagagagt gatatttatc ccaagacaat 1800
ccccaactca ggaaatcaag gattattcaa aaatctaagg tagagaggaa acaagcgcag 1860
agacaaaatc gaataaaaaa ctttagcaca tacaaaactg agcacacgat ttgacgaact 1920
ctatggatgg atctggccac cccttccttt aaatgatgcg atgaagaata caaaagcaca 1980
tacatcgtgt tcaaaatcat ttgtggatct caggctaaac tagggaaata gaaactagtt 2040
ttctaaacga aacacaaatg agctagctaa agagatagtt gtccacaaca acccacccat 2100
ctatttatag agcgttattt cactagtcca aactacccct agagatacat agagcatatc 2160
tgaaagtcgc ctagaggggg ggtggatagg cggaaactga aatttacaaa ctttaagcac 2220
actacaagcc ggggttagcg ttagaatgaa atctgagtcc gggagagagg ggaaaacaaa 2280
tcaacaaaga aaataaagcg gatgacacgg tgatttgttt taccgaggtt cggttctaag 2340
aaacctagtc cccgttgagg tggtcacaaa gaccgggtct ctttcaaccc tttccctctc 2400
tcaaacggtc acctagaccg agtgagcttt ctccttaatc aaacgggtca cttagacccc 2460
acaagtacca ccacacactt ggtgtctctt gttttgatta caagtcactt agagaacaag 2520
aatgaggaag aagaacgcca accaagcaac aagagcaaca aggaaacaca agaaatgatc 2580
ctctcacaag tcctaaagac tagagttgaa ttggggactt tgatcagatt gaaggctttg 2640
atttgtgtct tggagtgttg tgttttgctc ttgtattgag tggagagtag tgaatgcttg 2700
gattgttgga gtggaggtgg ttgtggggta tttatagccc ccaaccacca attcaaccat 2760
tgggggtggc tgctgtcgat aggtgcaccg gacagtccgg tgcgccactg gacactgtcc 2820
ggtgcgccag ccacgtcacc caaccgttag ggttctggcg gtttcgaccg ttggagcttt 2880
gtcttctagt ggcactggac agtccggtgc cgcatcggac agacactgtt cactgtccgg 2940
tgcgcctctg gtggctgctc tgacttctgc gcgaactgtc cacgcattgt agtgttgtag 3000
gcgaccgttg cagccgaccg ttgcgctgtt agtcgttact ccacttggtg caccggacag 3060
tccggtgaca caccgtacag tctggtgaat tatagcggag cgacgcctga gaaacctgaa 3120
agtgaagagt ttggagtcgt atggccctgg tgcaccggac actgtcggtg gcacaccgga 3180
cagtcaggtg cgccctcttc ggtttctttt gctcctttct tttgaaccct aacttgatct 3240
ttatatcggt ttgtgttgaa cctttagcat ctgtagagta tataatctag agcaaactag 3300
ttagtacaat tatttgtgtt gggcattcaa ccaccaaaat tatttatagg aaaaggttaa 3360
cccctatttc cctttcaatc tccccatttt ggtgattgat gccaacacaa accaaagcaa 3420
acatataagt gcagaattga actagtttgc ataaggtaag tgcaaaggtt gcttggaatt 3480
aaaccaattt atatttttac tagatatgca tggttgcttt cttttgttta acattttgga 3540
ccacgcttgc atcacttgtt ttgtttttgc aaattctttt ggaaagcctt ttcaaagtct 3600
ttttgcaaaa tagtcaaagg tatatgaata agatttcgag aagcattttc aagatttgaa 3660
attttctccc cctgtttcaa attattttcc tttgacttta acaaaactcc ccctgaataa 3720
aattctcctc ttagtcttca agagggtttt agtaaatacc aattggaact tatacttagg 3780
tacaagtttt gaaattatac cagttgaaaa tcatcatacc catttgaaat atcttaacta 3840
aaagttttca tcataagata ccaactgaag agacaaacat aaatcatcat ttcgaaactt 3900
ttgaaggttg gtggtgcggt ccttttgctt tgggcttaat atttctcccc ctttggcatt 3960
aatcgccaaa aacggaggct tttgagagcc cttttttact ttctccccca ttggtacaag 4020
taaatatgag tgaaagatta taccaattta agagtgatgt ggagtgatga cgaagggtaa 4080
atgataccga tagagtggag tggaagcctt gtcttcaccg aagactccat ttccctttca 4140
atctacgact tagcatagaa atcacttgaa aacacattag tcgtaatcat aaaagagata 4200
tgatcaaagg tatattaatg agctatgtat gcaaagtttt aatcaaagtt ccgagaatca 4260
agtatatttg gctcattcct aagtttgcta aaagttttct catctaatgg tttggtaaag 4320
atatcggcta attgttgttt ggtgctaaca taagctatct cgatatcccc cctttgttgg 4380
tgatccctca aaaagtgata ccgaatgtct atgtgcttag tgcggctgtg ttcaacggga 4440
ttattgaaag ggaaatgtgc ccttgggcca tttctaagta ttttggtgat tgagtgccaa 4500
cacaagtgct taaatgtgaa tctatgctca tggatgaaca aagtgcaaat cacaagtaag 4560
gtatgtttct aagccttagt acattggttt tgtgtactaa tatacttgtc taagtgttag 4620
aaacagagag aagaagaaag aagaagagtt ggctgtgtac agccaaaagg ctgcttcggt 4680
ctggggcacc ggactgtccg gtggtgcacc ggacagtgtc cggtgcgcca ggctgccttg 4740
acctgaagac gccgctctcg ggaatttgcc gacggcgtac ggctaaaatt caccggactg 4800
tccggtgtgc accggactgt ccggtgagcc aacggtcggc agggccaacg gtcggccgcg 4860
caatctgcgc gagacacgtg gccgagccaa cggtcagaag ggggcaccgg actgtccggt 4920
gtgcaccgga catgtccggt gcgccatcgg ctcccagatc ttcaacggtc tgcaacggtc 4980
gactgcgctg tttaaggaaa taaatcgggc accggacagt gtccggtgtg caccggactg 5040
tccggtgcgc ccgacgacag aaggcaagga tggccttcca gatttgttct caacggctcc 5100
tagctgcctt ggggctataa aagggacccc taggcgcatg gaggagcaca ccaagcattc 5160
ctacaacctt tctaagcacc aagacattga tctcgcgcat tcgtttcatt gtgatagcat 5220
atagagctct tgtggggttg tgaactcttt gagttgtgtt gcgagctctt gttgctgctt 5280
gtgtgcgtgt tgttactctg attttgagtc ttgtgtgcgt tgctagttcc ctccttactt 5340
cgtatttctt tgtgaatctc aagtgtaagg gcgagaggct ccaaagttgt ggagattcct 5400
cgcaaacggg atattgagaa gaaaagcata acactgtggt attcaagttg atcattggat 5460
cacttgagag gagttgagtg caactctcgt ccgttgggac gccacaacgt ggagtaggca 5520
agtttttgta cttggccgaa ccacgggata aatcactgtg tcttctctgt gttgaacttc 5580
ttgtgattat cgttgtgtgc aagatcttcg ctctagccac ttggcatcaa ctgtgctaac 5640
acttaacaag tttttgtggc tataagttta agttttacag gatcacctat tcaccccccc 5700
ctctaggtgc tctcaattgg tatcaaaggc gttctcttca agaaagggac taaccgcccg 5760
aagagatgga tcctaagggg aagggaatca tgatcaacga taaggagaag gagtccttcg 5820
tcaacgagcc caaagaagac aagcctaccg actccggctc gggccataga cggaaggaag 5880
ggaagaagaa gaagacaagg cgcatcaagg agatcgtcta ctacgacgac agcgacgaat 5940
cttcctcttc ccaaaaggac aacgactatg acaaacaaaa gacggttaac tcaaactttt 6000
cttttgatta ttcgcgcatt ccgcatagtt caaatgctca tttgctcccc attccacttg 6060
gcaagcctcc tcactttgat ggagaggact acggattttg gagtcacaaa atgcgtactc 6120
acctattttc tctccatcca agcatttggg agattgtgga aagtggaatg aagtttgata 6180
gctcggatag tccttcattt attaatgaac agattcataa aaatgcacaa gctactactg 6240
tgttgctagc gtctttgtgc agggacgagt atcacaaggt gagcggcttg gacaatgcca 6300
agcagatttg ggacaccctc aagatctctc atgaggggaa tgatgtcacc ttactcacca 6360
agatggagtt ggtggagggc gagctcggac gattcgcgat gataaggggc gaggagccga 6420
cacaaacata caaccggctc aagatcctta tcaacaaaat aaggagctac ggaagcacgc 6480
gatggacgga tcacgacgtc gtccgcctaa tgctaaggtc atttaccgtt cttgatcctc 6540
acttggtgaa caatattcgt gaaaatccta ggtacatcaa gatgtcgccc gaggaaattc 6600
ttggaaaatt tgtaagcggg cggatgatga tcaaggaggc gaggtacgtg gacgacgcgt 6660
tgaatggccc aattcatgag cctcaaccca ttgctctcaa ggcaacaagg agcaaggagg 6720
cgctgcccag caaggtggcg caaattgagg cggccggtct taatgatgaa gagatggctc 6780
tcatcatcaa aagattcaag acggcactaa aaggtcgcaa gggacagcca agcaagacta 6840
agaccaaggg aaaacgatca tgcttcaaat gcggtaagct tggtcatttt attgctaact 6900
gtcccgacaa tgatagtgac caggaacacg ggagcaagag ggaaaagaag aagcattaca 6960
agaaggccaa gggcgaggca catatcggaa aggagtggga ttcggattgc tcctcctctg 7020
actccgacaa tgaaggactc gccgccactg ccttcaacaa gtcatccctc ttcccccacg 7080
agtgtcacac atgccttatg gcaagggaga agaaggtatg caatcaaaac aatgtcacct 7140
atgattcttc cagtgatgat gagtctagtg atgatgaaat agattactct agtttgttca 7200
agggattgga tagaactaaa gtagataaaa ttaatgaatt gattgatgcc ttgaatgaaa 7260
aagatagact cttagaaaaa caagaggacc ttttgtatga agagcatgac aaatttgtag 7320
aagcacaaaa atcttatgct ttagaagtta aaagaaatga agtgctttct agtgaactat 7380
cttcttgtca taaaaccatt gctactttaa agagtgttaa tgatgacttg aatgctaaac 7440
tagaagtagc tagtaaatct aagtcttgtg tagaacatgt tgagatttgc actaggtgta 7500
aagatttcga tgttgatgct tgtagtgatc atttagtttc aatttccaaa ttaactgagg 7560
atttggctag tcttaatgcc caacttaaga ctagcaagaa tgaatttgat aaactaaaat 7620
ttgcaagaga tgcctatacg atcggtagac acccctcaat taaggatggg cttggcttca 7680
agagggaagc caagaactta acaagccata aggctcccat ctccgccaag gagaaaggga 7740
aggcccctat ggcaagtagc actaaaagga atcattcttt tatatatcat gataggagac 7800
aaactagaaa tgcttatagg agttataatg catatgatga ttttaactct catgccatgt 7860
ttgcttctag ttcttccttt atgcatagta gaaatatgtc taggaaaaat gctatgccta 7920
gaaagaatat tactcatgct cctaggaaaa tagtgaatga accttctaca atttattgtg 7980
ctttaaatgc ttcctttgct atttgtagaa aggataagaa aattgttgct aggaagatag 8040
gggcaaaatg caagggagac aaaacttgca tttgggtccc taaggacatt tgcactaacc 8100
ttgtaggacc caacatgagt tgggtaccta agtcccaagc ctaaatttgc cttgcaggtt 8160
tatgcatccg ggggttcaag ctggattatc gacagcggat gcacaaacca tatgacgggg 8220
gagaagaaga tgttcacctc ctacgtcaag aataaggatt cccaagattc aattgtattc 8280
ggtgatggga atcaaggcaa ggtaaaaggg ttaggtaaaa ttgcaatttc taatgagcac 8340
tctatttcta atgtgttttt agtagagtct cttggttata atttgctatc tgttagtcaa 8400
ttatgcaata tgggatataa ttgtcttttt acaaacgtag atgtgtctgt ctttagaaga 8460
agtgatggtt cactagcttt taagggtgta ttagacgaca aactttattt agttgatttt 8520
gcaaaagaag aggccggtct agatgcatgc ttaatagcta agactagcat gggctggctg 8580
tggcatcgcc gcttagcaca tgtggggatg aagaaccttc acaagcttct aaagggagaa 8640
cacgtgatag gtttgagtaa cgttcaattc gaaaaagata gaccttgtgc agcttgtcaa 8700
gcaggtaaac aagtgggagg agcacatcac agcaagaatg tgatgaccac ttcaagaccc 8760
ctggagctgc tgcatatgga cctcttcgga cccgtcgcct atctgagcat aggagggagt 8820
aagtatggtc tagttattgt agatgatttt tcccgcttca cttgggtgtt ctttttgcag 8880
gataagtctg aaacccaagg gaccctcaag cgcttcctca ggagggctca aaatgagttt 8940
gagctcaagg tgaagaagat aaggagcgac aacgggtccg agttcaagaa ccttcaagtg 9000
gaggaatttc ttgaggagga agggatcaag cacgagttct ccgctcccta cacaccacag 9060
caaaatggtg tggtagagag gaagaacagg acgctaatcg acatggcaag gacaatgctt 9120
ggagaattca agacccccga gcgtttttgg tcggaagccg tgaacacggc ttgccatgcc 9180
atcaacaggg tctaccttca ccgcctcctc aagaagactt cgtatgagct gctaaccggt 9240
aacaaaccca atgtatctta ttttcgtgta tttgggagca agtgctacat tctagtgaag 9300
aaaggtagaa attctaagtt tgctcccaaa gcagtagaag ggtttttatt aggttatgac 9360
tcaaatacaa aggcgtatag agtcttcaac aaatcatcgg gtttggttga agtctcaagc 9420
gacgttgtat ttgatgagac taatggctct ccaagagagc aagttgttga ttgtgatgat 9480
gtagatgaag aagatgttcc aacggccgct atgcgcacca tggcaattgg tgatgtgcga 9540
ccacaggaac acttggagca agatcaacct tcttcctcaa ctatggtgca tcccccaact 9600
caagacgatg aacaggttca tcaacaggag gcgtgtgatc aagggggagc acaagctgat 9660
catgtgatgg aggaagaagc gcagccggca cctccaaccc aagttcgagc gatgattcaa 9720
agggatcatc tcgtcgacca aattctgggt gacattagca agggagtaac tactcgatct 9780
cgattagtta atttttgtga gcattactcc tttgtctctt ctattgagcc tttcagggta 9840
gaggaggcct tgctagatcc ggactgggtg ttggccatgc aggaggaact caacaacttc 9900
aagaggaatg aagtttggac actggtgcct cgtccgaagc aaaatgttgt gggaaccaag 9960
tgggtgttcc gcaacaaaca ggacgagcac ggggtggtga cgagaaacaa ggctcgactt 10020
gtggcaaaag gttatgccca agtcgcaggt ttggatttcg aggagacttt tgctcctgtg 10080
gctaggctag aatcaattcg tatcttgcta gcatatgccg ctcatcattc tttcaggttg 10140
taccaaatgg atgtgaagag cgcattcctc aacgggccaa tcaaggagga ggtgtacgtg 10200
gagcaacccc ctggcttcga ggatgaacgg taccccgacc atgtgtgtaa gctctctaag 10260
gcgctctatg gacttaagca agccccaaga gcatggtatg aatgccttag agactttata 10320
attgttaatg ctttcaaggt tgggaaagcc gatccaactc tttttacaaa gacatgtgat 10380
ggtgatttgt ttgtgtgcca aatttatgtc gatgacataa tatttggttc tactaaccaa 10440
aagtcttgtg aagagtttag cagggtgatg acgcagaaat tcgagatgtc aatgatgggc 10500
gagttgaact acttccttgg gttccaagtg aagcaactca aggacgacac cttcatctcc 10560
caaacgaagt acacgcaaga tctgctaaag cgatttggga tgaaggacgc caagcccgca 10620
aagactccga tgggaaccga cgggcacacc gacctcaaca aaggaggtaa gtccgttgat 10680
caaaaagcat accggtcaat gatagggtca ttactttatt tatgtgctag tagaccagat 10740
attatgctta gcgtatgcat gtgtgctaga tttcaatccg atcctaagga gtgtcactta 10800
gtggcggtga agcgaattct gagatattta gttgctacgc cttgcttcgg gctctggtat 10860
ccaaaggggt ctacctttga cttggttgga tactcagatt ccgactatgc tggatgtaag 10920
gtcgatagga agagtacatc ggggacgtgc caattcttag gaaggtccct ggtgtcgtgg 10980
aactctaaga aacaaacctc cgttgcccta tccaccgctg aggccgagta cgttgccgca 11040
ggacagtgtt gcacgcaact actttggatg aggcaaaccc tccgggactt tggctacaat 11100
ctgagcaaag tcccactcct atgtgacaat gagagtgcta tccgcatggc ggaaaatcct 11160
gttgagcaca gccgcacaaa gcacatagac atccggcatc actttttgag agaccaccag 11220
caaaaggggg atatcgaagt gttccatgtt agcaccgaga accagctagc cgatatcttt 11280
accaagcctc tagatgagaa gaccttttgc aggctgcgta gtgagctaaa tgtcttagat 11340
tcgcggaact tggattgact tgtagcatac atgtgtttat gcctttgatc atgttcattc 11400
tgcattttgt tgcttattgt ggtgctcaag ttgtataaac actccctgga cctcacaagt 11460
ccgttgctaa gtgatgcaca tgtttagggg gagatgtgtt acaacttgac cctttgagac 11520
taactatgta gttgagtttg cttgatttag tctcaaagga gaattgaaag ggaaaggtgg 11580
acttggacca tgaaagactt ccactgcact ccgatgagag ggtaacgtat tccaagtcat 11640
ccaatgaact cttattgcca tttgctctta attggagatt ttggtgaggc aaaggggtta 11700
aaagggccaa agttgatccc attttggtgc ttgatgccaa agggggagaa aataaaggcc 11760
aaagcaataa atggatcagc taccacttga gaaattttga aaatagtgaa atagaacttt 11820
ttgttttgtc aaaactctct tattatctct ttgtcaaaag ttggcttcct gtggggagaa 11880
gtagtgatta tgggaaaaag ggggagtttt tgaaatcttt gatcaatctc ttttgaaatg 11940
actctcttta tgcttcaaca tgtgtgtttg acttagagat agagatttga gtttgatttg 12000
caaaaacaaa ccaagtggtg gcaaaggatg atccatatat gccaaaattg aataaaactc 12060
aaatttgttt tatttgaagt gattttgcac ttgttctagt tgccttatgt tgtgttggca 12120
taaatcacca aaaaggggga gattgaaagg gaaatgtgcc cttgggccat ttctaagtat 12180
tttggtgatt gagtgccaac acaagtgctt aaatgtgaat ctatgctcat ggatgaacaa 12240
agtgcaaatc acaagtaagg tatgtttcta agccttagta cattggtttt gtgtactaat 12300
atacttgtct aagtgttaga aacagagaga agaagaaaga agaagagttg gctgtgtaca 12360
gccaaaaggc tgcttcggtc tggggcaccg gactgtccgg tggtgcaccg gacagtgtcc 12420
ggtgcgccag gctgccttga cctgaagacg ccgctctcgg gaatttgccg acggcgtacg 12480
gctaaaattc accggactgt ccggtgtgca ccggactgtc cggtgagcca acggtcggca 12540
gggccaacgg tcggccgcgc aatctgcgcg agacacgtgg ccgagccaac ggtcagaagg 12600
gggcaccgga ctatccggta tgcaccggac atgtccggtg cgccatcggc tcccagatct 12660
tcaacggtct gcaacggtcg actgcgctgt ttaaggaaat aaatcgggca ccggacagtg 12720
tccggtgtgc accggactgt ccggtgcgcc cgacgacaga aggcaaggat ggccttccag 12780
atttgttctc aacggctcct agctgccttg gggctataaa agggacccct aggcgcatgg 12840
aggagcacac caagcattcc tacaaccttt ctaagcacca agacattgat ctcgcgcatt 12900
cgtttcattg tgatagcata tagagctctt gtggggttgt gaactctttg agttgtgttg 12960
cgagctcttg ttgctgcttg tgtgcgtgtt gttactctga ttttgagtct tgtgtgcgtt 13020
gctagttccc tcctttcttc gtatttcttt gtgaatctca agtgtaaggg cgagaggctc 13080
caaagttgtg gagattcctc gcaaacggga tattgagaag aaaagcataa cactgtggta 13140
ttcaagttga tcattggatc acttgagagg agttgagtgc aactctcgtc cgttgggacg 13200
ccacaacgtg gagtaggcaa gtttttgtac ttggccgaac cacgggataa atcactgtgt 13260
cttctctgtg ttgaacttct tgtgattatc gttgtgtgca agatcttcgc tctagccact 13320
tggcatcaac tgtgctaaca cttaacaagt ttttgtggct ataagtttaa gttttacagg 13380
atcacctatt cacccccccc ccctctaggt gctctcaatt atccaccatg cggattgcac 13440
tctcattgtc acataggaga gggactttgc tcaatttgta gccatagtcc ctgagggttt 13500
gcctcatcca atgtaattgt gcacagcaat ggcctgcggc aatatactcg gcttcggcgg 13560
tagaaagagc tactgagttt tgtttctttg aagcccaaga cactagggat cttcccagaa 13620
actgacaagt ccctgatgtg ctctttctat caattttaca ccctgcccaa tcagcatctg 13680
aatatcttat taagtcaaaa gtggatccct tggggtacca aagtccaaac ttaggagtat 13740
aaactaaata tttcatgatt cttttcacgg ccctaaggtg aacttcctta ggattggctt 13800
ggaaccttgc acacatgcat atagaaagca taatatttgg tcgagatgca cataaataga 13860
gtaaagatcc tattatcgac cggtatacct tttgatctac ggatttacct cccgtgtcga 13920
ggccgagatg cccatttgtt cccatgggtg tcttgatggg tttggcatcc ttcatttcaa 13980
acttgttaag tatatcttga atgtactttg tttggctgat gaaggtgtca tcttggagtt 14040
gcttgacttg aaagcctagg aaatacttca actcccccat catagacatc tcgaatttct 14100
aaatcaggat cctacttgaa agggaaatag ggtcaaacct tttcctaaat gattttggtg 14160
gttgaattgc ccaacacaaa taattggact aactaatttg ctccagatta taagttctat 14220
aggtgctaaa ggttcaacac aaaccaataa aaagtctaag atagtgttca aaaagaaagg 14280
agcaaaacca gcagaaggct gccctggtct ggcgcaccag acagtgtccg gtgcaccagg 14340
gagatcaact ctgaactgct cagcttcgag tttttggaga gccactccgc tataattcac 14400
tggactatcc ggtgtagcac cggactgtcc ggtgtgccat gcggagcaac ggctactgcg 14460
ccaatggtcg tctgcaaaag tgaacagtga acgctacagt gcgtggacag ttcgcgcaga 14520
gttagagcag gcgccagaag gcgcaccaga cattgaacag tacctgtccg gtgcaccacc 14580
agactgtccg gtggccccag ctgtcagagc tccaacggtc aaaccctaac ggttgggtca 14640
cgtggctggc gcaccggaca gtgtccggtg gcgcaccaga ctgtccggtg cgcccatcga 14700
cagacagcct ccccaacgac cattttggtg gttggggcta taaatacccc caaccaccac 14760
acttcaaggc atccaagttt tcaaccattg cattcaatac aagagctcta gactttactc 14820
caagacacaa atcaaaagat caaatcctct ccaagttcca aactcattcc aaagacttag 14880
tggcttgtga gagagagaca ttcctgttca tttgagttct tgtcgcttgg atcgcttttc 14940
ttcttcctcc attcttgttc tcaagcaact tgtaatcaag caagagacac caagttgtgg 15000
tggaccttgt aagggtctaa gtaacccgtt gattaaggag aaaagctcac tcggtctagg 15060
tgaccgtttg agagagggaa agggttgaaa gggacccagt ctttatgacc acctcaacgg 15120
ggagtaggtt tgcaagaacc gaacctcggt aaaacaaatc accgtgtcat ccgccttatt 15180
tgcttgtgat ttgttttcgc cctctctttt ggacttgact ttatttctaa tgttaacccc 15240
ggcttgtagt tgtgcttaaa gtttataaat ttcagatttg cctattcacc cccctctagg 15300
cgactttcaa ttggtatcag agcccgatac ttcattagaa cctaaccgct cgaagtgatg 15360
tcgggagatt acgccaagaa ggagatggtg accggcgaga agcccgccac aagccacggg 15420
aaagctccat cggggcagtc tggtaacaag gtgaagggat ccccttcaca caacaagtcg 15480
catcggagcg gcgagaagaa aaagaagatg aagaaagtgg tcttctacga gaccgactct 15540
tcgtcgccat ccacctctgg ctccgacgcg ccgttcgtca cttctaagcg ccatgtgcgc 15600
aagaagttta gtaagatcca cctacgctac cctcgcattt ctaaacatac tcctttactt 15660
tccatcccat taggcaaacc actagtcttt aatggtgaag attatagtag gtggagtgat 15720
atgatgaggt atcacctcac ctcactccac acaagcatat gggacattgt tgaatttgga 15780
gcacaggtac catccgtagg ggatgaagat tatgatgcgg acaaagtcgc ccaaatccga 15840
cacttcaatt cccaagcaac tactatactc ctcacctctc taagtcgaga ggagtataat 15900
aaggtgcaag ggttgaagag tgccaaagag atttgggaca tactaaagac cgcacacgaa 15960
ggagacgagg tgaccaagat caccaagagg gaaacgatcg agggggagct cgatcggttc 16020
atgctcaacc aaggagaggt gccacaagct atgtacaact ggctcaagat cttggtcaac 16080
caagtgcgca acctcgggag cacaaaatgg gatgaccatg aaatggtcaa ggttattcta 16140
agatcacttg tttttcttaa tcctacacaa gtacaattaa ttcgtggtga tcctagatac 16200
aagctaatgt ctcccgagga agttataggg aagtttgtga ggcttgaatt gatgatcaaa 16260
ggctccaaac aaatcatcga gtgaggcgcc acctccacac ccgaggtgca acccgtcgca 16320
ttcaaagcga cggaggagaa gaaagaagag tctatgtcaa gtaggctccc catcgacgcc 16380
tccaagctcg acaacaagga gatggcgcta atcatcaaaa gctttcgcta aatccttaag 16440
caaaggaggg ggaaggatta caagccccgc ttcaagaaag tttgctacaa gtgtggtaag 16500
cctggtcatt ttattgctaa atgtccatta tcaagtgata gtgacagggg cgacgacaag 16560
aacagaaaga ggagggaaaa gaagagatac tacaagaagg gcggcgatgc ccatgtttgt 16620
cgggagtggg actccgacga gagctccatc gactcctcct ccgacgagga tgccgccaac 16680
atcgccgtca acaagggtct ccttttcccc aacgtcggcc acaagtgcct catggcaaaa 16740
gacggcaaaa ataagaaggt aaaatctaga gcttccacta aatatgcaac atctagtgat 16800
gagcctagct ctagtgatga tgaggatgat ttgcttacac tttttgccaa ccttaacatg 16860
caacaaaatg agaaattgaa tgaattgatt agtgctattc atgagaagga tgaactcttg 16920
gatagccaag aggacttgct tattaaagaa aaacaagaaa catgttaaag taaaaaatga 16980
ctatgctcag gaagtagaaa aatatgaaaa attaactagt gagcttagca tttgccatga 17040
cactatctct aaccttagaa ttgaaaatgc caaattaatt gctaaggttg agaaattaaa 17100
tgtttttgat aactctcttg tcaaccttaa aaatgataat gctagtttga ttgctaagat 17160
tgacaagttg aatgaatcac tttctagcct taagagtgag aatgataaat taatgtctaa 17220
ggctaaagat ttaaatgttt gcaatgtttc tatttccaat cttaagaatg aaaatgctat 17280
tttacatgct aagattgatg aattaaatgc atgtaaaccc tctacatcta ctattgatca 17340
tgtctccatt tgtactagat gtagagacat taatgttgat gctatccatg atcacctagc 17400
tttaattaaa caacaaaatg atcacatagc tcaacttagt gctaaaatta atgagcttga 17460
cttagaaaat gaaattttta aatttgctag aagtatgctc tatagtggga gacaccctgg 17520
cattaaggat ggcattggct tccaacagga aggcaatgcc aagcttaata cccctaagaa 17580
attatctaac tttgttaagg gcaaagatcc catggttcag gataacgagg gctatatttt 17640
atatcctact ggttatcccg aacacaagat taggagaatt cattctagga agtctcactc 17700
aagctctcat catgctttta tgtataagag tgaggcatct agttctagtc aatccactca 17760
tgttaaattg cctaaaaaga aaactcttac tgcaccaaat gagcctattg tttcatttaa 17820
gacttttgat gcttcatatg ttttaactaa caaatcaggt aaaatagttg ccaaatatgt 17880
tggggccaaa cacaagggct caaaaacttg tgtttgggta cccaaggtgc ttgtttctaa 17940
tgtcaaagga accaagaccg tttgggtacc taagaacaag gcctaaactt gttttgtagg 18000
tttatgcatc cgggggctca agttggataa ttaatagcgg gtgcacaaac cacatgactg 18060
gggagaaaag gatgttctcc tcttacaaga aaaatgaaga tccccaaaga gctatcacat 18120
tcggggatgg aaatcaaggt ttggtcaaag gacttggtaa aattgctata tcacctgacc 18180
attccatttc caatgttttt cttatagatt ctttatatta caatttgctt tttgtttctc 18240
aattatgcaa aatgggttac aactgtcttt ttacagatat aggtgttact gtctttagaa 18300
gaagtgatga ttcagtagca tttaagggag tattagaggg tcagctatac gtagttgatt 18360
ttaatagagc tgaactcgat acttgtttaa ttgctaagac taatatgagt tggctctgtc 18420
atcgccgact agcccatgtt gggatgaaga atcttcacaa gcttctaaag gaagaacaca 18480
ttttgggact aaccaatgtt cattttgaga aagacagggt ttgtagcgca tgccaagtag 18540
gaaagcaagt tggtgttcat catccacata agaacatcat gacgaccgac aggccacttg 18600
agctactcca catggaccta ttcggcccaa tagcttacat aagcatcggc gggagtaagt 18660
attgtcttgt tattgtgaat gattattctc gcttcacttg ggtgttcttt ttgcaggata 18720
aatctcaaac ccaagagacc ttaaagggat tcttgagacg ggctcaaaat gagtttgact 18780
tgaggatcaa aaagattaca agcgacaatg ggacggagtt caagaactct caaattgaag 18840
gctttcttga ggacgagggc atcaagcatg agttctcttc tccctacaca ccacaacaaa 18900
atggtgtagt ggagaggaag aatagaactc tatttgacat ggcgaggacc atgcttgatg 18960
agtacaagac ttcggaccgg ttttgggcgg aagcaatcaa caccgcttgc tacgccatca 19020
accgtctcta ccttcaccga atcctcaaga agacatccta tgaactccta aacagtaaaa 19080
agcccaatgt ttcatatttt agagtctttg gtagcaaatg ttttattctt attaaaagag 19140
gtagaaaatc taaatttgct cctaaggctg tagaaggctt tttacttggt tacgactcaa 19200
acacaagggc atatagagtc tttaacaagt ccactggact agttgaagtt tcttgtgaca 19260
ttgtgtttga tgagactaat ggctctcaag tagagcaagt tgatcttgat gagttagatg 19320
atgaagaggc tccatgcgcc tcactaagga acatgtccat cggggatgtg tgtcctaagg 19380
aatccgaaga gcctccacaa gcacaagatc atccttcatc ttccatgcaa gcatctccac 19440
caaaccaaga tgaggatcaa gctcaagatg atgaaaaaga agatcaagag gagccacctc 19500
aagaggagga caatgatcaa gggggagatg ctaatgatca agacaaggaa gatgatcagg 19560
gtccaagacc gcctcaccca agactccacc aagcaataca acgagatcac cccgtgaact 19620
ccatcctcgg cgatattcat aagggggtaa ccactcgatc tcgtgtcgct catttttgtg 19680
aacattactc ttttatgtct tctattgagc catacagggt ggaagactca ttaagagatt 19740
cagattgggt gttggcaatg caagaggaac tcaacaactt cacgaggaat gaggtatggc 19800
atcttgttcc acgtcctaat caaaatgttg taggaaccaa gtgggtcttc cacaataagc 19860
aagatgaaca tggtgtggtg acaaggaaca aagcccgact tatggccaag ggatattaac 19920
aagtcgaagg tttggatttc ggtgaaacct atgcacccgt agctaggctt gagtcaattc 19980
gcatattact tgcctatgct aattaccatg gctttaagct ttaccaaatg gacgtgaaaa 20040
gtgccttcct caatggacca atcaaggaag aggtctatgt tgagcaacct cctagctttg 20100
aagatagtga gtaccctaat catgtctata aactctcaaa ggcgctttat gggctcaagc 20160
aagccccaag agcatggtat gaatgcctga gagattttct tatcactaat ggcttaaaag 20220
tcggcaaagc cgatcctact ctctttacta aaaccattgc aaatgatttg tttgtatgcc 20280
aaatttatgt tgatgatatc atatttggat ctactaacaa atctacttgt gaagagttta 20340
gtaggattat gattcaaaaa tttgagatgt ctatgatggg ggagttgaag tacttcctag 20400
gatttcaagt gaagcaactc caagagggca ccttcattag ccaaacgaag tatattcaag 20460
acatactcac taagtttgga atgaaggatg ccaagcccat catgacaccc atgggaacca 20520
atgggcatct cgacctcgac acgggaggta aatccgtaga tcaaaaggta tatcggtcga 20580
tgataggatc tttactctat ttatgtgcat ctcgaccgga cattatgctt tccgtatgca 20640
tgtgtgcaag atttcaagcc gatcctaagg aagttcacct tacggccatg aaaagaatct 20700
tgagatattt agttcataca cttaaatttg gtctttggta ccccaaggga tccacctttg 20760
atttaatagg ttattcatat gctgattggg cagggtgtaa gattgataga aagagcacat 20820
cagggacttg tcagttcttg ggaagatccc tggtgtcttg ggcttcaatg aaacaaaatt 20880
cagtagctct ttctaccgcc gaagccgagt acattgccgt aggccattgt tgcgcgcaat 20940
tgctttggat gaggcaaacc cttagggact atggctacaa attaaccaaa gtccctctcc 21000
tatgtgataa tgagagtgca atctgcttgg cggataatcc cgttgagcac agccgcacta 21060
agcacatagc cattcggtat cactttttga gggatcaaca acaaaggggg gatatcgaga 21120
ttgcttatgt tagcaccaaa taacaattag ccgatatctt taccaaacca ctagatgaga 21180
aaacctttac caaacttagg aatgagctaa acattcttga ttctcggaat tttgattgat 21240
actttgcaca catagctcat ttatatacct ttgatcatat ctctttcatg tgctatgact 21300
aatgtgttgt tcaagtgtat ttcatgctaa gtcatagatt gaaagggaaa tggagtcttc 21360
ggcgaagaaa aggcttccac tccactctac cggtattatt tacccttcgc cgtcactcca 21420
catcgctctc caacattggt ataatccttc actcatatat tatttgccaa agggggagag 21480
aatttcataa gggctctaaa gactccgttt ttggcgatta atgccaaagg gggagagagt 21540
attagcccaa agcaaaagga tcgcaccacc acaccaattt caaaaatttt cgaaacaaag 21600
ttgttttcaa ttgatatctt tgaaattagt attcctctaa gaaattctat ctgatttgta 21660
tctatatttt aaggaggagt ttttcaaaat tggtatctaa aatacttgat cttctttcaa 21720
tttgtaaaac cctcttgaac actaagagga gaatttcatt aaggggagtt ttgtttagtc 21780
aaaggaaaaa catttgaaac agggggagaa aatttcaaat cttgaaaatg cttctcgaaa 21840
tcttattcat atacctttga ctatttgcaa aagactttga aaaagaattt ccaaaagaat 21900
ttgcaaaaac aaaacaagtg gtgcaaatgt ggtccaaaat gttaaaagga agaaagcaat 21960
ccatgcatat cttatagaag tttaaattgg tttaattcca agcaaccttt gcacttacct 22020
tatgcaaact agttcaattc tgcacttata tatttgcttt ggtttgtgtt ggcatcaatc 22080
accaaaaagg gggagattga aagggaaata gggtcaaacc ttttcctaaa tgattttggt 22140
ggttgaattg cccaacacaa ataattggac taactagttt gctctagatt ataagttcta 22200
caggtgccaa aggttcaaca caaaccaata aaaagtccaa gatagggttc aaaaagaaag 22260
gagcaaaacc aaccgaaggc tgccctggtc tggcgcaccg gactgtccgg tgtgccaccg 22320
gacagtgtcc ggtgcactag ggagatcaac tctgaactgc tcagcttcgg gtttttggag 22380
agccactccg ctataattca ccggactgtc cggtgtgcca tgcggagcaa cgactactgc 22440
gccaacggtc gtctgcaaaa gtgaacagtg aatgctatag tgtgcagaca gttcgcgcag 22500
agtcagagct ggcgccagaa ggcgcaccag acagtgaaca gtacctgtcc ggttcaccac 22560
cggactgtcc ggtgtggccc cagttgtcag agctccaacg gtcgaatcct aacggttggg 22620
tgacatggct gtcgcaccgg acaatgttcg gtggtgcacc ggactgtccg gtgcgcccat 22680
cgacagacag cctccccaac ggccattttg gtggttgggg ctataaatac ccctcaacca 22740
ccacacttca aggcatccaa gtttttcaac cattgcattc aatacaagag ctctagactt 22800
tactccaaga cacaaatcaa aagatcaaat cctctccaag tcccaaactc attccaaaga 22860
cttagtggct tgtgagagag agacattcgt gttcatttga gttcttgtcg cttggatcgc 22920
ttttcttctt cctccattct tgttctcaag caacttgtaa tcaagcaaga gacaccaagt 22980
tgtggtgatc cttgtaaggg gtctaagtga cccgttgatt aaggagaaaa gctcactcgg 23040
tctaggtgac cgtttgagag agggaaaggg ttgaaagaga cccggtcttt atgaccacct 23100
caacggggag taggtttgca agaaccgaac ctcggtaaaa caaatcactg tgtcatccgt 23160
cttatttctt gtgatttgtt ttcgccctct ctttcgaact cgactttatt tctaatgcta 23220
acctcggctt gtagttgtgc ttaaagttta taaatttcag atttgcctat tcactcccct 23280
ctaggcgact ttcactacta aactcttcac aagttgattt gttagtagac ccaaatatga 23340
tatcatcaac ataaatttgg catacaaaca aatcttttgc aatagtttta gtaaagagag 23400
taggatcgac tttaccgact ttgaagccgt tagtgataag aaaatcacgc aggcattcat 23460
accatgctct tgaggcttgc ttgagcccat aaagcgcctt tgagagttta taaacatggt 23520
tagggtactc actatcttca aagtcgggag gttgctcaac atagacctct tccttgattg 23580
gtccattgag gaagacactt ttcacgtcca tttgataaag cttaaagcca tggtaagtag 23640
cataggcaag taatatacga attgactcaa gcctagctac gggtgcatag gtttcaccaa 23700
aatccaaacc ttcgacttgt gaatatccct tggccacaag tcgggctttg ttccttgtca 23760
ccacaccatg ctcatcttgc ttgttgcgga atacccactt ggttcctaca acattttggt 23820
taggacatgg aactaaatgt catacctcat ttattgtgaa gttgttgagc tcctcttgca 23880
ttgccaacac ccaatctgaa tctcttagtg catcctccac cctgtatggc tcaatagagg 23940
acacaaagga gtaatgttca caaaaatgag cgactcgaga tcgagtggtt acccccttat 24000
gaatgtcacc gagaattgag ttcacggggt gatctctttg aatcgcttgg tggactcttg 24060
ggtgtggagg tctttgaccc taatcatctt ccttgtcttg atcaacttca tctccccctt 24120
gatcattgtc ctcctcttga ggtggctcat cctattgatc ctcatcttca ttgtcttgag 24180
cttgatcctc atcttcagtt tgtggagatg attgattgga agatgatggt tgatcttgtg 24240
cttgtgtggg ctcttcgaat tctttaggac acacatcccc aatggacatg ttccttagtg 24300
cgacacatgg agcctcttca tcatctagct catcaagatc aacttgctcc atttaggagc 24360
cattagtctc atcaaacaca atgtcacaag aaacctcaac taatccagtg tatttgttaa 24420
gactctaaat gcccttgtgt ttgagtcata accaagtaaa aagccatcta cagccttagg 24480
agcaaattta ggttttctac ctcttttaac aagaataaaa catttgctac caaagactgt 24540
aaaatatgaa acattgggct ttttaccggt gaggagttca taagatgtct tcttgaggat 24600
tcggtgaagg tagagccggt tgatggagta gcaggcgctg ttaatcgcct cagcccaaaa 24660
tcggtccgga gtcttgtact catcaagcat ggtcctcgcc atgtccaata gagttctatt 24720
cttcctctcc actacaccat tttgttgagg tgtgtaggga gaagagaact catgcttgat 24780
gccctcttcc tcaacaaagc cttcaatttg atagttcttg aactccgtcc cattgtcgct 24840
tcttatcttc ttgatcctta atccgaactc atttagagct catctcaaga atccctttaa 24900
ggtctcttgg gtctgagatt tttcttgtaa aaagaatacc caagtgaagc gagaataatc 24960
atccacaatt acaagccagt acttactcct gccgatgctt atgtaagcta tcaagccgaa 25020
taaatccatg tggagtaact ctagtggcct gtctgacgtc atgatgtttt tgtgtggatg 25080
atgtgtgcca acttgctttt ctgcttggca tgcgctacaa accctgtctt tctcaaaatg 25140
aacatttgtt agtcccaaaa tatgctctcc ctttagaaga ttgtgaagat tcttcatccc 25200
aacatgggct agtcggcgat gccagagcca acccatatta gtcttagcaa ttaagcaagt 25260
atcgagttca gctctattaa aataaactaa gtatagttga ccctctaata ctcccttaaa 25320
tgctactgaa tcatcacctc ttctaatgac agtaacacct atatccgtaa aaagacagtt 25380
gtagcccatt ttgcataatt gataaactga aaccaaattg taatctaaag aatctacaag 25440
aaaaacattg gaaatagaat ggtcaggtga tatagcaatt ttaccaagtc ctttgaccaa 25500
actttgattt ccatccccga atgtgatagc tctttgggga tcatcgtttt tctcatagga 25560
gaagaacatc cttttctccc ctgtcatgtg gtttgtgcat ccactatcaa taatccaact 25620
tgagcccccg aatccataaa cctgcaaaac aatttatgcc ttgttcttag gtacccaaac 25680
ggtcttgggt ccattcacat tagaaataag caccttgggt acccaaacac aagtcttgga 25740
gcccttgtgt ttgcccccaa catatttggc aactactttg cctgatttgt tagttaaaac 25800
ataagaagca tcaaaagtct taaatgaaat gttatgatca tttgatgcag taggagtttt 25860
ctttttaggc attttaacat gtgtagaatg cctagagcta gatgcctcat tcttatacat 25920
aaaagcatgg tgagaaacag aatgagacct ctcagcatga actctcctaa ttttgtgttc 25980
gggataacca acatgatata aaatatagcc ctcgttatcc tgaaccatgg gagccttgcc 26040
cttaacaaaa ttagacaatc ttttaggggc agtaagtttg acattgcttc cctgttggaa 26100
accaatgcca tccttgatgc cagggcgtct cccattatag agcatgcttc tagcaaattt 26160
aaaattttca ttttctatct catgctcctt gattttagca gttaattgag ctatatgatc 26220
attttgttgt ttaattaaag caaggtgatc atgaatagca tcaatattaa tgtctctaca 26280
tctagtacaa atagtaacat gatcaacact agaactagag ggattgcaaa catttaattc 26340
ttctatctta gcatttaata tgacattctc atctctaaga catgaaatag aatcattgta 26400
aacatttaaa tccttagcgt tggaaatcaa gctagcattt tcggtcctaa ggctagaaat 26460
tgattcattc aacttatcaa tcttagcaat taaagtagca ttatcatttc taagattgac 26520
aattgaatca tggcaaattc taagctcttt agtcagattt tcatttttct ctacttcctg 26580
agcataagca ttcttcacct taacatgatt tttattttcc ttaataagga atttctcttg 26640
gctatccaag agttcatcct tctcatgaat agctcctatc aattcattta atttttcttt 26700
ttgttgcatg ttaaggttgg caaaaagggt aagcaaatta tcttcatctt cactagagct 26760
accctcatca ctagatgttg tatatttagt gaaggctcta gattttacct tcttcctttt 26820
gccatcctta gccatgaggc actgtggccg acatttgaga agagaagtcc cttgttgaca 26880
gcgatgttgg cggtgtcctc gtcggaggag tcggtggagc tcatgtcgga gtcccattcc 26940
cggcacacgt gggcatcgcc gcccttcttc ttgtagtact tcttcttttc ctttctcttt 27000
cccctcttgt catcgcccct gtcactatca cttgacatag gacatttaac aatgaaatga 27060
ccgggcttac cacacttgta gcaccccctt ttagagcggg gtttgtagtc cttccccctc 27120
ctttgcttga ggatttggcg gaagctcttg atgatgagcg ccatctcctc gttgtcgagc 27180
ttggaggcgt cgatggggag cctacttgat gtagactctt ctttcttttc ctccgtcgct 27240
ttgaatgcga cgggttgcac ctcggtgttg tttggagcct ttgatcatca attcaaagct 27300
cacaaacttt cctataacct cctcgggaga cattagctta tatctaagat caccacgtat 27360
taattgaact tgcgtactat tacaaaaaat gagtgatctt agaataacat tgaccatttc 27420
atggtcatcc catttggtgc tcccgaggtt gcgcacttga ttcaccaagg tcttgagccg 27480
gttgtacata gcttgtggct cctctccttg attgaggacg aaacgaccga gctccccctc 27540
gatcgtctcc cgtttggtga tcttggtcac ctcatctccc tcgtgcgcgg tcttgagcac 27600
gtcccaaatc tccttggcac tcttcaaccc ttgcacctta ttatactcct ctcaacatag 27660
agaggcgatg agtatggtag tggcttggga gttgaagtgc cagatttggg tgacctcgtc 27720
cgagtcgtag ccctcgtccc ctacggatgg tacctgcgct ccaaactcaa caatgtccca 27780
tatacttgcg tggagtgagg ttaggtgatg cctcatttta tcactccaca tacaatagtc 27840
ttcaccatca aaaccggtgg tttgcctatt gggacaaaaa gtaaaggagt gcgtttagaa 27900
atgcggggat agcgtagggc gatcttacta aacttcttgc gctcatggca cttagaagtg 27960
acggacggag cgtcggagcc ggaggtggag ggcgacgaag aatcggtctc gtagtagacc 28020
actttcttca tctttttctt tttgtcgcca ctccggtgtg acttgacgcg ggaggtgatt 28080
cctcccttcc tttggtgtcg gactcccttg atggagcctt cccgtggctt gtgcccgttt 28140
ccatctccct cttggcggat cctcccgaca tcacttcgag tggttagact ctaatgaagt 28200
atcgcctttg ataccaattg aaagtcgcct agagggggtg gataggcgga aactgaaatt 28260
tacaaacttt aagcacacta caagctgtgg taagcgttag aatgaaatcc gagtccggga 28320
gagaggggaa aataaatcaa ccaacaaaat aaagcggatg acacggtgat ttgttttacc 28380
gaggttcggt tctaaggaac ctagtccccg ttgaggtggt cacaaagact gggtctgttt 28440
caaccctttc cctctctcaa acggtcacct agaccgagtg agctttctcc ttaatcaaac 28500
gggtcactta gaccccacaa ggaccaccac acacttggtg tctcttgttt tgattacaag 28560
tcacttagag aacaagaatg agaaagaaga aagccaacca agcaacaaga gcaacaagga 28620
aacataagaa acaatcctct cacaagtcct aaagactata attgaattgg ggactttgat 28680
cggatcaaag gctttgattt gtgtcttgga gtgttgtgtt ttgcttttgt attgaatgga 28740
gggtagtgaa tgtttggatt gttggagtgg aggtggttgt ggggtattta tagcccccaa 28800
ccaccaattc aaccgttggg ggtggctgct atcgatgggc gcaccggata gtccggtgtg 28860
ccaccggaca ctgtcaggtg cgccagccac gtcacccaac cgttagggtt ctggcggttt 28920
cgaccgttgg agctttgtct tctagtggca ccggacagtc cggtgccgca ccggacaggc 28980
actgtttact gtccggtgcg cctctggtgg ttgctctgac ttctgcgcga actgtccgcg 29040
cactgtagtg ttgcaggcga ccgttgcaag cgaccgttgc gttgttagcc gttgctccgc 29100
ttggtgcacc ggacagtcgg gtggcacacc ggacagtcca gtgaattata gcggagcgac 29160
gcctgagaaa cctgaaagtg aagagtttgg agtcgtacgg ccctggtgca ccggacactg 29220
cccggtggca caccggacag tccggtgcac cctcttcagt ttcttttgct cctttctttt 29280
gaaccctaac ttgatcttta tatcggtttg tgttgaacct ttagcacctg tagagtatat 29340
aatctagagc aaactagtta gtccaattat ttgtgttggg cattcaacca ccaaaattat 29400
ttataggaaa aggttaaccc ctatttccct ttcactatcc acttagctga ggcaaaatgg 29460
accaattcct atgattttga tctgacgacc acacactcta cacgaagttt tttcgcctcg 29520
acgcaccctt ttcgatgatg ccacgtgtcg catctgattc ttgttggaac cgcactaccg 29580
agttttgagg tccaaactca gcaaaattag caattgggtg atattgaggc tcaaccactg 29640
aaaccaccgt gagtagcgca ctgcatgcac gtcccacttc atagacacgt gtcccccagt 29700
ccttgaccgc gccagcaaca tgatttgctc tgccacgttc tcacgcaccc gtgtcgtgcg 29760
tgccttaggt gtcagccacc gcgcgactag tttcttggct tctctggtcc cttagtcaag 29820
tcccagcact cgtactttgc cactcccggt tcatcggcac gaatccgcat gaccttcata 29880
ttctgcgtca accatatcgt ccctgtggtc cacacctcca cttcataagc cgacagacat 29940
ggttgtacaa cacaagctct cgtactctgg ttagttcaag actcacagca aaacaatacc 30000
tgttggcaat ctctcattat caaaccgaat ctcaagggat aagtacgtca accttgtgtt 30060
cgcaaagacg tccaccttta ttcccgatta tatgatccga tactagaaat gacttttagt 30120
acttgttctt ggcttgaacc tgttggtgtt ttcaaccgca ctaagggctt gttcgttttt 30180
gcgttaatcc atgtggattg ggtgggattg agtcggatta aatccatagc aaatcaaaat 30240
ccatcccaat cccacccaat acacttcaat ccacatggaa tatcaataac cgaacaaggc 30300
ctaaagagtt gaaattcatt actggttcgt tactagaagt ctagaaccag tactgatgat 30360
atctgtgcat atttagtact ggttagtgtc tccaaccggt actaaagact taatattact 30420
agcacttgat gagggacact aataagtact aatgtactct atatggactc cggtctgcat 30480
ttaaaatcgg tgttgatgcc tatatgaata tgggttttaa aacaactcga ataaggggat 30540
gtttggtttc tagggactaa tgtttagtcc ctatatttta ttccatttta gttccaaaat 30600
tgctaaatat agaaactaaa actttatttt agtttctata tttagcaatt tatagactaa 30660
aaaggaataa aatgaaggga ctaaacatta gtccctagaa accaaacacc ccctaaatgt 30720
tgatgtagga agcctagttc tcttgccgtg gcgtttacag aaaaaaaaag actaaagtaa 30780
agtagcattc tccattatcg gtcgaattta gaagagaatg tgcagactca tttatcgctg 30840
tttgctaaga ttgggatctc aatcatattc gtttccgttc caagcagctt ttgccccggc 30900
cgtttggctg caaccttgca gggctcacat gaaatccctc agcatcctgc tgcatatcat 30960
ttgctacctt catggcttca gtccacactt cacacctgca ggcttgtagc tagctggatt 31020
ctcacacact ccccagctcc cacacgtcct ccgatccgat ccgatcccga tcctccagaa 31080
gaggggcgag ctgcaagcgt agggcggcag catgatgcac tcgcaccacc ctcactacca 31140
tccgcgtttc cacccgccgt cgtcctcctc gtct 31174
<210> 2
<211> 2477
<212> DNA
<213>Zea mays Linn.
<400> 2
attcatatta tgagccatgt gtaaatgagt tgagacttat ttccagtagc tatagacacc 60
taagtgctca aagatcattc aatattagtg tagatacttt tatgaagtgc ttagattagt 120
tagaccgctg ctatagcact tgttcttgat tttgtcctag tgttacaagt gaggattaga 180
cactcatatc cctttggtgc ttgcacacat aactatatta gttgtaccaa atgggcccat 240
aatcttgcaa gatcacatca actatgttta tggtgtggat gtcagcggtg tattggagga 300
aatgagacat atggcatttc gagcagaaaa tcatgtgcaa cacaaaagca cactactaga 360
gaatatatca tcggtgccgg ttgggaactg gttatagtat cagatttcca accggtacta 420
agcaacatat actaaagact gaagtatcga aaaggtaacc agagggggtg aatgggtgcc 480
aatcaaatta tgttgcttaa aaactggaac ttgagcactt aacttcaatg gagatgaaga 540
attcgctcaa aacaaaagaa catcaaccaa ccggtgtctt atatttcaaa aacgttccta 600
ggattcacgc gagaccaaca aaataaacgg atcgcaaatc ggacaccaaa aagtctaaat 660
cagtccaaaa ccatgtcgat atctagtgtt gttttcagta actcgaattt cagttttcga 720
atgcgaaact aaaccaaacg ggctctgatt gagctgaaat ttggcacaca cctttacaaa 780
tgagtctcca aggtctccac aaaattttaa ctcaaccgga tttataaatc aatcacagat 840
cagaaaacat agactagatc ggggcttagt tggggttttc aaaatgagtt cggatcggat 900
cacaaccata aactgctcaa accagatgat tgtagtggtc tagagagtga tatttatccc 960
aatacaacaa tccccaactc aataaatcaa ggattattcc aaaatctaag agaggaaacg 1020
agcgcggaga caaaatcgaa taaaaaactt cagcacatac aaactgagca cgcgatttgc 1080
caaatcctat ggatggatct ggccaccctt ccttaaagtg atgcgatgaa gaatacaaaa 1140
gcacagacat cgtgttcaaa tcatctatgg atctcacgct aaactaggga aatagaaact 1200
agagttttct aaatgaagca caaatgagct agctaaagag atagttgtcc acaataaccc 1260
acctatttat ttatagaggg ttatttcact agtctaaact acacctagaa atacatagag 1320
cctatccact tagccgaggc aaaatgaacc aactcttggg attttgatct gatgaccacg 1380
cgctgcacac gaaattgctt cgcctcgacg cacccttttt gatgatgtca cgtgccacat 1440
ctgattcttg ttggaacgac actatcgaga tttgaggtcc aaactcagca aaaccagcag 1500
ttgggtggtt ttgaggctca accaccgaaa gtttgaaacc accatgagta gcgcaccgaa 1560
tgcgcgtccc cgcgtcctgg acacatgtcc ccgagtcctt attgggctgg cgacatgatc 1620
tactctgcca cgttctcacg tgtccatgcg tgcctcaggt gtcagccacc acgactagtt 1680
tctcagcttc tctagctagt cctttagtca agttccagca ctcgtcattc gctgctcccg 1740
gtccatcggc actaacccgc atgaccttca ccttcggcgt caaccatatc gtccttgtgg 1800
tccacacctc cacttcataa gctgacatgc atggttgcac aacacaagct atcgtactct 1860
ggttagttca agacttacac caaagtaata cctgttgaca actctcgtta ttaacccaaa 1920
ccataaggga taagtcaacc ttgtgttcgc aaagatgtcc acaagattgg gatgaatata 1980
tgatgaatat atgaatatga atagatttga aaacaactcg aataaatgtt gatgtacgaa 2040
agcctagtta tcccgtagtg gcgttacaga aaataaaaaa aggactaaag taaagtagca 2100
ttctccatta tcggtcgaat ttggaagaaa atgtgcaaac tcatttatcg ctgtttgcta 2160
agattgggat ctcaatcata ttcgtttccg ttacaagcag cttttccccg tttggctgca 2220
actgcaacct tgcagggctc acatgaaatc cctcagcatc gtcctgctgc atatcatttg 2280
ctaccttcat ggcttcagtc cacacttcac acctgcaggc ttgtagctag ctggattctc 2340
acacactccc cagctcccac acgtcctccg atccgatcct ccagaagagg agcgagctgc 2400
aagcgtaggg cagcatgatg cactcgcacc accctcacta ccatccgcgt ttccacccgc 2460
cgtcgtctga ggaagtg 2477
<210> 3
<211> 30
<212> DNA
<213>Artificial sequence
<400>3
tggctctgca actacatatt gttttataat 30
<210> 4
<211> 28
<212> DNA
<213>Artificial sequence
<400> 4
ttcgaccgat aatggagaat gctacttt 28
<210> 5
<211> 20
<212> DNA
<213>Artificial sequence
<400> 5
<210> 6
<211> 20
<212> DNA
<213>Artificial sequence
<400>6
<210> 7
<211> 25
<212> DNA
<213>Artificial sequence
<400> 7
ggttagactc taatgaagta tcgcc 25
<210> 8
<211> 22
<212> DNA
<213>Artificial sequence
<400> 8
gacacgtggc atcatcgaaa ag 22
<210> 9
<211> 1311
<212> DNA
<213>Artificial sequence
<400> 9
atgatgcact cgcaccaccc tcactaccat ccgcgtttcc acccgccgtc gtcctcctcg 60
tctgaggcgg tggacatgga cccccgcgtg tggagccggc tgccgcagcc gctggtggac 120
cgcgtgctgg cgtgcctacc gacgccatcc ttcctccgtc tccgggccgc ctgccgccgc 180
ttcggcaacc tcatctactc gtcgccgttc ctccactccc acctcctcct ctcgccgcac 240
ctccccttct tcgccttcgc cgtcccttcc gcggggtacc cgtacctcct cctgctcgac 300
cccaccacgc aggcgcccgc gccctcctgg tcccgcctcc cgctgccgct gccggccgcg 360
cccggcgccg tgcaggcggc gttctccccg gcggccgcgt cggcgggcct gctcgcgttc 420
ctgtcggacg cgtccggcca caagacgctg ctcctcgcca accccatcac gcgcctcctc 480
gcgccgctgc cgctctgccc caccgcgcgc ctctccccca ccgtcggcct cgccgcggga 540
cccacctcct tcatcgccgt cgttgccggc gacgacctcg tgtccccctt cgcggtcaag 600
aacatctccg cggacacgtt cgtcgccgac gccgcctccg tcccgccctc cggtttctgg 660
gcctcgagtt ccatcctgcc ccgcctctcc tccctcgacc cccgcgccgg catggctttc 720
gcctctggaa ggttctactg catgagctcg tcgccgttcg cggtgcttgt gttcgacgtg 780
gcaaccaacg tgtggagcaa ggtgcagccg ccgatgagga ggttcctgcg gtcgccggcg 840
ctcgtggagc tcggcggcgg gagggagcgc gaggcggtgg tggcgctggt ctccgccgtc 900
gaaaagagcc gcctcagcgt gccgcggagc gtgcgcgtgt ggacgctgcg aggcgagcac 960
ggagctgctg ccggcggaag caacggcggc ggagcgtgga ctgaggtggc gcggatgcca 1020
cccgacgtgc acgcgcagtt cgcggcggcc gagggcgggc gcgggttcga gtgcgcggcg 1080
cacggcgact tcgtggtgct ggcgccacgc gggcccgcga gccccgtgct cgtgttcgac 1140
tcgcgccacg acgagtggcg gtgggcgccg ccgtgcccgt acccgtaccc gtacgccgcg 1200
ggaggcgcgg ggttcagggt gttcgcctac gagccccgcc ttgcgacgcc ggccatcggt 1260
ctcctggacg ccacggcgcc ggcggccttt ttgcatggga tgcagggcta g 1311
Claims (8)
1. Detecting whether a substance containing 27.2-kb Ty1/Copia transposon exists in a promoter region of a maize gene Stiff1 to identify the maize stalk strength to be detected;
the 27.2-kb Ty1/Copia transposon is a DNA molecule at position 2156-29434 of the sequence 1 in the sequence table.
2. Detecting whether a substance containing 27.2-kb Ty1/Copia transposon exists in a promoter region of a maize gene Stiff1 in the application of preparing and identifying a maize stalk strength product to be detected;
the 27.2-kb Ty1/Copia transposon is a DNA molecule at position 2156-29434 of the sequence 1 in the sequence table.
3. Detecting whether a substance of 27.2-kb Ty1/Copia transposon is contained in a promoter region of a maize gene Stiff1 or not in the application of breeding high stalk strength maize;
the 27.2-kb Ty1/Copia transposon is a DNA molecule at position 2156-29434 of the sequence 1 in the sequence table.
4. Use according to any one of claims 1 to 3, characterized in that:
the substances for detecting whether the promoter region of the maize gene Stiff1 contains the 27.2-kb Ty1/Copia transposon include the following 1) or 2) or 3):
1) directly sequencing the required reagents or instruments;
2) amplifying the primers of the 27.2-kb Ty1/Copia transposon;
3) PCR reagents containing the primers;
the primers consist of the following primers I1, I2 and I3;
the I1 primer consists of a DNA molecule shown in a sequence 3 and a DNA molecule shown in a sequence 4;
the I2 primer consists of a DNA molecule shown in a sequence 5 and a DNA molecule shown in a sequence 6;
the I3 primer consists of a DNA molecule shown in a sequence 7 and a DNA molecule shown in a sequence 8.
5. A method for identifying the strength of corn stalks to be detected comprises the following steps: detecting whether a promoter region of a maize gene Stiff1 to be detected contains a 27.2-kb Ty1/Copia transposon; the stalk strength of the corn to be detected containing the transposon is higher than that of the corn to be detected not containing the transposon;
the 27.2-kb Ty1/Copia transposon is a DNA molecule at position 2156-29434 of the sequence 1 in the sequence table.
6. A method for breeding corn with high stalk strength comprises the steps of detecting whether a promoter region of a corn gene to be detected Stiff1 contains a 27.2-kb Ty1/Copia transposon; breeding the corn to be detected containing the fragment to obtain the corn with high stalk strength;
the 27.2-kb Ty1/Copia transposon is a DNA molecule at position 2156-29434 of the sequence 1 in the sequence table.
7. The method according to claim 5 or 6, characterized in that:
the method for detecting whether the promoter region of the maize gene Stiff1 to be detected contains 27.2-kb Ty1/Copia transposon comprises the following steps: amplifying the maize to be tested with the primers of claim 4,
if the I1 primer has an amplification product and the I2 primer and the I3 primer have no amplification product, the maize to be detected does not contain the 27.2kb Ty1/Copia transposon;
if the I1 primer has no amplification product and the I2 primer and the I3 primer have amplification products, the maize to be tested contains 27.2kb Ty1/Copia transposon.
8. The application of the DNA fragment shown in the 2156-th 29434 site of the sequence 1 in the sequence table in the identification of the corn stalk strength.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911017281.0A CN110669860B (en) | 2019-10-24 | 2019-10-24 | Method for detecting strength of maize stalks and specific transposon thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911017281.0A CN110669860B (en) | 2019-10-24 | 2019-10-24 | Method for detecting strength of maize stalks and specific transposon thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110669860A CN110669860A (en) | 2020-01-10 |
CN110669860B true CN110669860B (en) | 2021-03-23 |
Family
ID=69084187
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201911017281.0A Active CN110669860B (en) | 2019-10-24 | 2019-10-24 | Method for detecting strength of maize stalks and specific transposon thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110669860B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112795691B (en) * | 2021-03-24 | 2022-02-18 | 湖南农业大学 | Molecular marker linked with corn stem thickness and application thereof |
CN113088523B (en) * | 2021-04-01 | 2022-04-26 | 中国农业大学 | Transposon and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103789304A (en) * | 2014-01-14 | 2014-05-14 | 南京农业大学 | IL-1 receptor antagonist protein (IRAP) marker developed based on pear genome and application thereof |
CN104981481A (en) * | 2012-12-18 | 2015-10-14 | 梅塔玻利克斯公司 | Transcriptional regulation for improved plant productivity |
CN108441571A (en) * | 2017-02-14 | 2018-08-24 | 中国农业大学 | Application of the corn molecular labeling in identifying and regulating and controlling corn rough dwarf resistance trait |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CA2529658C (en) * | 2003-06-23 | 2017-09-12 | Pioneer Hi-Bred International, Inc. | Engineering single-gene-controlled staygreen potential into plants |
CN102731634B (en) * | 2011-04-14 | 2014-04-16 | 中国农业科学院作物科学研究所 | Pleiotropic gene associated protein from wheat, encoding gene thereof and application |
CN110157834B (en) * | 2019-07-01 | 2022-04-19 | 北京市农林科学院 | SNP site OE2-5 related to high lysine character of corn and application thereof |
-
2019
- 2019-10-24 CN CN201911017281.0A patent/CN110669860B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN104981481A (en) * | 2012-12-18 | 2015-10-14 | 梅塔玻利克斯公司 | Transcriptional regulation for improved plant productivity |
CN103789304A (en) * | 2014-01-14 | 2014-05-14 | 南京农业大学 | IL-1 receptor antagonist protein (IRAP) marker developed based on pear genome and application thereof |
CN108441571A (en) * | 2017-02-14 | 2018-08-24 | 中国农业大学 | Application of the corn molecular labeling in identifying and regulating and controlling corn rough dwarf resistance trait |
Non-Patent Citations (2)
Title |
---|
Sequence evolution and copy number of Ty1-copia retrotransposons in diverse plant genomes;Navarro-Quezada, A et al.;《PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA》;20080108;第99卷(第1期);第268-273页 * |
玉米基因组学及农艺性状基因克隆研究进展;高志勇等;《湖北农业科学》;20160310(第5期);第1094-1098页 * |
Also Published As
Publication number | Publication date |
---|---|
CN110669860A (en) | 2020-01-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104024438B (en) | Snp loci set and usage method and application thereof | |
CN110511945B (en) | Rice fertility regulation gene, mutant and application thereof | |
AU2019276382B2 (en) | Use of Yr4DS gene of Aegilops tauschii in stripe rust resistance breeding of Triticeae plants | |
AU2021201537B2 (en) | Methods of increasing crop yield under abiotic stress | |
CN101939445A (en) | Be used to prepare polynucleotide and the method for the plant of resistant to fungal pathogens | |
CN113121664A (en) | Method for identifying, selecting and generating disease resistant crops | |
CN113490683B (en) | Gray spot resistance related protein ZmWAK-RLK, and coding gene and application thereof | |
CN110669860B (en) | Method for detecting strength of maize stalks and specific transposon thereof | |
AU2016369320A1 (en) | Brassicaceae plants resistant to plasmodiophora brassicae (clubroot) | |
CN103865937A (en) | Cytoplasmic male sterility restorer gene in rice and application thereof | |
AU2022202318A1 (en) | Methods of increasing specific plants traits by over-expressing polypeptides in a plant | |
CN109705202A (en) | A method of cultivating anti-graywall plant | |
CN111690689A (en) | Construction method and application of humanized CCR2 gene modified animal model | |
CN113874388A (en) | Parthenogenesis genes | |
CN111295447A (en) | Maize elite event MZIR098 | |
CN109134633B (en) | Rice blast resistant protein and gene, isolated nucleic acid and application thereof | |
KR20230088741A (en) | Modified promoters of parthenogenetic genes | |
CN102732531B (en) | Rice blast resistant gene RMg7, RMg8 or RMg9, and its application | |
CN109797158A (en) | The rice high temperature resistant gene of application and acquisition of the gene OsNTL3 in terms of improveing rice high temperature resistance | |
KR101760932B1 (en) | Molecular Markers related a Restorer-of-Fertility gene and Methods for Selecting of Male-Fertility or Male-Sterility in Onion | |
CN111763249B (en) | Plant powdery mildew resistance related protein Pm5e, and coding gene and application thereof | |
KR101760931B1 (en) | Molecular Markers related a Restorer-of-Fertility gene and Methods for Selecting of Male-Fertility or Male-Sterility in Onion | |
KR101760934B1 (en) | Molecular Markers related a Restorer-of-Fertility gene and Methods for Selecting of Male-Fertility or Male-Sterility in Onion | |
CN111808872A (en) | Gene DPY1 for regulating and controlling panicolaceae plant type and application and method thereof | |
JP4418242B2 (en) | Rice with improved disease resistance against white leaf blight of rice and its production method |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |