CN110669766A

CN110669766A - Adhesin aptamer and screening method and application thereof

Info

Publication number: CN110669766A
Application number: CN201910931865.2A
Authority: CN
Inventors: 唐晓磊; 华影; 周发友; 章宏祥; 黄友明
Original assignee: Second Affiliated Hospital Of Wannan Medical College
Current assignee: Second Affiliated Hospital Of Wannan Medical College
Priority date: 2019-09-29
Filing date: 2019-09-29
Publication date: 2020-01-10

Abstract

The invention discloses an adhesin aptamer and a method for screening the adhesin aptamer, wherein helicobacter pylori genomic DNA is used as a template, an adhesin gene is obtained by amplification, the obtained gene is connected with an expression vector to obtain a screening target, the screening target is incubated with a random single-stranded ssDNA library, SELEX screening and PCR amplification of the library are carried out, and then the adhesin aptamer is obtained by multiple rounds of screening. The invention also discloses application of the adhesin aptamer in preparation of a detection kit for helicobacter pylori and preparation of a helicobacter pylori immune medicament. The adhesin aptamer of the invention has higher affinity and specificity, small molecular weight and strong permeability, and can more intuitively reflect the condition of organism infection Hp compared with the prior art.

Description

Adhesin aptamer and screening method and application thereof

Technical Field

The invention relates to a nucleic acid aptamer and screening and application thereof, in particular to a nucleic acid aptamer for detecting helicobacter pylori and a screening method and application thereof.

Background

The aptamer is a ligand which is screened from a random single-stranded oligonucleotide library by adopting an Exponential Enrichment ligand phylogenetic Evolution technology (SELEX) and can have high specificity and high affinity with a target substance. The aptamer screened by SELEX has the advantages of high affinity, stable performance, low molecular weight, low immunogenicity, easy modification, no toxic or side effect and the like.

Helicobacter pylori (Hp) infection is closely related to high incidence of gastric cancer, the global Hp infection rate is about 50%, the asian infection rate is up to 70%, and the average infection rate in China is about 59%. The mechanism of Hp infection is mainly that thalli are combined with gastric mucosal epithelial cells and are planted in the gastric mucosal layer through adhesion. In the adhesion process, Hp can activate various signal pathways in gastric mucosa epithelial cells and secrete various pathogenic related factors, so that pathological manifestations such as cell proliferation, apoptosis, excessive inflammatory reaction and the like are triggered, and then Hp is promoted to be planted deeply in mucosa. Therefore, the adhesion of Hp and epithelial cells of gastric mucosa is a key link for attacking the pathogenic process of the organism.

The material for the Hp to adhere is based on adhesins, which are more diverse and predominate in the adhesion process. It has been found that various Hp adhesin proteins (e.g., Hpa A, Bab A, Sab A, Alp A/B, Oip A, Hop Z) exert their colonizing effects by tightly binding to gastric mucosal epithelial cells. Wherein Hpa A plays an important role in all stages of planting and disease causing of Hp, and is expected to be a target for detecting and preventing helicobacter pylori. Therefore, screening of the corresponding ligand of the adhesin has positive significance for eliminating Hp by blocking the adhesion effect of the adhesin through the ligand. Therefore, the screening of corresponding ligands for Hpa A by utilizing the characteristics of SELEX has very important significance for diagnosis and treatment of Hp in gastric mucosa.

At present, the clinical detection of Hp infection mainly takes a C14 breath test and a rapid urease test as main means, and the principle of the method is mainly based on that Hp urease catalyzes urea decomposition. However, the C14 breath test is somewhat radioactive and thus more or less harmful to the health of infants and minor adults; and the interpretation of breath test results is also affected by the recent intake of antibiotics and fasting degree. The fast urease test usually causes some false negative due to the relation of Hp quantity in the material and the recent taking of antibiotics. The detection of Hp antibody in peripheral blood commonly used in clinical laboratories is more extensive at present, but the judgment of the disease course of patients still has defects. In addition, the current culture technology is still not standardized and commercialized, and a detection means capable of supplementing the method is urgently needed.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides an aptamer of a specific target adhesin Hpa A and a screening method of the aptamer of the adhesin, which is based on SELEX technology, screens corresponding ligands aiming at the adhesin Hpa A and verifies the other binding characteristics, and lays a foundation for further exploring the feasibility of the method for carrying out Hp diagnosis and treatment in gastric mucosa.

In order to achieve the purpose, the invention adopts the following technical scheme:

an adhesin aptamer, wherein the nucleotide sequence of the aptamer comprises a nucleotide sequence shown in SEQ ID NO. 1; or a nucleotide sequence containing any one of the following: a sequence which has more than 60 percent of homology with the nucleotide sequence defined by SEQ ID NO.1 and hybridizes with the nucleotide sequence defined by SEQ ID NO.1, and an RNA sequence transcribed by the nucleotide sequence defined by SEQ ID NO. 1.

Further, the nucleotide sequence of the aptamer is methylated, thiolated, phosphorylated, aminated, or isotopically-modified.

Further, the nucleotide sequence of the aptamer is connected with a fluorescent substance, a therapeutic substance, a radioactive substance, biotin, digoxigenin, a nano luminescent material or an enzyme label.

A method for screening the aptamer, comprising the steps of:

(1) taking helicobacter pylori genome DNA as a template, and carrying out PCR amplification to obtain a helicobacter pylori adhesin (Hpa A) gene;

(2) the obtained gene is connected with an expression vector Pet28a plasmid after enzyme digestion, a connection product is transferred into an Escherichia coli E.coli BL21 strain and is induced to express, bacteria are cracked and purified, and the obtained recombinant adhesin Hpa A is the screening target;

(3) incubating the adhesin Hpa A obtained in the step (2) with a ssDNA library, and collecting ssDNA combined with a screening target;

(4) performing PCR amplification on the obtained ssDNA to obtain dsDNA;

(5) the obtained dsDNA is connected with pUC19 plasmid after enzyme digestion, and is transferred into Escherichia coli E.coli DH5 alpha strain;

(6) and selecting positive clone sequencing, and verifying the binding force of ssDNA obtained by positive clone amplification and Hpa A to obtain the aptamer.

Further, the Hpa A primer sequence in step (1) is as follows:

F:5’-CGGATCCTGCAGCCCGCATATTATTG-3’；

R:5’-CAAGCTTTCGGTTTCTTTTGCCTTTT-3’。

further, in step (3), the ssDNA library comprises the sequence:

5’-CGGATCCATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3’；

primer P1: 5' -CGGATCCATCCAGAGTGACGCAGCA-3’；

Primer P2: 5' -GAAGCTTACTAAGCCACCGTGTCCA-3’。

Further, in the step (3), the purified adhesin Hpa A is coated in polystyrene micropores, then the synthesized ssDNA library is dissolved in a screening buffer solution and put into the screening buffer solution, and the bound ssDNA is washed down to be used as a template of the next round; blank wells were used as negative screening media after the fifth round.

The invention also provides application of the adhesin aptamer or the derivative thereof in preparation of a kit, a molecular probe or a targeting medium for detecting helicobacter pylori.

A helicobacter pylori detecting agent comprising the adhesin aptamer of claim.

The invention also provides the application of the adhesin aptamer or the derivative thereof in preparing anti-helicobacter pylori vaccines. The derivative of the adhesin aptamer may be a phosphorothioate backbone derived from the backbone of the nucleotide sequence of the ligand as described above.

Compared with the prior art, the invention has the beneficial effects that:

the aptamer with higher affinity obtained by the invention has stronger ability of distinguishing Hp; when the combination of the Hp and the Hp is verified in a frozen section of the gastric mucosa, the combination of a fluorescent label can detect the thallus more sensitively, compared with a C14 breath test and a rapid urease test, the combination can reflect the condition of the Hp infected by organisms more intuitively, and the screening of the Hpa A aptamer specifically combined with the surface of the Hp thallus can be applied to the detection of the Hp infection of the gastric mucosa tissue.

Drawings

In order to more clearly illustrate the detailed description of the invention or the technical solutions in the prior art, the drawings that are needed in the detailed description of the invention or the prior art will be briefly described below. Throughout the drawings, like elements or portions are generally identified by like reference numerals. In the drawings, elements or portions are not necessarily drawn to scale.

FIG. 1 is an agarose gel electrophoresis of the Hpa A gene amplified by PCR;

FIG. 2 is an agarose gel electrophoresis of recombinant pET28a/Hpa A plasmid after digestion;

FIG. 3 is an alignment chart of the sequencing results of recombinant pET28a/Hpa A plasmid;

FIG. 4 is a SDS-PAGE gel of the induced expression of Hpa A protein in E.coli DE 3;

FIG. 5 is a SDS-PAGE gel of the purified recombinant Hpa A protein;

FIG. 6 is an HPLC chart of purified recombinant protein Hpa A;

FIG. 7 is a graph showing the results of comparison of relative binding capacity of libraries in different rounds;

FIG. 8 is a monoclonal diagram of aptamer for restriction enzyme digestion identification analysis;

FIG. 9 is a graph showing the results of comparison of detection performances of 5 strains with different monoclonal aptamers;

FIG. 10 is a graph showing the results of detection of binding force between the full-length sequence and the core sequence of aptamer HA 6;

fig. 11 is a graph showing the results of binding of confocal laser-verified aptamers to h.pyrori;

FIG. 12 is a graph showing the results of flow cytometry to detect that aptamer HA6 blocks the binding of Hp to GES-1.

Detailed Description

Embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The following examples are only for illustrating the technical solutions of the present invention more clearly, and therefore are only examples, and the protection scope of the present invention is not limited thereby.

It is to be noted that, unless otherwise specified, technical or scientific terms used herein shall have the ordinary meaning as understood by those skilled in the art to which the invention pertains. The experimental procedures in the following examples are conventional unless otherwise specified. The materials used in the examples were purchased from conventional biochemical reagent stores unless otherwise specified.

Example 1 screening of aptamers

1. Experimental Material

The strain source is as follows: hp ATCC26695 strain is from the university of jiangsu.

ssDNA library:

5’-CGGATCCATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3’

and primer P1: 5' -CGGATCCATCCAGAGTGACGCAGCA-3’

Primer P2: 5' -GAAGCTTACTAAGCCACCGTGTCCA-3'; are all offered by Shanghai bioengineering.

Colombia medium was purchased from Qingdao Haibo Biotech.

Fetal bovine serum was purchased from Gibco.

Restriction enzymes BamH I, Hind III and T4 ligase were purchased from Fermentas.

DNA marker and protein marker were purchased from Beijing Lanborlided Bio Inc.

Microaerophilic gas-generating bags were purchased from mitsubishi corporation.

PCR mix reaction was purchased from Thermo.

Kanamycin and gentamicin were purchased from Sigma.

Siniperca chuatsi essence DNA was purchased from Sigma.

2. Hp culture and pET28a/Hpa A recombinant plasmid construction

2.1 Hp culture

Weighing Columbia culture medium 44 g, dissolving in 900ml pure water, autoclaving at 121 deg.C for 15min, cooling to 45 deg.C, adding 50ml aseptic defibrinated sheep blood, 50ml fetal calf serum and 20mg gentamicin, mixing, and pouring into aseptic plate. The helicobacter pylori strains are densely lined and coated on a flat plate, and the flat plate is placed in a microaerophilic tank, added with a proper amount of sterilized water and a microaerophilic aerogenic bag, sealed and placed in a37 ℃ incubator. And scraping the Hp mycoderm after the strains are cultured to be qualified, and extracting Hp genome DNA by using a bacterial gene extraction kit and identifying.

2.2 construction of pET28a/Hpa A recombinant plasmid

Designing and synthesizing a primer:

hpa A (Gene ID:898975) primers were designed with the following sequences:

F:5’-CGGATCCTGCAGCCCGCATATTATTG-3’(BamH I，25μmol/L)；

R:5’-CAAGCTTTCGGTTTCTTTTGCCTTTT-3’(Hind III，25μmol/L)；

gene amplification: taking the extracted genome DNA as a template, carrying out PCR amplification, wherein the reaction conditions are as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, 35 cycles in total, extension at 72 ℃ for 5min, and identifying the product by electrophoresis. The example of the present invention extracted genome from ATCC26695, successfully cloned Hpa A gene length 699bp, total 713bp, without 27aa signal peptide by primer, as shown in FIG. 1.

Construction of pET28a/Hpa A recombinant plasmid: the Hpa A gene obtained by amplification was recovered using a PCR product recovery kit. The PCR-amplified fragment and plasmid pET28a were digested with BamH I and Hind III restriction enzymes at 37 ℃ for 2h, and 2 digestion products were recovered using DNA recovery kits, respectively. Mixing the recovered fragment enzyme digestion product and the plasmid enzyme digestion product in a T4 ligase reaction system according to the mole number of 9:1, and reacting for 4h at 16 ℃. 10ul of the reaction system was taken and mixed with 50ul of E.coli DE3 competent cells, and then placed in an ice bath for 30 minutes, in a water bath at 42 ℃ for 90 seconds, and then in an ice bath for 15 min. The above mixed reagent was added to 500. mu.l of LB medium, left to stand at 37 ℃ for 1 hour, and 200. mu.l of the mixture was spread on a resistant LB agar plate (final kanamycin concentration: 50ug/mL) and cultured overnight at 37 ℃. The plasmid was extracted by enrichment from a single-clone LB liquid medium (final kanamycin concentration: 50ug/mL) and identified by digestion with BamH I and Hind III, with a small fragment of about 700, as shown in FIG. 2. The plasmid identified as a positive clone was sequenced and aligned to have 100% identity without frameshift mutations and was designated pET28a/HpaA, as shown in FIG. 3.

3. Induced expression, purification and identification of recombinant Hpa A protein

E.coli BL21 transformed with pET28a/Hpa A recombinant plasmid was cultured in LB liquid medium containing kanamycin to an OD 600nm of about 0.8, and after induction with 1mmol of IPTG at 37 ℃ for 4 hours, the bacteria were collected by centrifugation. SDS-PAGE showed that the protein with high abundance was expressed around 30kD, as shown in FIG. 4. FIG. 4 is a SDS-PAGE gel electrophoresis analysis of the induced expression of the recombinant Hpa A protein in E.coli DE 3: m: protein marker,

Lane

1, 2, 3, 4 are IPTG induction 1h, 2h, 3h, 4h respectively, Escherichia coli DE3 thallus lysate, Lane 5 is bacterial lysis of untransformed recombinant plasmid; the arrow indicates the band of the recombinant Hpa A protein.

To the collected bacteria, 10mg/mL lysozyme solution was added, and the mixture was left overnight at 4 ℃. After being treated by a high-pressure homogenizer, the mixture is centrifuged for 30min at 10000g at 4 ℃, supernatant is taken and affinity purified by Ni-NAT column, and the supernatant is washed for 3 times by 20mmol and 40mmol of imidazole in 5 times of column volume respectively and eluted by 200mmol of imidazole. The eluted target protein was freeze-dried and then subjected to SDS-PAGE electrophoretic identification and HPLC identification, as shown in FIGS. 5 and 6. In fig. 5, M: protein marker, lane 1 is purified recombinant protein Hpa A. The molecular weight of the recombinant Hpa A purified and eluted by Ni-NAT is about 28kD, and the purity of the recombinant Hpa A is about 98% as determined by gray scanning analysis and HPLC; the band was cut and submitted to the company for peptide fingerprinting analysis and identification, and the detection result was Hpa A protein derived from helicobacter pylori ATCC26695, as shown in Table 1.

TABLE 1 peptide fingerprinting of recombinant proteins with HpaA amino acid sequence identity

4. SELEX screening

Screening buffer solution: 20mM HEPES, pH 7.4, 120mM NaCl, 5mM KCl, 1mM CaCl₂，1mM MgCl₂·6H₂O。

An initial ssDNA library comprising library sequences:

5’-CGGATCCATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3’(BamH I)(88nt)；

primer P1: 5' -CGGATCCATCCAGAGTGACGCAGCA-3’(BamH I)；

Primer P2: 5' -GAAGCTTACTAAGCCACCGTGTCCA-3’(Hind III)；

SELEX screening was performed by a microplate method. The initial ssDNA library was solubilized. 10ng of purified HpaA protein was dissolved in pH 9.6 carbonate buffer, coated on polystyrene microwells and blocked with Mandarin fish sperm DNA at 37 ℃ for 1 hour. Taking 2nmol of initial ssDNA library, heating at 95 ℃ for 5min, quickly placing in ice water for 5min, adding into micropores, incubating at 37 ℃ for 1h, discarding supernatant, and washing the micropores with screening buffer solution for 3 times, each time for 5 min. Adding 100ul H into micropores₂Heating at 95 deg.C for 5 min.

The bound ssDNA eluate was amplified by PCR as the library for the next round of screening. PCR amplification reaction conditions: pre-denaturation at 95 ℃ for 5min, 30s at 95 ℃, 30s at 60 ℃ and 20s at 72 ℃ for 12 cycles, and extension at 72 ℃ for 5 min.

Adding siniperca chuatsi sperm DNA closed micropore reverse screening in the 5 th round, collecting ssDNA in the supernatant for PCR amplification, and taking the ssDNA as a library of the next round of forward screening, wherein the amplification conditions are as follows: pre-denaturation at 95 ℃ for 5min, 30s at 95 ℃, 30s at 60 ℃ and 20s at 72 ℃ for 10 cycles, and extension at 72 ℃ for 5 min.

After 10 rounds of positive screening and 5 rounds of negative screening, the relative binding capacity of the harvested 10 rounds of libraries was measured, and the data shows that the relative binding capacity of 1 st round to 5 th round is in an increasing trend, and the addition of the 5 th round of negative screening temporarily decreases the relative binding capacity, but the relative binding capacity is still in an increasing trend with the increase of the number of screening rounds and is higher than that of the first 5 rounds, as shown in fig. 7. In FIG. 7, ns indicates that the difference between the two groups is not statistically significant; differences have significant statistical significance.

5. Identification of aptamer binding properties

The ssDNA obtained in the last round was PCR amplified to dsDNA, which was digested separately with pUC19 plasmid by double digestion (BamH I and Hind III), and the digested fragments were recovered according to the kit instructions. The PCR fragment and plasmid digestion product according to the amount of the substance 5:1 mixed, then in T4 ligase reaction system 16 degrees C connected 4 hours, after transformation into E.coli DH5 alpha Escherichia coli, ampicillin resistance LB solid medium 37 degrees C overnight culture. The single colony is picked for enrichment culture and plasmid is extracted, and the extracted plasmid is identified by using double enzyme digestion (BamH I and Hind III). The enzyme-positive plasmid was amplified using Bio-P1, and the resulting ssDNA was bound to Hpa A and its relative binding was verified.

After the 10 th round of aptamers were amplified to double strands and cloned into the pUC19 plasmid, the 43 clones selected were digested to identify 40 positive clones, as shown in FIG. 8.

6 monoclonal aptamers with high relative binding force are combined with various thalli, and the binding specificity of the monoclonal aptamers is verified. The results of affinity measurements of 2 monoclonal aptamers with high specificity (designated as HA3 and HA6 aptamers) are shown in fig. 9.

The affinity of the two aptamers was subsequently examined, K for HA3 and HA6 aptamers_DThe values are respectively: 8.531. + -. 1.59nM and 6.520. + -. 1.489nM, as shown in FIG. 10. In FIG. 10, panel (A) shows the binding assay for the aptamer HA6 full-length sequence; panel (B) shows the binding assay for aptamer HA6 core sequence.

Example 2 aptamer detection efficacy validation

Sequencing the plasmids of the 2 aptamers finally obtained by screening after enzyme cutting is positive, synthesizing a core region sequence marked by FAM, and detecting HP in a gastric mucosa tissue section by using the two aptamers. Freezing and slicing the fresh gastric mucosa taken out, fixing the frozen and sliced fresh gastric mucosa on a polylysine-treated glass slide, putting the synthesized FAM-labeled aptamer into the glass slide at the concentration of 10 mu mol, covering a detection area, incubating for 20 minutes in a dark place, screening buffer solution, washing the glass slide for 5 times, drying the glass slide, and detecting the glass slide by using a fluorescence microscope.

The final sequence of the obtained aptamer is as follows:

CGTTACGATCGGATCCAATGCATTTGCGCATATCGTAACCGATAG, SEQ ID NO. 1.

Fluorescence was observed under a fluorescence microscope and positive was noted with fluorescence: (+); no fluorescence was scored negative: (-) as shown in figure 11. In fig. 11, panel (a) is the binding of FAM-labeled aptamer HA6 to h.pylori; (B) staining for rhodamine dyes with h.pyri; (C) the two images (A) and (B) are combined.

And the results were compared to the patient's C14 breath test and the rapid urease test. The match rate was higher compared to the rapid urease test (RUT method) of the patients, and there was no statistical difference between the two methods, as shown in Table 2.

TABLE 2 comparison of detection rates of helicobacter pylori in 166 gastric mucosa specimens by two methods

Example 3 flow cytometry detection of HA6 to block HP binding to GES-1 cells

HP was stained with rhodamine B, aptamer HA6 was added at different dose gradients, incubated and bound to GES-1 cells, and the proportion of Hp attached to GES-1 cells was detected by flow cytometry, as shown in FIG. 12.

The existing research analyzes the structure of prokaryotic expression adhesin, which is consistent with the structure of natural adhesin, so that it is feasible to screen ligand for its three-dimensional conformation. The invention selects HpaA with higher abundance based on the detection of Hp in gastric mucosa. The invention analyzes the 260 th amino acid functional area of the protein, the 1-27 th amino acid is signal peptide, the 134-139 th amino acid is combined functional area, and then the gene coding 28-259 th amino acid is amplified and cloned.

During the purification, a Ni-NAT affinity chromatography column is used for purification, and HPLC is used for identifying the purity, the purity is about 98 percent, and the requirement of screening is met. After 10 rounds of positive screening and 5 rounds of negative screening, cloning the aptamer library in the last round, carrying out PCR amplification on the selected positive clones to obtain 32 kinds of aptamers, and detecting the binding force of the aptamers, and selecting 6 aptamers with higher binding force to carry out detection specificity detection. After detection, two aptamers have stronger capability of distinguishing Hp, and then the full length of the aptamers and the binding force of a core sequence (45nt) are compared, and the difference of the binding force has no statistical significance. The combination of the aptamer and Hp is verified in a frozen section of the gastric mucosa, and the aptamer can detect the thallus more sensitively by virtue of small molecular weight, strong permeability and combination with a fluorescent marker.

The invention utilizes the in vitro screening technology SELEX technology of the aptamer to screen the corresponding ligand of Hpa A, and uses the ligand to detect Hp in gastric mucosa. Compared with a C14 breath test and a rapid urease test, the method for screening the Hp adhesion Hpa A aptamer can more intuitively reflect the condition of body infection Hp.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; such modifications and substitutions do not depart from the spirit and scope of the present invention, and they should be construed as being included in the following claims and description.

SEQUENCE LISTING

<110> Anhunan medical college second subsidiary Hospital

<120> adhesin aptamer, and screening method and application thereof

<130>1

<160>1

<170>PatentIn version 3.5

<210>1

<211>45

<212>DNA

<213> Artificial sequence

<400>1

cgttacgatc ggatccaatg catttgcgca tatcgtaacc gatag 45

Claims

1. An adhesin aptamer, wherein the nucleotide sequence of the aptamer comprises a nucleotide sequence shown as SEQ ID No. 1; or a nucleotide sequence containing any one of the following: a sequence which has more than 60 percent of homology with the nucleotide sequence defined by SEQ ID NO.1 and hybridizes with the nucleotide sequence defined by SEQ ID NO.1, and an RNA sequence transcribed by the nucleotide sequence defined by SEQ ID NO. 1.

2. The adhesin aptamer according to claim 1, wherein the nucleotide sequence of the aptamer is methylated, thiolated, phosphorylated, aminated or isotopically esterified.

3. The aptamer according to claim 1 or 2, wherein the nucleotide sequence of the aptamer has a fluorescent substance, a therapeutic substance, a radioactive substance, biotin, digoxigenin, a nano-luminescent material, or an enzyme label attached thereto.

4. A method for screening an aptamer according to claim 1, comprising the steps of:

(4) performing PCR amplification on the obtained ssDNA to obtain dsDNA;

5. The screening method according to claim 4, wherein the Hpa A primer sequence in step (1) is:

F:5’-CGGATCCTGCAGCCCGCATATTATTG-3’；

R:5’-CAAGCTTTCGGTTTCTTTTGCCTTTT-3’。

6. the screening method of claim 4, wherein in step (3), the ssDNA library comprises the sequence:

5’-CGGATCCATCCAGAGTGACGCAGCA-N45-TGGACACGGTGGCTTAGT-3’；

primer P1: 5' -CGGATCCATCCAGAGTGACGCAGCA-3’；

Primer P2: 5' -GAAGCTTACTAAGCCACCGTGTCCA-3’。

7. The screening method of claim 4, wherein in step (3), purified adhesin Hpa A is coated in polystyrene microwells, and then the synthetic ssDNA library is dissolved in screening buffer and put into it, and bound ssDNA is washed down as a template for the next round; blank wells were used as negative screening media after the fifth round.

8. Use of the adhesin aptamer or derivative thereof of any of claims 1 to 3 in the preparation of a kit, molecular probe or targeting medium for the detection of helicobacter pylori.

9. A helicobacter pylori detection reagent comprising the adhesin aptamer according to any one of claims 1 to 3.

10. Use of the adhesin aptamer or derivative of any of claims 1 to 3 for the preparation of a vaccine against helicobacter pylori.