CN110669828A

CN110669828A - Detection method and primer for recovery rate of converted DNA

Info

Publication number: CN110669828A
Application number: CN201911153500.8A
Authority: CN
Inventors: 刘蕊; 王辉
Original assignee: Shanghai Wuyuan Health Technology Co Ltd
Current assignee: Shanghai Wuyuan Health Technology Co Ltd
Priority date: 2019-11-22
Filing date: 2019-11-22
Publication date: 2020-01-10

Abstract

The invention provides a method for detecting DNA recovery rate, which comprises the following steps: 1) performing qPCR on a DNA sample transformed to convert unmodified cytosine bases to uracil bases with primers that recognize cytosine base-free DNA fragments in the DNA sample, obtaining transformed Ct values; and 2) calculating DNA recovery using the Ct value and the Ct value obtained by qPCR of the untransformed DNA sample with the primers. The method further comprises the following steps: qPCR of the transformed DNA sample with primers recognizing the transformed DNA to obtain Ct value, and then the DNA recovery rate in step 2) was evaluated.

Description

Detection method and primer for recovery rate of converted DNA

Technical Field

The present invention relates to the field of detection of recovery of DNA undergoing cytosine conversion.

Background

Cytosine conversion, e.g., bisulfite conversion, is an in vitro chemical reaction in which DNA is treated with a bisulfite compound to convert its unmodified (e.g., methylation-modified) cytosine base (C) to uracil (U), which in turn is converted to thymine (T) in subsequent PCR amplification, while the methylation-modified cytosine remains unchanged. After chemical treatment with bisulfite compounds, it can be known which cytosine at the position in the genome is methylated and modified by qPCR or sequencing detection. Bisulfite conversion is thus currently the most common way of DNA treatment for methylation detection.

In addition to effecting the above chemical changes, bisulfite treatment also causes a great deal of damage to the DNA, leading to fragmentation and degradation of the DNA. Evaluation of DNA recovery after bisulfite treatment at different ratios and different manufacturers is an important data for evaluating the effectiveness of treatment reagents. Currently, there is no simple method for systematically detecting such DNA recovery rates, and there is no mutual evidence between different detections.

Disclosure of Invention

The invention utilizes a pair of primers for identifying DNA sites without cytosine bases and a pair of primers for identifying DNA sites after conversion to detect the recovery rate of the DNA after conversion. The detection method is simple and easy to operate, and two different detections are used for mutual authentication.

The invention provides a method for detecting DNA recovery rate, which comprises the following steps:

1) performing qPCR on a DNA sample transformed to convert unmodified cytosine bases to uracil bases with primers that recognize cytosine base-free DNA fragments in the DNA sample, obtaining transformed Ct values; and

2) the Ct values and those obtained by qPCR of untransformed DNA samples with the primers were used to calculate DNA recovery.

In one or more embodiments, the method further comprises the step of performing qPCR on the untransformed DNA sample with the primers.

In one or more embodiments, the modification is methylation.

In one or more embodiments, the conversion is performed using an enzymatic method, preferably a deaminase treatment.

In one or more embodiments, the conversion is performed using a non-enzymatic method, preferably treatment with bisulfite or bisulfate, more preferably treatment with calcium bisulfite, sodium bisulfite, potassium bisulfite, ammonium bisulfite, sodium bisulfite, potassium bisulfite, and ammonium bisulfite.

In one or more embodiments, the methods further comprise protecting the modified cytosine prior to transformation by a non-enzymatic or enzymatic method. The protection is preferably carried out by TET2 and/or oxidation enhancers.

In one or more embodiments, the primer comprises a first primer and a second primer, the first primer does not contain a C and the second primer does not contain a G. The amplification product formed by the primer in qPCR is 50-500bp, 100-400bp, 150-300bp or 200-250bp, preferably 50-150bp, more preferably 80-100 bp.

In one or more embodiments, the first primer is 5-50, 10-40, 15-30, or 20-25 nucleotides in length.

In one or more embodiments, the first primer does not contain cytosine C.

In one or more embodiments, the first primer contains 20-60%, 30-50%, or 35-45% A, preferably 40% A. In one or more embodiments, the first primer contains 10-50%, 20-40%, or 25-35% T, preferably 28% T. In one or more embodiments, the first primer contains 20-40%, 25-35%, or 30-33% G, preferably 32% G. In one or more embodiments, the first primer contains 30-50% A, 20-40% T, and 25-35% G. Preferably, the first primer contains 40% a, 28% T and 32% G. In one or more embodiments, the first primer comprises or consists of SEQ ID No. 1 or a mutant having at least 70% sequence identity to SEQ ID No. 1.

In one or more embodiments, the second primer can be 5-50, 10-40, or 15-30, or 15-20 nucleotides in length.

In one or more embodiments, the second primer does not contain guanine G.

In one or more embodiments, the second primer contains 1-20%, 2-15%, or 5-10% A, preferably 6% A. In one or more embodiments, the second primer contains 10-40%, 20-35%, or 25-30% T, preferably 29% T. In one or more embodiments, the second primer contains 55-80%, 61-75%, or 63-70% C, preferably 65% C. In one or more embodiments, the second primer contains 2-15% A, 20-35% T, and 61-75% C. Preferably, the second primer contains 6% a, 29% T and 65% C. In one or more embodiments, the second primer comprises or consists of SEQ ID No. 2 or a mutant having at least 70% sequence identity to SEQ ID No. 2.

In one or more embodiments, the DNA recovery is calculated as follows:

Δ Ct ═ Ct (post-transformation) -Ct (untransformed)

The recovery rate is 2^ -delta Ct.

In one or more embodiments, the method further comprises: qPCR of the transformed DNA sample with primers recognizing the transformed DNA to obtain Ct value, and then the DNA recovery rate in step 2) was evaluated.

In one or more embodiments, the primer that recognizes the transformed DNA is an ACTB primer that recognizes the transformed DNA sequence. If the ACTB detection result of the reagent with a high recovery rate of the two reagents shows a lower Ct value, it can be determined that the reagent with a high recovery rate is superior to the other reagent.

In one or more embodiments, the ACTB primer comprises or consists of SEQ ID No. 3 or a mutant having at least 70% sequence identity to SEQ ID No. 3; and/or the ACTB primer comprises or consists of SEQ ID NO. 4 or a mutant having at least 70% sequence identity to SEQ ID NO. 4.

Drawings

FIG. 1 is a schematic diagram showing the method for detecting the recovery rate of DNA after cytosine conversion.

FIG. 2 shows the results of DNA recovery from different transformation kits.

Detailed Description

The invention utilizes a pair of primers (CFF) for identifying DNA sites without cytosine bases and a pair of primers (ACTB) for identifying DNA sites after transformation to detect the recovery rate of DNA after transformation. The method is suitable for recovering and detecting the DNA of any fragmented, non-fragmented, single-stranded and double-stranded DNA after cytosine conversion.

1) providing a DNA sample and primers that recognize DNA fragments without cytosine bases in the DNA sample;

2) carrying out qPCR on the DNA sample by using a first primer and a second primer to obtain a Ct value;

3) treating the DNA sample to convert unmodified cytosine bases to uracil bases, optionally purifying the DNA;

4) carrying out qPCR on the DNA sample treated in the step 3) by using a first primer and a second primer to obtain a converted Ct value;

5) the Ct values before and after treatment were used to calculate the DNA recovery.

The "sample" as described herein may be any type of DNA-containing sample. In one or more embodiments, the sample is fragmented genomic DNA.

As used herein, a "DNA" or "DNA molecule" is a deoxyribonucleic acid. The basic unit of DNA is deoxyribonucleotide, which is condensed by phosphodiester bond to form a long chain molecule. Each deoxyribonucleotide consists of a phosphate, a deoxyribose, and a base. Bases (bp) of DNA are mainly adenine (A), guanine (G), cytosine (C) and thymine (T). In the double-helix structure of double-stranded DNA, A is hydrogen-bonded to T, and G is hydrogen-bonded to C. The form of DNA includes cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be of any length, such as 50-500bp, 100-400bp, 150-300bp or 200-250 bp.

As used herein, "uracil" or "U" is a component of RNA. An "RNA" or "RNA molecule" is a ribonucleic acid. RNA is a long chain molecule formed by the condensation of ribonucleotides via phosphodiester bonds. Each ribonucleotide molecule consists of a phosphate, a ribose and a base. RNA has 4 main bases, namely adenine (A), guanine (G), cytosine (C) and uracil (U). In base pairing of RNA, U replaces the position of T in DNA, i.e. a is hydrogen-bonded to U and G is hydrogen-bonded to C.

Transformation can occur between bases of DNA or RNA. As used herein, "cytosine conversion" or "CT conversion" is the process of converting an unmodified cytosine base (C) to an uracil base (U) by treating DNA using non-enzymatic or enzymatic methods. Non-enzymatic or enzymatic methods of performing cytosine conversion are well known in the art. Illustratively, non-enzymatic methods include bisulfite or bisulfate treatments, such as calcium bisulfite, sodium bisulfite, potassium bisulfite, ammonium bisulfite, sodium bisulfate, potassium bisulfate, ammonium bisulfate, and the like. Illustratively, the enzymatic method includes a deaminase treatment. The transformed DNA is optionally purified. DNA purification methods suitable for use herein are well known in the art.

In reference to cytosine, "modification" refers to the introduction or removal of a chemical group on the cytosine base. During cytosine conversion, the modified cytosine base is more stable than the unmodified cytosine base and is less susceptible or unaffected by the conversion process to become U. In one or more embodiments, the modification refers to methylation. As used herein, "methylation" or "DNA methylation" refers to the covalent attachment of a methyl group at the cytosine 5' carbon position of a CpG dinucleotide in genomic DNA to form a 5-methylcytosine (5 mC).

Optionally, the modified cytosine can be protected from downstream transformation or deamination by non-enzymatic or enzymatic means prior to transformation of the cytosine as described herein. Non-enzymatic or enzymatic methods suitable for protecting modified cytosines are well known in the art. For example, TET2(ten-eleven transition 2) and/or an oxidation enhancer may protect the modified cytosine. TET2 can oxidize 5mC and 5hmC to 5caC by a cascade reaction. The oxidation enhancer may convert 5hmC to 5ghmC by glycosylation. Oxidation enhancers suitable for performing such glycosylation are well known in the art.

As used herein, a "primer" refers to a nucleic acid molecule having a specific nucleotide sequence that directs the synthesis at the initiation of nucleotide polymerization. The primers are typically two oligonucleotide sequences synthesized by man, one primer complementary to one DNA template strand at one end of the target region and the other primer complementary to the other DNA template strand at the other end of the target region, which functions as the initiation point for nucleotide polymerization. Primers designed artificially in vitro are widely used in Polymerase Chain Reaction (PCR), qPCR, sequencing, probe synthesis, and the like.

The present invention uses a pair of primers recognizing a cytosine base-free DNA fragment comprising a first primer and a second primer. In one or more embodiments, the first primer does not contain C and the second primer does not contain G. The amplification product formed by the cytosine base-free DNA fragment identified by the primer can be any length, such as 50-500bp, 100-400bp, 150-300bp or 200-250bp, and the preferred amplification length of the product is 50-150 bp.

Herein, the first primer does not contain cytosine C and/or the second primer does not contain guanine G. The first primer may be 5-50, 10-40, 15-30, or 20-25 nucleotides in length. The second primer may be 5-50, 10-40, or 15-30, or 15-20 nucleotides in length.

Generally, the GC content of the primer sequence is generally 40-60%, and too high or too low is not favorable for the initiation reaction. Moreover, the GC contents of the upstream and downstream primers cannot differ too much. However, the inventors have found that these principles are not applicable to the primers described herein. The primer of the invention can balance the amplification specificity and the amplification efficiency of the DNA after CT conversion treatment, and realize more accurate DNA conversion rate detection.

In the present invention, the first primer may contain A, T or G in various amounts. The first primer contains 20-60%, 30-50%, 35-45% A, preferably 40% A. In the present invention, the first primer contains 10 to 50%, 20 to 40%, 25 to 35% of T, preferably 28% of T. In the present invention, the first primer contains 20 to 40%, 25 to 35%, 30 to 33% G, preferably 32% G. Illustratively, the first primer contains 30-50% A, 20-40% T and 25-35% G. Preferably, the first primer contains 40% a, 28% T and 32% G. In one or more embodiments, the first primer comprises or consists of SEQ ID No. 1 or a mutant having at least 70% sequence identity to SEQ ID No. 1.

In the present invention, the second primer may contain A, T and C in different amounts. The second primer contains 1-20%, 2-15%, 5-10% A, preferably 6% A. In the present invention, the second primer contains 10-40%, 20-35%, 25-30% of T, preferably 29% of T. In the present invention, the second primer contains 55-80%, 61-75%, 63-70% C, preferably 65% C. Illustratively, the second primer contains 2-15% A, 20-35% T and 61-75% C. Preferably, the second primer contains 6% a, 29% T and 65% C. In one or more embodiments, the second primer comprises or consists of SEQ ID No. 2 or a mutant having at least 70% sequence identity to SEQ ID No. 2.

The first and second primers described herein are identical to and reverse complementary to the sense strand of the amplified DNA region, respectively, and after the CT conversion treatment, both strands of the double-stranded DNA become no longer reverse complementary, so that only the second primer recognizes the template and forms a complementary strand that can be recognized by the first primer in the first cycle of PCR. From the second cycle, the two primers recognize the two newly formed double-stranded strands, respectively, and perform exponential amplification. The amplification length of the product can be 50-150bp, 60-140 bp, 70-130 bp and 80-120 bp. Preferably, the product amplification length is 80-100 bp.

The term "variant" or "mutant" as used herein refers to a polynucleotide that has a nucleic acid sequence altered by insertion, deletion or substitution of one or more nucleotides compared to a reference sequence, while retaining its ability to hybridize to other nucleic acids. A mutant according to any of the embodiments herein comprises a nucleotide sequence having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to a reference sequence (SEQ ID NO:1 or 2 as described herein) and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, BLASTn from NCBI. Mutants also include nucleotide sequences that have one or more mutations (insertions, deletions, or substitutions) in the reference sequence and in the nucleotide sequence, while still retaining the biological activity of the reference sequence. The plurality of mutations typically refers to within 1-10, such as 1-8, 1-5, or 1-3. The substitution may be a substitution between purine nucleotides and pyrimidine nucleotides, or a substitution between purine nucleotides or between pyrimidine nucleotides. The substitution is preferably a conservative substitution. For example, conservative substitutions with nucleotides of similar or analogous properties are not typically made in the art to alter the stability and function of the polynucleotide. Conservative substitutions are, for example, exchanges between purine nucleotides (A and G), exchanges between pyrimidine nucleotides (T or U and C). Thus, substitution of one or more sites with residues from the same in the polynucleotides of the invention will not substantially affect their activity.

In steps 2) and 4), the method of the invention further comprises the quantitative polymerase chain reaction of the DNA, whether treated or not, with the transformationReaction (qPCR). qPCR is also known as real-time polymerase chain reaction (real-time PCR), and amplification of a target nucleic acid molecule is monitored in real-time during PCR. qPCR can quantitatively or semi-quantitatively determine the amount of template nucleic acid in a sample. Two common methods for detecting PCR products in qPCR are non-specific fluorescent dyes inserted into any double-stranded nucleic acid and sequence-specific nucleic acid probes consisting of oligonucleotides labeled with fluorescent reporter genes. The qPCR process typically involves a series of temperature changes that are repeated 25-50 times. These cycles generally consist of three phases: the first stage is about 95 ℃, allowing the separation of the double strands of nucleic acids; a second stage at about 50-70 ℃ allowing the primer to bind to the nucleic acid template; the third stage is about 68-72 ℃ and promotes the polymerization by the DNA polymerase. In some embodiments, the third stage may be omitted. The temperature and time used for each cycle depend on various parameters such as the enzyme used to synthesize the DNA, the concentration of divalent ions and deoxyribonucleotides (dNTPs) in the reaction, and the binding temperature of the primer. Methods for determining the temperature and time for each cycle of qPCR are known in the art. Where the first and second single-stranded nucleic acid sequences are RNA, the invention also relates to the use of RT-qPCR, i.e., reverse transcribing the RNA ligation product into cDNA, followed by qPCR quantification. Any commercialization (KAPA) can be used for qPCR detection

FAST Universal, NEB Luna Universal) or a self-contained reaction mixture including any form of DNA polymerase, 4 deoxyribonucleotides, any concentration of Mg ions, etc. The qPCR detection instrument can use any factory qPCR instrument, such as BioRad CFX connect read-Time PCR detection System.

The relative recovery of DNA can be calculated by methods well known in the art using the results before and after treatment. Illustratively, the relative recovery of DNA is calculated using the following formula, i.e., the Ct value after transformation minus the Ct value before transformation, amplified exponentially with a negative power of 2 as the relative recovery:

Δ Ct ═ Ct (post-transformation) -Ct (untransformed)

Relative recovery rate of 2^ -delta Ct

The method also comprises the steps of carrying out qPCR on the DNA sample subjected to the conversion treatment by using a primer for identifying the DNA locus after the conversion to obtain the Ct value of the DNA after the conversion, and then carrying out comprehensive evaluation on the DNA recovery rate in the step 5). In one or more embodiments, the primer that recognizes the post-transformation DNA site is an ACTB detection primer. The ACTB primer recognizes only the transformed DNA sequence, but is independent of DNA methylation. Thus, in the detection of ACTB, pre-transformation DNA was not detected. Theoretically, the higher the recovery of DNA after transformation, the larger the number of template molecules of ACTB, the smaller the Ct value. The CFF test can calculate the relative recovery value of the conversion reagent, the ACTB can compare the relative high and low recovery values of different conversion reagents, and when the two test results are identical, the mutual comparison result of the recovery values of the conversion reagents can be determined. For example, if the ACTB detection result of a reagent having a high CFF detection result recovery rate of the two reagents shows a lower Ct value, it can be determined that the reagent having the high recovery rate is superior to the other reagent. In one or more embodiments, the ACTB detection primer comprises or consists of SEQ ID No. 3 or a mutant having at least 70% sequence identity to SEQ ID No. 3; and/or, the ACTB detection primer comprises or consists of SEQ ID NO. 4 or a mutant having at least 70% sequence identity to SEQ ID NO. 4.

The invention also provides a primer as described herein, comprising a first primer and/or a second primer as described herein.

The invention also provides a kit for detecting recovery of treated DNA, said kit comprising primers as described herein, said treatment converting unmodified cytosine bases in DNA to uracil bases. The kit also contains instructions for calculating DNA recovery using Ct values obtained by qPCR before and after treatment.

The invention also provides the use of a primer as described herein comprising a first primer and a second primer as described herein for detecting recovery of treated DNA by qPCR, wherein the treatment converts unmodified cytosine bases in the DNA to uracil bases, characterized in that the DNA recovery is calculated using the DNA Ct values obtained by qPCR before and after the treatment.

The invention also provides the use of the primers described herein for the manufacture of a kit for qPCR detection of recovery of treated DNA, said kit comprising a first primer and a second primer described herein, said treatment converting unmodified cytosine bases in DNA to uracil bases.

The present invention is described in further detail by referring to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Accordingly, the present invention should in no way be construed as limited to the following examples, but rather should be construed to include any and all variations which become apparent in light of the teachings provided herein. The methods and reagents used in the examples are, unless otherwise indicated, conventional in the art.

Examples

Example 1 transformation of DNA

This example uses the Z kit and T kit to transform DNA. Fragmented reference genomic NA12878DNA was used as detection DNA, and each kit was repeated 4 times.

1) The CT conversion reagent was prepared according to the kit instructions.

2) The concentration of fragmented NA12878 was adjusted to 1 ng/. mu.L, 20. mu.L was taken and 130. mu.L of CT transformation reagent was added, and each kit was tested in 4 replicates. Approximately 20. mu.L of untransformed DNA was retained as a control.

3) And operating a CT conversion temperature control program according to the instructions of each kit. The Z kit is stored at 98 ℃ for 8 minutes, 54 ℃ for 1 hour and 4 ℃. The kit T is stored at 98 ℃ for 10 minutes, 64 ℃ for 2 hours and 30 minutes and 4 ℃.

4) And (3) purifying the transformed DNA adsorption column according to the kit specification, wherein the purification comprises DNA combination, desulfonation reaction, washing and elution. Finally, 20 mu L of eluent is used for eluting the DNA of the adsorption column to obtain the converted DNA.

Example 2 CFF qPCR assay

In this example, the CFF primer was used to perform qPCR on the transformed DNA to obtain a Ct value.

1) CFF forward and reverse primers were diluted to 4 μ M separately and equal volumes were mixed to form a primer mix, the qPCR reaction mix was configured as follows: kapa SYBR Fast qPCR MIX 5. mu. L, CFF primer MIX 1. mu.L and control or post-transformation DNA 4. mu.L.

CFF forward primer: TAAGAGTAATAATGGATGGATGATG

CFF reverse primer: CCTCCCATCTCCCTTCC

2) Vortex, shake, centrifuge briefly.

3) The PCR tube was placed in a fluorescent quantitative PCR instrument (BioRad CFX connect read-Time PCR detection System) and the following program was run:

pre-denaturation: 5 minutes at 95 ℃;

signal collection 40 cycles: 30 seconds at 95 ℃; 60 seconds at 54 ℃ (fluorescence signal collection).

The results are shown in table 1 and fig. 2. Counting the Ct value detected by the CFF primer, wherein the smaller the difference with the untransformed DNA, the higher the DNA recovery rate. The relative recovery was calculated as follows:

Δ Ct ═ Ct (post-transformation) -Ct (untransformed)

Relative recovery rate of 2^ -delta Ct

TABLE 1 detection of transformed DNA with CFF primers

Example 3 ACTB qPCR assay

In this example, the Ct value was obtained by qPCR of the converted DNA using ACTB primer.

1) The ACTB forward and reverse primers were diluted to 10. mu.M, respectively, and the same volumes were mixed to form a primer mix, and the ACTB probe was diluted to 4. mu.M.

2) The qPCR reaction was configured as follows: NEB Luna PCR master mix 10. mu. L, ACTB primer mix 2. mu. L, ACTB probe 1. mu.L and post-transformation DNA 7. mu.L.

ACTB forward primer: GTGATGGAGGAGGTTTAGTAAGTT

ACTB reverse primer: CCAATAAAACCTACTCCTCCCTTAA

ACTB probe:

/5TAMRA/ACCACCACCCAACACACAATAACAAACACA/3IABkRQ/

3) the PCR tube was placed in a fluorescent quantitative PCR instrument (ABI 7500Real-Time PCR System) and the following procedure was run:

pre-denaturation: 5 minutes at 95 ℃;

signal collection 40 cycles: 15 seconds at 95 ℃; 60 seconds at 58 ℃ (fluorescence signal collection).

The results are shown in table 2 and fig. 2. And counting the Ct value of the ACTB detection, wherein the distribution of the Ct value of different kits is similar to the distribution of the detection result of the CFF primer.

TABLE 2 detection of the transformed DNA with ACTB primer

	Ct (Z kit)	Ct (T kit)
			Repetition of 1	30.53	30.56
Repetition 2	30.06	30.87
			Repetition of 3	30.35	30.62
Repetition of 4	30.40	30.79

The results of table 2 and fig. 2 show that:

CFF detection can calculate the relative recovery value of the conversion reagent, ACTB can compare the relative high and low recovery values of different conversion reagents, and when the detection results of the two conversion reagents are identical, the mutual comparison result of the recovery values of the conversion reagents is finally determined.

Sequence listing

<110> Shanghai Kun Yuansheng science & technology Limited

<120> method for detecting recovery rate of transformed DNA and primer

<130>194685

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>25

<212>DNA

<213>Artificial Sequence

<400>1

taagagtaat aatggatgga tgatg 25

<210>2

<211>17

<212>DNA

<213>Artificial Sequence

<400>2

cctcccatct cccttcc 17

<210>3

<211>24

<212>DNA

<213>Artificial Sequence

<400>3

gtgatggagg aggtttagta agtt 24

<210>4

<211>25

<212>DNA

<213>Artificial Sequence

<400>4

ccaataaaac ctactcctcc cttaa 25

Claims

1. A method of detecting DNA recovery comprising:

2. The method of claim 1, further comprising the step of obtaining an untransformed Ct value by qPCR on an untransformed DNA sample using the primers.

3. The method of claim 1, wherein in one or more embodiments, the modification is methylation.

4. The method of claim 1,

the conversion is carried out using an enzymatic method, preferably a deaminase treatment, or

The conversion is carried out using a non-enzymatic method, preferably treatment with bisulfite or bisulfate, more preferably treatment with calcium bisulfite, sodium bisulfite, potassium bisulfite, ammonium bisulfite, sodium bisulfate, potassium bisulfate, and ammonium bisulfate.

5. The method of claim 1, further comprising protecting the modified cytosine prior to transformation by non-enzymatic or enzymatic means, preferably with TET2 and/or an oxidation enhancer.

6. The method of claim 1, wherein the DNA recovery is calculated as follows:

Δ Ct ═ Ct (post-transformation) -Ct (untransformed)

The recovery rate is 2^ -delta Ct.

7. The method as claimed in claim 1, wherein the primer comprises a first primer and a second primer, the first primer does not contain C and the second primer does not contain G, preferably, the amplification product formed by the primer in qPCR is 50-500bp, 100-400bp, 150-300bp or 200-250bp, preferably 50-150bp, more preferably 80-100 bp.

8. The method of claim 7, wherein the primer has one or more characteristics selected from the group consisting of:

the length of the first primer is 5 to 50 nucleotides, preferably 10 to 40 nucleotides, more preferably 15 to 30 nucleotides,

the first primer contains 30-50% A, preferably 40% A,

the first primer contains 20-40% T, preferably 28% T,

the first primer contains 25-35% G, preferably 32% G,

the first primer contains 30-50% of A, 20-40% of T and 25-35% of G,

the first primer comprises or consists of SEQ ID NO. 1 or a mutant having at least 70% sequence identity to SEQ ID NO. 1,

the length of the second primer is 5 to 50 nucleotides, preferably 10 to 40 nucleotides, more preferably 15 to 30 nucleotides,

the second primer contains 2-15% A, preferably 6% A,

the second primer contains 20-35% T, preferably 29% T,

the second primer contains 61-75% C, preferably 65% C,

the second primer contains 2-15% of A, 20-35% of T and 61-75% of C,

the second primer comprises or consists of SEQ ID NO. 2 or a mutant having at least 70% sequence identity to SEQ ID NO. 2.

9. The method of claim 1, wherein the method further comprises: qPCR of the transformed DNA sample with primers recognizing the transformed DNA to obtain Ct value, and then the DNA recovery rate in step 2) was evaluated.

10. The method of claim 9, wherein the primers that recognize the transformed DNA are ACTB primers and the evaluating comprises: if the ACTB detection result of the reagent with the high recovery rate of the two reagents shows a lower Ct value, the reagent with the high recovery rate is superior to the other reagent,

preferably, the ACTB primer comprises or consists of SEQ ID NO. 3 or a mutant having at least 70% sequence identity to SEQ ID NO. 3; and/or the ACTB primer comprises or consists of SEQ ID NO. 4 or a mutant having at least 70% sequence identity to SEQ ID NO. 4.