CN110669854B - Primer probe combination for identifying staphylococcus aureus and drug resistance thereof - Google Patents
Primer probe combination for identifying staphylococcus aureus and drug resistance thereof Download PDFInfo
- Publication number
- CN110669854B CN110669854B CN201911080810.1A CN201911080810A CN110669854B CN 110669854 B CN110669854 B CN 110669854B CN 201911080810 A CN201911080810 A CN 201911080810A CN 110669854 B CN110669854 B CN 110669854B
- Authority
- CN
- China
- Prior art keywords
- seq
- staphylococcus aureus
- probe
- methicillin
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of biology, in particular to a primer probe combination for identifying staphylococcus aureus and drug resistance thereof. The primer probe combination provided by the invention comprises a universal primer and a probe for staphylococcus aureus, and a specific primer and a probe for methicillin-resistant staphylococcus aureus. The primer and the probe have good specificity, and can realize rapid, accurate and sensitive identification of SA and MRSA by combining a real time PCR detection method. Experiments show that the lowest detection limit of the primer probe for detecting staphylococcus aureus is 3CFU/ml, and the lowest detection limit of methicillin-resistant staphylococcus aureus is 5CFU/ml.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a primer probe combination for identifying staphylococcus aureus and drug resistance thereof.
Background
Staphylococcus aureus (Staphylococcus aureus, SA) is a gram-positive coccus, an important pathogen for humans, belonging to the genus Staphylococcus (Staphylococcus) and causing community and hospital infections. In recent years, with the widespread use of penicillin, some staphylococcus aureus produces penicillinase, which can hydrolyze beta-lactam ring, and the phenomenon of drug resistance enhancement, which is shown to be drug resistance to penicillin, especially methicillin-resistant staphylococcus aureus (MRSA), is attracting more and more attention.
The detection method of the staphylococcus aureus is various, the bacterial separation culture is a 'gold standard' for microorganism detection, the method is reliable, but the method is time-consuming and labor-consuming, the requirement of rapid detection cannot be met, and the common immunofluorescence method has certain specificity and sensitivity, but the result is unstable due to the influence of the type and concentration of the antibody, and false positives can sometimes occur. In order to overcome the problems, the multiplex fluorescent quantitative RT-PCR technology is used for diagnosing SA and MRSA infection, and the method has the characteristics of rapidness, sensitivity, strong specificity and the like, and the probe has high conservation, so that the detection efficiency is greatly improved.
However, at present, unreasonable phenomena exist in selection of gene fragments identified aiming at SA and MRSA and in relation to primer probes, so that most detection reagents cannot realize accurate, rapid and sensitive detection.
Disclosure of Invention
In view of the above, the technical problem to be solved by the present invention is to provide a primer probe combination for identifying staphylococcus aureus and its drug resistance, which can accurately, rapidly and sensitively identify SA and MRSA.
The primer probe combination provided by the invention comprises the following components:
specific primer pairs of staphylococcus aureus shown as SEQ ID NO. 1-2;
a specific probe of staphylococcus aureus as shown in SEQ ID NO. 3;
a methicillin resistance detection primer pair shown as SEQ ID NO. 4-5;
and a methicillin-resistant detection probe as shown in SEQ ID No. 6.
The primers and probes of staphylococcus aureus are used for qualifying staphylococcus aureus, and can detect whether methicillin-resistant staphylococcus aureus or sensitive staphylococcus aureus. The primers and probes for detecting the methicillin resistance are used for detecting the methicillin resistance gene in staphylococcus aureus, and the primers and probes can not amplify sensitive staphylococcus aureus, but can amplify methicillin-resistant staphylococcus aureus.
In the invention, the fragment amplified by the primer pair shown in SEQ ID NO. 1-2 is shown in SEQ ID NO. 11;
the amplified fragment of the primer pair shown as SEQ ID NO. 4-5 is shown as SEQ ID NO. 12.
The primer probe combination provided by the invention further comprises:
internal standard amplification primer pairs shown as SEQ ID NO. 7-8;
an internal standard probe shown as SEQ ID NO. 9.
In the invention, the sequence of the internal standard is shown as SEQ ID NO. 10.
In the invention, the 3 'end of the probe is connected with a quenching group, and the 5' end is connected with a fluorescent group; wherein:
the 5' end of the probe shown in SEQ ID NO.3 is connected with a FAM fluorescent group;
the 5' end of the probe shown in SEQ ID NO.6 is connected with a ROX fluorescent group;
the 5' end of the probe shown in SEQ ID NO.9 is connected with HEX fluorescent group.
The primer probe combination is applied to preparation of a kit for detecting staphylococcus aureus and methicillin resistance thereof.
The primer and the probe provided by the invention can detect a plurality of targets simultaneously in one reaction system, have good accuracy, specificity and sensitivity, and can save cost. Because the invention adopts the probe with higher specificity to be applied to the kit, the invention can rapidly detect staphylococcus aureus and methicillin-resistant staphylococcus aureus nucleic acid in unknown samples, provides reliable experimental basis for diagnosing staphylococcus aureus and methicillin-resistant staphylococcus aureus nucleic acid, and solves the technical problems of low efficiency, poor specificity and low sensitivity of the existing kit.
The invention also provides a detection kit for staphylococcus aureus and methicillin resistance thereof, which comprises the primer probe combination and Real time PCR reaction reagent.
The Real time PCR reaction reagent comprises: dNTPs, MLV enzyme, taq enzyme, mgCl 2 。
Wherein the concentration of dNTPs is 10mM, the concentration of MLV enzyme is 200u/ul, the concentration of Taq enzyme is 5u/ul, mgCl 2 Is 50mM.
The kit also comprises a negative control and a positive control; wherein the negative control is sterile water, and the positive control is artificially synthesized with a concentration of 1×10 6 Copies/ml pseudovirus.
The invention also provides a method for detecting staphylococcus aureus and methicillin resistance thereof for non-diagnosis or treatment purpose, which comprises the following steps: detecting Real time PCR on the sample by adopting the primer probe combination, judging whether the sample is infected by staphylococcus aureus according to the detected Ct value, and judging whether the sample is infected by methicillin-resistant staphylococcus aureus;
the judging comprises the following steps:
the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 have no fluorescence value, the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 37, and the detection result is reported to be negative;
the CT value of the probe channel shown in SEQ ID NO.3 is less than or equal to 38, but the CT value of the probe channel shown in SEQ ID NO.6 is more than or equal to 38, and the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the probe channel is reported to be positive to staphylococcus aureus, but not methicillin-resistant staphylococcus aureus;
the CT values of the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 are both less than or equal to 38, and the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the test result is reported to be positive to staphylococcus aureus and methicillin-resistant staphylococcus aureus;
the CT values of the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 are all more than or equal to 38, but the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the concentration of the staphylococcus aureus sample is reported to be lower than the detection lower limit, and the result is only used as a reference;
when the CT value of the probe channel shown in SEQ ID NO.9 is more than or equal to 38 and any one of a typical S amplification curve, a positive control without CT value or amplification curve appears in the negative control, the detection result is invalid, the cause is searched and eliminated, and the test is repeated.
The detection of non-diagnostic objects according to the invention essentially comprises
The reaction system of Real time PCR comprises:
the reaction program of the Real time PCR comprises the following steps:
the primer probe combination provided by the invention comprises a universal primer and a probe for staphylococcus aureus, and a specific primer and a probe for methicillin-resistant staphylococcus aureus. The primer and the probe have good specificity, and can realize rapid, accurate and sensitive identification of SA and MRSA by combining a real time PCR detection method. Experiments show that the lowest detection limit of the primer probe for detecting staphylococcus aureus is 3CFU/ml, and the lowest detection limit of methicillin-resistant staphylococcus aureus is 5CFU/ml.
Detailed Description
The invention provides a primer probe combination for identifying staphylococcus aureus and drug resistance thereof, and a person skilled in the art can properly improve the technological parameters by referring to the content of the invention. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods and applications herein without departing from the spirit and scope of the invention.
The test materials and instruments adopted by the invention are common commercial products and can be purchased in the market.
The invention is further illustrated by the following examples:
example 1 preparation of a Staphylococcus aureus and methicillin-resistant Staphylococcus aureus diad nucleic acid detection kit
Primer and probe sequences in the kit are shown in the following table 1:
TABLE 1 primer, probe sequences
| Name of the name | Nucleotide sequence | |
| SA upstream primer | SEQ ID NO：1 | AGAAAATTGAAGTCGAGTTTGACAAAG |
| SA downstream primer | SEQ ID NO：2 | TAAACATAAGCAACTTTAGCCAAGCC |
| SA probe | SEQ ID NO：3 | TGGACGTGGCTTAGCGTATATTTATGCTG |
| MRSA upstream primer | SEQ ID NO：4 | CAGTTATTGGATATTCGTGTCGTCAT |
| MRSA downstream primer | SEQ ID NO：5 | ACATTCAAATACGATAGACATTGTTGT |
| MRSA probe | SEQ ID NO：6 | CCAGCCAATGATCCAGCTTTATTTGAATCT |
| Internal standard upstream primer | SEQ ID NO：7 | TCTTATCTTCCTCCCACAGCTCC |
| Internal standard downstream primer | SEQ ID NO：8 | GTGGGGTGAATTCTTTGCCA |
| Internal standard probe | SEQ ID NO：9 | CGTGCTGGTCTGTGTGCTGGCC |
The kit also comprises: 10mM dNTPs,200 u/. Mu.l of MLV enzyme, 5 u/. Mu.l of Taq enzyme, 50mM of MgCl 2 . The kit also comprises a negative control (sterile water) and a positive control (synthetic concentration 1×10) 6 Copies/ml pseudovirus).
Example 2 detection method of the kit of the present invention
The detection method of the invention is Real Time RT-PCR, the Real Time RT-PCR reaction process is (1) pre-denaturation, the Time and the length depend on the length and the base composition of target nucleic acid, the pre-denaturation temperature is generally 90-105 ℃, the Time is generally 2-10 min, and the purpose of pre-denaturation is to thoroughly separate double-chain nucleic acid sequences into single chains; (2) Denaturation, the temperature is generally 91-105 ℃, and the time is generally 10-35 s; (3) Annealing, each primer is annealed to a target sequence of human staphylococcus aureus and methicillin-resistant staphylococcus aureus or internal standard quality control nucleic acid. The annealing temperature is usually 40-60 ℃, the annealing time can be 10-60 s (4) extension, the primer is combined with the template, the synthesis of a new DNA double strand is started, the extension temperature is usually 40-80 ℃, and the extension time can be 10-1 min.
The composition of each assay system is shown in Table 2:
fluorescence detection channel selection: (1) Selecting FAM channel (reporTer: FAM, quenCher: none), and detecting human Staphylococcus aureus; (2) Selecting ROX channel (ReporTer: ROX, quenCher: none), and detecting human methicillin-resistant Staphylococcus aureus; (3) selecting HEX channel, detecting internal standard; (3) the reference fluorescence (PAssive ReferenCe) was set to none. The fluorescent quantitative real-time reaction conditions are shown in Table 3 below.
Table 3: fluorescent quantitative real-time PCR reaction condition
After the reaction is finished, the instrument automatically stores the result, automatically analyzes or manually adjusts the starting value, the ending value and the threshold line value of the baseline by using the software of the instrument, analyzes, and then records the CT value and the fixed value result of the sample. The specific test results were analyzed as follows:
the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 have no fluorescence value, the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 37, and the detection result is reported to be negative;
the CT value of the probe channel shown in SEQ ID NO.3 is less than or equal to 38, but the CT value of the probe channel shown in SEQ ID NO.6 is more than or equal to 38, and the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the probe channel is reported to be positive to staphylococcus aureus, but not methicillin-resistant staphylococcus aureus;
the CT values of the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 are both less than or equal to 38, and the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the test result is reported to be positive to staphylococcus aureus and methicillin-resistant staphylococcus aureus;
the CT values of the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 are all more than or equal to 38, but the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the concentration of the staphylococcus aureus sample is reported to be lower than the detection lower limit, and the result is only used as a reference;
when the CT value of the probe channel shown in SEQ ID NO.9 is more than or equal to 38 and any one of a typical S amplification curve, a positive control without CT value or amplification curve appears in the negative control, the detection result is invalid, the cause is searched and eliminated, and the test is repeated.
Example 3 feasibility test of the kit of the invention
1. Minimum limit of detection (LOD) test
(1) The staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent is prepared by the following steps: a staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid assay was prepared by using the method of example 1.
(2) Bacterial sample extraction
Mixing 5 staphylococcus aureus with methicillin-resistant staphylococcus aureus human throat swab eluent in a tube uniformly by a liquid transfer device, taking out 100 μl into a new centrifuge tube, centrifuging at 12000rpm for 5min, and carefully discarding the supernatant; 200. Mu.l of bacterial lysate (from Beijing Bai Albo technology Co., ltd.) was added to the pellet, thoroughly mixed, and centrifuged at 10000rpm in a water bath at 100℃for 5min for further use.
(3) Sample detection
25 μl of the treated sample supernatant was added to a reaction tube of a duplex nucleic acid detection reagent for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, each concentration was 20 multiplex wells, and 25 μl of purified water was added to the detection solution as a negative control, and the detection was performed according to the detection method in example 2.
(4) Analysis of results
The detection of the sample of each concentration gradient of the staphylococcus aureus and methicillin-resistant staphylococcus aureus bigeminal nucleic acid detection reagent by using the kit prepared in the example 1 and the detection method in the example 2 shows that the detection sensitivity (LOD) staphylococcus aureus of the detection method is 3CFU/ml, and the methicillin-resistant staphylococcus aureus is 5CFU/ml, and the specific data are shown in Table 4 and Table 5.
Table 4: staphylococcus aureus detection limit confirmation
| Sample concentration (CFU/ml) | Detecting the repetition number | Number of positive tests | Positive detection rate |
| 0 | 21 | 0 | 0.00％ |
| 1 | 21 | 15 | 71.43％ |
| 3 | 21 | 21 | 100.00％ |
| 9 | 21 | 21 | 100.00％ |
| 27 | 21 | 21 | 100.00％ |
TABLE 5 confirmation of detection limits of human methicillin-resistant Staphylococcus aureus
| Sample concentration (CFU/ml) | Detecting the repetition number | Number of positive tests | Positive detection rate |
| 0 | 21 | 0 | 0.00％ |
| 1.5 | 21 | 18 | 85.71％ |
| 2.5 | 21 | 21 | 100.00％ |
| 5 | 21 | 21 | 100.00％ |
| 10 | 21 | 21 | 100.00％ |
2. Cross-reaction with other diseases
(1) The staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent was prepared by adopting the method of example 1.
(2) Cross pathogen sample extraction
Mixing staphylococcus aureus, methicillin-resistant staphylococcus aureus, methicillin-sensitive staphylococcus aureus (MSSA), coagulase-negative staphylococcus (CNS), methicillin-resistant staphylococcus epidermidis (MRSE), diphtheria bacillus, haemophilus influenzae, denatured bacillus, streptococcus pneumoniae, escherichia coli, pseudomonas aeruginosa and candida albicans throat swab eluate in a tube uniformly by using a pipette, taking 100 mu l of the mixture out in a new centrifuge tube, centrifuging the mixture at 12000rpm for 5min, and carefully discarding the supernatant; 200. Mu.l of the virus lysate was added to the pellet, thoroughly mixed, water-bath at 100℃for 5min, and centrifuged at 10000rpm for 5 min.
(3) Sample detection
25 μl of the treated sample supernatant was added to a staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reaction tube, and simultaneously 25 μl of purified water was added to the detection solution as a negative control, and the extracted staphylococcus aureus and methicillin-resistant staphylococcus aureus were tested as positive control tests according to the test method in example 2.
(4) Analysis of results
By using the kit prepared in example 1 and the detection method in example 2, other pathogens except staphylococcus aureus and methicillin-resistant staphylococcus aureus are detected, and the results show that: the kit provided by the invention has no cross reaction on pathogen infection samples such as staphylococcus aureus, methicillin-resistant staphylococcus aureus positive control, methicillin-resistant staphylococcus aureus (MSSA), coagulase-negative staphylococcus (CNS), methicillin-resistant staphylococcus epidermidis (MRSE), diphtheria bacillus, haemophilus influenzae, bacillus mutans, streptococcus pneumoniae, escherichia coli, pseudomonas aeruginosa and the like, and has high specificity, and specific results are shown in table 6.
Table 6: cross reaction experiment
| Sample name | Detection result | Sample name | Detection result |
| Staphylococcus aureus | Positive and negative | Haemophilus influenzae | Negative of |
| MRSA | Positive and negative | Denatured bacillus | Negative of |
| MSSA | Negative of | Streptococcus pneumoniae | Negative of |
| CNS | Negative of | Escherichia coli | Negative of |
| MRSE | Negative of | Pseudomonas aeruginosa | Negative of |
| Diphtheria bacillus | Positive and negative | Negative control | Negative of |
3. Tamper resistance to potentially foreign substances
(1) The staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent is prepared by the following steps: the preparation of a staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent was performed by the method of example 1.
(2) Sample processing
And selecting high-value and low-value concentration values of staphylococcus aureus and methicillin-resistant staphylococcus aureus. Two staphylococcus aureusConcentration values of 1X 10 respectively 8 CFU/ml and 5CFU/ml, and methicillin-resistant Staphylococcus aureus at 1×10 concentration respectively 8 CFU/ml and 10CFU/ml. At the same time, interfering substances were added to the corresponding virus samples at a peak concentration (Cmax) of 3 times, and the samples were treated by the cross-reaction method of example 3 and tested according to the test method of example 2.
(3) Analysis of results
Interference judgment: the interference rate% is smaller than the accuracy bias allowed by the line standard of the project (set as 10%), and the pass can be judged.
The interference rate calculation formula: (interference sample concentration-control sample concentration)/control sample concentration x 100%.
Experiments show that when samples contain common antiviral drugs such as ribavirin, menthol, tenofovir, lamivudine, benzocaine, adefovir Wei Cu, dexamethasone, entecavir, epinephrine, zanamivir (200 ug/ml) and the like, the detection sensitivity of the kit is not obviously interfered, and the detection sensitivity is specifically shown in table 7.
Table 7: anti-interference experiment of exogenous substances
| Drug name | Interference ratio (%) | Drug name | Interference ratio (%) |
| Ribavirin | 1.2 | Adeford Wei Cu | 2.1 |
| Menthol crystal | 2.6 | Dexamethasone | 3.2 |
| Tenofovir | 0.8 | Entecavir | 1.6 |
| Lamivudine | 1.2 | Epinephrine system | 2.5 |
| Benzocaine | 3.3 | Zanamivir | 2.4 |
4. Interference resistance against potentially endogenous substances
(1) The staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent is prepared by the following steps: a staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent was prepared by using the method of example 1.
(2) Sample processing
And selecting high-value and low-value concentration values of staphylococcus aureus and methicillin-resistant staphylococcus aureus. The two concentration values of staphylococcus aureus are respectively 1 multiplied by 10 8 CFU/ml and 5CFU/ml, and methicillin-resistant Staphylococcus aureus at 1×10 concentration respectively 8 CFU/ml and 10CFU/ml. At the same time, interfering substances were added to the corresponding virus samples at a peak concentration (Cmax) of 3 times, and the samples were treated by the cross-reaction method of example 3 and tested according to the test method of example 2.Meanwhile, 200mg/dL hemoglobin, 3000mg/dL triglyceride, 20mg/dL bilirubin and other interfering substances are added into corresponding virus samples, and the samples are processed by the cross reaction method in the example 3 and detected according to the detection method in the example 2.
(3) Analysis of results
Interference judgment: the interference rate% is smaller than the accuracy bias allowed by the line standard of the project (set as 10%), and the pass can be judged.
The interference rate calculation formula: (interference sample concentration-control sample concentration)/control sample concentration x 100%.
Experiments show that when the sample contains 200mg/dL hemoglobin, 3000mg/dL triglyceride, 20mg/dL bilirubin and other endogenous interfering substances, the detection sensitivity of the kit of the invention is not obviously interfered, and the specific is shown in Table 8.
Table 8: anti-interference experiment of endogenous substances
| Interfering substances | Interference ratio (%) |
| Hemoglobin (hemoglobin) | 1.8 |
| Triglycerides (Triglycerides) | 2.3 |
| Bilirubin | 2.5 |
3. And detecting staphylococcus aureus and methicillin-resistant staphylococcus aureus in the environmental water sample.
(1) The staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent is prepared by the following steps: a staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent was prepared by using the method of example 1.
(2) Extraction of samples from water
Collecting 5 water samples of different lakes with sterile glass tubes, with the numbers of P1-P5, taking 1000 μl out, centrifuging at 12000rpm for 5min, and carefully discarding the supernatant; 200. Mu.l of bacterial lysate (from Beijing Bai Albo technology Co., ltd.) was added to the pellet, thoroughly mixed, and centrifuged at 10000rpm in a water bath at 100℃for 5min for further use.
(3) Sample detection
25. Mu.l of the treated specimen supernatant was added to a reaction tube for a duplex nucleic acid detection reagent for Staphylococcus aureus and methicillin-resistant Staphylococcus aureus, and 25. Mu.l of purified water was added to the detection solution as a negative control, and the detection was performed in accordance with the detection method in example 2.
(4) Analysis of results
The detection of water samples of 5 different lakes with the staphylococcus aureus and methicillin-resistant staphylococcus aureus duplex nucleic acid detection reagent by using the kit prepared in the example 1 and the detection method in the example 2 shows that the water sample P1 is positive for staphylococcus aureus and the methicillin-resistant staphylococcus aureus is negative, the P3 is positive for staphylococcus aureus and methicillin-resistant staphylococcus aureus, and the rest results are negative, and the specific data are shown in Table 9.
Table 9: detection experiment of pathogen in water sample
The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.
Sequence listing
<110> Zhengzhou Anji bioengineering Co., ltd
<120> primer probe combinations for identification of Staphylococcus aureus and its drug resistance
<130> MP1915105
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
agaaaattga agtcgagttt gacaaag 27
<210> 2
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
taaacataag caactttagc caagcc 26
<210> 3
<211> 29
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tggacgtggc ttagcgtata tttatgctg 29
<210> 4
<211> 26
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
cagttattgg atattcgtgt cgtcat 26
<210> 5
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
acattcaaat acgatagaca ttgttgt 27
<210> 6
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
ccagccaatg atccagcttt atttgaatct 30
<210> 7
<211> 23
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
tcttatcttc ctcccacagc tcc 23
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gtggggtgaa ttctttgcca 20
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
cgtgctggtc tgtgtgctgg c 21
<210> 10
<211> 81
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
tcttatcttc ctcccacagc tcctgggcaa cgtgctggtc tgtgtgctgg cccatcactt 60
tggcaaagaa ttcaccccac c 81
<210> 11
<211> 136
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
agaaaattga agtcgagttt gacaaaggtc aaagaactga taaatatgga cgtggcttag 60
cgtatattta tgctgatgga aaaatggtaa acgaagcttt agttcgtcaa ggcttggcta 120
aagttgctta tgttta 136
<210> 12
<211> 117
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
cagttattgg atattcgtgt cgtcatcacg cgtccagcca atgatccagc tttatttgaa 60
tctactgtga aaagtattaa aaattttaaa acaacaatgt ctatcgtatt tgaatgt 117
Claims (9)
1. A primer probe combination, comprising:
specific primer pairs of staphylococcus aureus shown as SEQ ID NO. 1-2;
a specific probe of staphylococcus aureus as shown in SEQ ID NO. 3;
a methicillin-resistant detection primer pair shown as SEQ ID NO. 4-5;
and a methicillin-resistant detection probe as shown in SEQ ID NO. 6;
an internal standard amplification primer pair shown as SEQ ID NO. 7-8;
an internal standard probe shown as SEQ ID NO. 9.
2. The primer probe combination according to claim 1, wherein,
the fragment amplified by the primer pair shown in SEQ ID NO. 1-2 is shown in SEQ ID NO. 11;
the fragment amplified by the primer pair shown as SEQ ID NO. 4-5 is shown as SEQ ID NO. 12.
3. The primer probe combination of claim 1 or 2, wherein the probe has a quenching group attached to the 3 'end and a fluorescent group attached to the 5' end; wherein:
the 5' end of the probe shown in SEQ ID NO.3 is connected with a FAM fluorescent group;
the 5' end of the probe shown in SEQ ID NO.6 is connected with a ROX fluorescent group;
the 5' end of the probe shown in SEQ ID NO.9 is connected with HEX fluorescent group.
4. The use of the primer probe combination according to any one of claims 1-3 in the preparation of a kit for detecting staphylococcus aureus and methicillin resistance thereof.
5. A detection kit for staphylococcus aureus and methicillin resistance thereof, comprising the primer probe combination of any one of claims 1-3 and a Real time PCR reaction reagent.
6. The kit of claim 5, wherein the Real time PCR reaction reagents comprise: dNTPs, MLV enzyme, taq enzyme, mgCl 2 。
7. The kit of claim 5 or 6, further comprising a negative control and a positive control; wherein the negative control is sterile water, and the positive control is artificially synthesized with a concentration of 1×10 6 Copies/ml pseudovirus.
8. A method for detecting staphylococcus aureus and methicillin resistance thereof for non-diagnostic or therapeutic purposes, comprising the steps of: detecting Real time PCR on a sample by adopting the primer probe combination according to any one of claims 1-3, judging whether the sample is infected by staphylococcus aureus according to the detected Ct value, and judging whether the sample is infected by methicillin-resistant staphylococcus aureus;
the judging comprises the following steps:
the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 have no fluorescence value, the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 37, and the detection result is reported to be negative;
the CT value of the probe channel shown in SEQ ID NO.3 is less than or equal to 38, but the CT value of the probe channel shown in SEQ ID NO.6 is more than or equal to 38, and the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the probe channel is reported to be positive to staphylococcus aureus, but not methicillin-resistant staphylococcus aureus;
the CT values of the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 are both less than or equal to 38, and the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the test result is reported to be positive to staphylococcus aureus and methicillin-resistant staphylococcus aureus;
the CT values of the probe channels shown in SEQ ID NO.3 and SEQ ID NO.6 are all more than or equal to 38, but the CT value of the probe channel shown in SEQ ID NO.9 is less than or equal to 38, and the concentration of the staphylococcus aureus sample is reported to be lower than the detection lower limit, and the result is only used as a reference;
when the CT value of the probe channel shown in SEQ ID NO.9 is more than or equal to 38 and any one of a typical S amplification curve, a positive control without CT value or amplification curve appears in the negative control, the detection result is invalid, the cause is searched and eliminated, and the test is repeated.
9. The method of claim 8, wherein the step of determining the position of the first electrode is performed,
the reaction system of Real time PCR comprises:
the reaction program of the Real time PCR comprises the following steps:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911080810.1A CN110669854B (en) | 2019-11-07 | 2019-11-07 | Primer probe combination for identifying staphylococcus aureus and drug resistance thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911080810.1A CN110669854B (en) | 2019-11-07 | 2019-11-07 | Primer probe combination for identifying staphylococcus aureus and drug resistance thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110669854A CN110669854A (en) | 2020-01-10 |
| CN110669854B true CN110669854B (en) | 2023-04-28 |
Family
ID=69086355
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911080810.1A Active CN110669854B (en) | 2019-11-07 | 2019-11-07 | Primer probe combination for identifying staphylococcus aureus and drug resistance thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110669854B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979142B (en) * | 2020-07-27 | 2022-08-05 | 广东省微生物研究所（广东省微生物分析检测中心） | Methicillin-resistant staphylococcus aureus simultaneously carrying drug-resistant genes cfr and lsa (E) and detection method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102399877A (en) * | 2011-11-09 | 2012-04-04 | 泰普生物科学（中国）有限公司 | Staphylococcus aureus methicillin resistant strain PCR (Polymerase Chain Reaction) detection kit |
| CN103421898A (en) * | 2013-08-08 | 2013-12-04 | 广东出入境检验检疫局检验检疫技术中心 | Triple real-time fluorescent PCR (polymerase chain reaction) detection primer, detection probe, detection kit and detection method for methicillin-resistant staphylococcus aureus |
| CN108624658A (en) * | 2018-05-25 | 2018-10-09 | 深圳市宝安区沙井人民医院 | The qPCR methods and reagent of fast detecting Staphylococcus aureus MRSA |
| CN112410472A (en) * | 2020-12-18 | 2021-02-26 | 郑州安图生物工程股份有限公司 | Primer probe combination and detection kit for detecting mycoplasma pneumoniae, chlamydia pneumoniae and adenovirus |
-
2019
- 2019-11-07 CN CN201911080810.1A patent/CN110669854B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102399877A (en) * | 2011-11-09 | 2012-04-04 | 泰普生物科学（中国）有限公司 | Staphylococcus aureus methicillin resistant strain PCR (Polymerase Chain Reaction) detection kit |
| CN103421898A (en) * | 2013-08-08 | 2013-12-04 | 广东出入境检验检疫局检验检疫技术中心 | Triple real-time fluorescent PCR (polymerase chain reaction) detection primer, detection probe, detection kit and detection method for methicillin-resistant staphylococcus aureus |
| CN108624658A (en) * | 2018-05-25 | 2018-10-09 | 深圳市宝安区沙井人民医院 | The qPCR methods and reagent of fast detecting Staphylococcus aureus MRSA |
| CN112410472A (en) * | 2020-12-18 | 2021-02-26 | 郑州安图生物工程股份有限公司 | Primer probe combination and detection kit for detecting mycoplasma pneumoniae, chlamydia pneumoniae and adenovirus |
Non-Patent Citations (2)
| Title |
|---|
| "Crystal structure of YwpF from Staphylococcus aureus reveals its architecture comprised of a β-barrel core domain resembling type VI secretion system proteins and a two-helix pair";Sang Jae Lee et al.;《Function and Bioinformatics》;20151231;第4页第2段 * |
| "Identification of methicillin-resistant Staphylococcus aureus (MRSA) strains isolated from burn patients by multiplex PCR";Effat Abbasi Montazeri et al.;《BURNS》;20151231;第41卷;第590-594页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110669854A (en) | 2020-01-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112410472B (en) | Primer probe combination for detecting mycoplasma pneumoniae, chlamydia pneumoniae and adenovirus and detection kit | |
| US11649511B2 (en) | Multiplex PCR method for the detection of SARS-CoV-2 | |
| JP2798499B2 (en) | Infectious disease diagnostic probe | |
| CN110714090B (en) | Kit for detecting free nucleic acid of blood flow infection pathogen in blood plasma | |
| CN112458212B (en) | Kit for simultaneously detecting influenza A virus, influenza B virus and respiratory syncytial virus | |
| CN106987626B (en) | Primer and probe for rapidly detecting various fungi and identifying strains and application thereof | |
| KR20180083303A (en) | Methods and apparatuses for nucleic acid-based diagnostic approaches, including determining the abnormal state of a sample, particularly a health condition and / or a pathogenic condition | |
| CN110804669A (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection primer group for mycoplasma pneumoniae and application thereof | |
| CN110079621B (en) | Oligonucleotide combination, method and kit for identifying mycobacterium species | |
| CN110669854B (en) | Primer probe combination for identifying staphylococcus aureus and drug resistance thereof | |
| Xiao et al. | Evaluation of real-time PCR coupled with multiplex probe melting curve analysis for pathogen detection in patients with suspected bloodstream infections | |
| CN110894534A (en) | Primer, probe, kit and detection method for detecting mycoplasma genitalium | |
| CN110734988A (en) | methicillin-resistant staphylococcus aureus (MRSA) nucleic acid isothermal amplification method | |
| CN109457020B (en) | Drug resistance detection composition, drug resistance detection kit and drug resistance detection method | |
| CN116479150A (en) | Single tube one-step method for rapidly detecting methicillin-resistant staphylococcus aureus by RPA-Cas12a/Cas13a | |
| CN116287420A (en) | Composition for detecting different types of fungi, kit and application thereof | |
| CN115873979A (en) | Constant-temperature nucleic acid amplification RAA primer probe combination for detecting candida auricula and application thereof | |
| CN111455094B (en) | Composition, kit, application and method for detecting deep infection fungi | |
| CN106048051B (en) | A kind of candida krusei fluorescence PCR detection reagent kit | |
| CN112575099B (en) | Primer probe combination and detection kit for klebsiella pneumoniae | |
| CN112458194B (en) | Primer probe combination and detection kit for mycoplasma pneumoniae and drug-resistant mutation thereof | |
| CN113604589A (en) | Kit for simultaneously detecting drug-resistant sites, virulence genotyping and proton pump inhibitor metabolic genotyping of helicobacter pylori | |
| CN106521038A (en) | High-sensitivity BHV-2 (bovine herpes virus 2) quantitative real-time PCR (polymerase chain reaction) detection method and kit | |
| CN116396958A (en) | Primer probe combination and kit | |
| Badran et al. | Development of Duplex Droplet Digital PCR for Rapid Detection of Blood Stream Infections Caused by S. aureus, E. coli, S. pneumoniae and P. aeruginosa |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |