CN110628905A - Diagnostic marker detection kit for breast in-situ cancer and detection method and application thereof - Google Patents
Diagnostic marker detection kit for breast in-situ cancer and detection method and application thereof Download PDFInfo
- Publication number
- CN110628905A CN110628905A CN201910556557.6A CN201910556557A CN110628905A CN 110628905 A CN110628905 A CN 110628905A CN 201910556557 A CN201910556557 A CN 201910556557A CN 110628905 A CN110628905 A CN 110628905A
- Authority
- CN
- China
- Prior art keywords
- round
- amplification
- situ
- kit
- breast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a diagnostic marker detection kit for breast in situ cancer, a detection method and application thereof, wherein the detection kit comprises two pairs of upstream and downstream amplification primers of SNP sites, an amplification template extraction reagent, DNA polymerase, dNTPs and buffer solution, a first round of amplification product is longer than a second round of amplification product and contains the second round of amplification product, the second round of amplification is carried out by taking the first round of amplification product as a template, wherein the first round of amplification primers are shown as SEQ ID NO: 1-2, wherein the second round amplification primer is shown as a sequence table SEQ ID NO: 3 to 4. The invention adopts a two-round amplification method to repeatedly amplify the same segment, efficiently and accurately amplifies the segment to be amplified and detects the SNP locus of the CDKN2BAS gene by pyrosequencing, can quickly draw a conclusion, is convenient for clinically prejudging the curative effect of breast carcinoma in situ, is convenient to sample, is efficient and quick to detect and has low cost, and relieves the burden on economy and body of a patient.
Description
Technical Field
The invention relates to a diagnostic marker detection kit for breast carcinoma in situ, a detection method and application thereof, belonging to the field of detection kits.
Background
Carcinoma of the breast in situ refers to a lesion in which epithelial cells in the duct or lobule of the breast proliferate abnormally but do not extend beyond the surrounding basement membrane. The cancer can be classified into ductal carcinoma in situ and lobular carcinoma in situ according to the occurrence position. The current concept is that intraductal carcinoma in situ is no longer a true breast cancer, but rather a precancerous lesion of invasive breast cancer, with a tendency to progress to invasive breast cancer. For the precancerous lesions, missed diagnosis is easy to occur in early breast examination, such as molybdenum target and ultrasound examination, so that the patients miss the optimal treatment opportunity. Therefore, how to screen breast carcinoma in situ early and accurately is crucial to improve the survival rate of patients and the prognosis.
Breast Carcinoma In Situ (BCIS) diagnosis accounts for approximately 20% of all Breast Cancers (BC) in countries with screening programs, and is one of the most recognized risk factors in the breast cancer family. The in situ breast cancer is related to the genetic polymorphism sites with the connection of the million strands, and CDKN2BAS-rs1011970, FGFR2-rs 3750817, FGFR2-rs2981582, TNRC9-rs3803662 and 5p12-rs10941679 are screened out through the screening of a gene bank and the region screening. Through verification, the CDKN2BAS-rs1011970 locus is found to have obvious correlation with the breast in situ cancer. Therefore, the CDKN2BAS-rs1011970 locus is used as a biomarker for diagnosing the breast in situ cancer for rapid detection, and a genetic factor level basis is provided for the screening and prognosis of clinical breast in situ cancer.
Disclosure of Invention
In view of the above problems in the prior art, the present invention aims to obtain a diagnostic marker detection kit for breast carcinoma in situ, and a detection method and application thereof.
In order to realize the purpose, the technical scheme of the kit for detecting the breast in-situ cancer diagnosis marker adopted by the invention is as follows:
the detection kit comprises two pairs of upstream and downstream amplification primers of SNP sites, an amplification template extraction reagent, DNA polymerase, dNTPs and buffer solution, wherein a first round of amplification product is longer than a second round of amplification product and contains the second round of amplification product, the second round of amplification is carried out by taking the first round of amplification product as a template, and the first round of amplification primers are shown in a sequence table SEQ ID NO: 1-2, wherein the second round amplification primer is shown as a sequence table SEQ ID NO: 3 to 4.
According to the invention, due to the particularity of the sequence to be detected, the amplification kit with the same sequence of two reverse primers is designed, the kit has high specificity and accurate amplification result, the use is simple and convenient, and a good foundation is laid for subsequent sequencing work.
The primer sequence provided in the detection method is only the most basic primer sequence, the primer sequence can be modified according to different final detection means in the detection process, such as adding a fluorescent label, a biotin label, a nano microsphere, a magnetic bead and the like into the primer, the modification method can adopt a conventional method in the field, and the modification methods are considered to fall into the protection scope of the invention.
The detection sample can be selected from a blood sample or an oral swab, the gene screening has no pain and no side effect, the genetic basis can be rapidly and accurately provided for clinical medication of breast in-situ cancer, and the clinical medication and prognosis tracking are facilitated.
The detection method of the amplification product can refer to various existing detection methods, and is not limited herein.
Preferably, in the detection method, compared with the first round and the second round amplification systems, the volume of the second round PCR amplification system is at least 2 times of that of the first round PCR amplification system, the primer concentration is changed in an equal proportion, but the template addition amount is the same. The amplification system can ensure the complete performance of the second round of PCR amplification.
Preferably, in order to ensure that the two rounds of amplification reactions can be completely performed, the denaturation time of the second round of PCR amplification system is prolonged, so that the template double strand can be conveniently and fully opened, the annealing temperature is slightly higher than that of the first round, but the number of cycles can be properly reduced due to the short fragments, and the specificity of the amplified product is ensured.
As a preferred embodiment, the reaction procedure of the two-round amplification system is specifically as follows: the first round of PCR amplification system is 25 μ L, the extracted genome DNA is used as a template, and the reaction procedure is 94 ℃ for 2 min; 15sec at 94 ℃, 20sec at 50 ℃ and 2min at 72 ℃ for 35 cycles, 10min at 72 ℃ and heat preservation at 4 ℃;
the second round of PCR amplification system is shown in Table 2 below, the reaction system is 50 μ L, the first round product is used as a template, and the reaction procedure is 94 ℃ for 4 min; 15sec at 94 ℃, 20sec at 55 ℃ and 2min at 72 ℃ for 30 cycles, 10min at 72 ℃ and heat preservation at 4 ℃.
As a preferred embodiment, Primix Taq enzyme is used in both PCR reactions, 10. mu.L is added in the first round and 25. mu.L is added in the second round.
The amplification product can be directly detected qualitatively by agarose gel electrophoresis, and can also be detected by DNA in other modes.
The kit comprises a first round amplification primer and necessary reagents thereof, and a second round amplification primer and necessary reagents thereof.
Preferably, the DNA polymerase in the reagents necessary for amplification is Primix Taq enzyme.
Preferably, the kit further comprises a DNA recovery reagent.
The invention also provides a detection method of the kit for detecting the breast in-situ cancer diagnosis marker, the detection method carries out gene sequencing on the second round amplification product, and the second round amplification product is amplified by taking the first round amplification product as a template.
The invention also provides an application of the diagnosis marker detection kit for the breast in situ cancer, and the detection kit can be used for gene diagnosis of the breast in situ cancer incidence risk and detection of rs1011970 site of CDKN2BAS as other diagnosis markers or detection indexes.
Compared with the prior art, the method adopts a two-round amplification method to repeatedly amplify the same segment, the second round of primers are combined in the first PCR product, so that the second PCR amplified segment is shorter than the first amplification, and because the probability of primer pairing and amplification on the wrong segment is extremely low, the two-round amplification can well correct the wrong segment generated in the first amplification, the amplification specificity is very high, and the pollution of non-specific amplification caused by the weak specificity of primer pairing is basically avoided. The method has the advantages that the fragments to be amplified are efficiently and accurately amplified, the pyrophosphate sequencing is carried out to detect the SNP locus of the CDKN2BAS gene, the conclusion can be quickly given, the clinical prediction of the curative effect of the breast carcinoma in situ is facilitated, the sampling is convenient, the detection is efficient, quick and low in cost, and the economic and physical burden of a patient is relieved.
Drawings
FIG. 1 is an electrophoretogram of PCR amplification products provided by the present invention.
Detailed Description
The kit for detecting the breast carcinoma in situ diagnosis marker provided by the present invention is further described in detail and completely by referring to the following examples. The following examples are illustrative only and are not to be construed as limiting the invention.
The experimental procedures in the following examples are conventional unless otherwise specified. The experimental materials used in the following examples were all commercially available unless otherwise specified.
Kit composition
The rapid amplification kit in this embodiment is a nested PCR kit for performing two rounds of amplification on the rs1011970 site of CDKN2BAS, and includes two pairs of upstream and downstream amplification primers of SNP sites, an amplification template extraction reagent, DNA polymerase, dNTPs, and a buffer solution. The Taq DNA polymerase is Ex Taq DNA polymerase from TaKaRa.
The DNA template used in the kit of this embodiment is a human blood DNA template extracted after processing, and the collected human whole blood or tissue needs to be processed in advance. If the sample to be amplified is an unprocessed whole blood sample, a buffer solution for PCR of the whole blood sample is adopted, wherein the buffer solution contains 100mmol/L Tris-HCl, 50mmol/L KCl and has the pH value of 9.3-9.5.
The diagnostic marker CDKN2BAS-rs1011970 of the invention is recorded as 'G/T' base mutation in NCBI, and is represented by 'K' in the sequence, and the specific sequence is as follows:
AACCCTGTTAGATAAAAAATTCATCCATTAATAGCAACTAAATTTCATTAGGTAAGTAGT
AGTGCTGTGTTTAAAAGAGTAATCTATTTGGAAACAGGAATTAATACTCAGaatattatt
attaatatatttgaaaattaCTTGTGTTTATTTGTCCCAGCCCTTACAAGGTGTGTGGTA
ATGGTTAAGGTATTTCTCCTCTATATGCCTGAGTTTTCTTCTTTACAAAAGGGGGGAGGG
AATAATAGCACCTGATTTTACTTTTGTTGTGAAGATtaaatttgtacatatataaatcta
tatatctatatatacacttatatatgtatgtaaaatatgtaGGCTTGTGCCTGACATTAA
ATACTAAAAAATACTAGCTATTATTTTTATCCTCATATTATCAGATATGACACATTCATA
ATTTAAACAGAAGCCTACGAAGAACTCATAAATTAAAAGAAGATAATCTTTTCACAAGGT AACAAATTTTGGAACAATTTTTTAGAGTCTCTAGACATCTGTTACTGACGTTGTGAGTGA
AATGGGTCTGTGAAGGGAAGATACAGGTGGAACTGGGCCAGTGTTT
K
CAGAGGACCATGATATTTCTATATCTCTGCTGGCTCCCTATCAGTTCTAGAGCTAGTTCA
AGTGAAGCCTCCATAACCTCTGGACAATAAAAATGCACCATGCTATTGTTAGCATGATGA
ATGAATTTATTTTTGTTTAGCTTACAGAAAGTTAGTAGTTTTCAAAAGGGTCTTTATGTA
TACAATTGAAGATACTACATTCTTGAAAAGGAAATCTTTACAGCATACAGGTCCCTGGCA
CTAATACCTCATTTCTGGGCACAGCTTGATATGGAGGTATAGTTTGTGTTTTATCTGAGG
AAAATTTAGGTTGGTGTTATGTTTTGGGCTAGCTCTGCTGAAACATTATTCTCTTTTCTT
TTAGAGCCAGGGCTGTGGGCTGTGTCACTTGTGACTTGGCAGCCCTTAATGGGGCTACAT
GAGGAAGACATTTCCTTACATGATTCCAAGAGTCTTTCTCTGGGGTTCTGAGGTAGTCTC
TGTGTTTCTTGGAGATATCGTTGGCTCTAAAATTTCCCCTAAGTGAGGGGTTATTCTGTC
TCCCAAAAATGTTAGGAG
second, design of primers
Primers were designed based on the rs1011970 sequence recorded at NCBI, two pairs of amplification primers were designed using Primer Premier 5, and the primers were synthesized by Shanghai Bioengineering technology services, Inc. The two pairs of amplification primers correspond to two PCR reactions, the second round of fragments to be amplified are contained in the first round of fragments to be amplified, and the sequences of the primers are shown in a sequence table SEQ ID NO: 1 to 4, F1 and F2 are Forward primers, and R1 and R2 are Reverse primers. Due to the specificity of the template sequence, the reverse primer sequences of the two pairs of primers in the invention are the same segment of sequence, and the SNP sites to be detected fall into the two segments of amplification products, which are shown in the following table 1 specifically:
TABLE 1
Third, PCR reaction and result identification
The amplification primers are shown in the table 1 above, the amplification system is shown in the table 2 below, the first round of PCR amplification system is 25 μ L, the extracted genomic DNA is used as a template, and the reaction procedure is 94 ℃ for 2 min; at 94 ℃ for 15sec, at 50 ℃ for 20sec, at 72 ℃ for 2min, for 35 cycles, at 72 ℃ for 10min, and at 4 ℃.
The second round of PCR amplification system is shown in Table 2 below, the reaction system is 50 μ L, the first round product is used as a template, and the reaction procedure is 94 ℃ for 4 min; 15sec at 94 ℃, 20sec at 55 ℃ and 2min at 72 ℃ for 30 cycles, 10min at 72 ℃ and heat preservation at 4 ℃.
The two PCR reaction systems are shown in Table 2 below:
TABLE 2
| Reagent | First round usage amount (μ L) | Second round usage amount (μ L) |
| Primix TaqTM(2×) | 10.0 | 25 |
| Forward Primer(20μM) | 0.5 | 1.0 |
| Reverse Primer(20μM) | 0.5 | 1.0 |
| Form panel | 5.0 | 5.0 |
| RNase Free ddH2O | 7.2 | 21 |
| Total amount of | 25 | 50 |
The PCR product was purified and then electrophoresed through 1% agarose gel, the loading buffer contained the tracer dye, the loading amount was the same for each well, and the electrophoresis results are shown in FIG. 1. In the figure, a band between about 150kb and about 250kb is clearly visible, wherein a band 1 is a DNAmarker, a band 2 is an amplification product of the first round, a band 3 is an amplification product of the second round, and a band 4 is a negative control. The amplification system is stable and effective, and the primer amplification is correct.
Detection of single nucleotide polymorphism sites of diagnostic markers
Women with breast examination and existing adult lactation history were selected at random for gene detection at the rs1011970 locus of CDKN2BAS, and among 100 women, 32 women and 68 healthy women were diagnosed with breast carcinoma in situ. The results of the rs1011970 assay are shown in table 3 below:
TABLE 3
| Wild type GG | Mutant heterozygote GT | Mutant homozygotic TT | |
| Group of carcinoma in situ | 12(37.5％) | 19(59.3％) | 1(3.1％) |
| Health group | 47(69.1％) | 21(30.9％) | 0 |
As can be seen from the above table, the T gene frequency of the patients diagnosed with breast carcinoma in situ was 32.8%, which is much higher than 15.4% of that of the healthy group. From the results of the experiment, the gene mutation of the rs1011970 site of CDKN2BAS is related to the onset of breast carcinoma in situ, but the sample size is small, and the sampling range is not enough to support further conclusion. The biochemical mechanism also needs to be further explored.
Finally, it must be said here that: the above embodiments are only used for further detailed description of the technical solutions of the present invention, and should not be understood as limiting the scope of the present invention, and the insubstantial modifications and adaptations made by those skilled in the art according to the above descriptions of the present invention are within the scope of the present invention.
Sequence listing
<110> Wuhan Firsted Biotech Ltd
<120> diagnostic marker detection kit for breast carcinoma in situ, detection method and application thereof
<130> 2018
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(18)
<223> F1 primer sequence
<400> 1
agcctacgaa gaactcat 18
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(18)
<223> R1 primer sequence
<400> 2
ctaacaatag catggtgc 18
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(18)
<223> F2 primer sequence
<400> 3
tgagtgaaat gggtctgt 18
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<221> primer_bind
<222> (1)..(18)
<223> F2 primer sequence
<400> 4
ctaacaatag catggtgc 18
Claims (10)
1. The diagnostic marker detection kit for the breast carcinoma in situ is characterized by comprising two pairs of upstream and downstream amplification primers of SNP sites, an amplification template extraction reagent, DNA polymerase, dNTPs and buffer solution, wherein a first round of amplification product is longer than a second round of amplification product and comprises the second round of amplification product, and the second round of amplification is carried out by taking the first round of amplification product as a template, wherein the first round of amplification primers are shown as SEQ ID NO: 1-2, wherein the second round amplification primer is represented by a sequence table SEQID NO: 3 to 4.
2. The kit for detecting the breast in situ cancer diagnostic marker according to claim 1, wherein: the volume of the second round amplification system is 1.5-2.5 times of that of the first round amplification system, the addition amount of the amplification primers is changed in equal proportion, and the addition amount of the templates is the same.
3. The kit for detecting the in situ breast cancer diagnostic marker according to claim 1, wherein the first PCR amplification system is 25 μ L, and the second PCR amplification system is 50 μ L.
4. The kit for detecting the in situ breast cancer diagnostic marker according to claim 1, wherein the first round of amplification reaction procedure is as follows: taking the extracted genome DNA as a template, and carrying out treatment at 94 ℃ for 2 min; at 94 ℃ for 15sec, at 50 ℃ for 20sec, at 72 ℃ for 2min, for 35 cycles, at 72 ℃ for 10min, and at 4 ℃.
5. The kit for detecting the in situ breast cancer diagnostic marker according to claim 1, wherein the second round of amplification reaction procedure is as follows: taking the first round product as a template, and keeping the temperature at 94 ℃ for 4 min; 15sec at 94 ℃, 20sec at 55 ℃ and 2min at 72 ℃ for 30 cycles, 10min at 72 ℃ and heat preservation at 4 ℃.
6. The kit for detecting the in situ breast cancer diagnostic marker according to claim 1, wherein the Primix Taq enzyme is used in two PCR reactions, 10 μ L is added in the first PCR reaction, and 25 μ L is added in the second PCR reaction.
7. The kit for detecting the breast in situ cancer diagnostic marker according to claim 1, wherein: the kit also comprises a genomic DNA recovery reagent.
8. The kit for detecting the breast in situ cancer diagnostic marker according to claim 1, wherein: the DNA polymerase is Primix Taq enzyme.
9. A detection method using the kit for detecting the breast in situ cancer diagnostic marker according to any one of claims 1 to 8, wherein the detection method is to perform gene sequencing on a second round amplification product, and the second round amplification product is amplified by using a first round amplification product as a template.
10. The application of the diagnostic marker detection kit for breast carcinoma in situ is characterized in that the detection kit is the diagnostic marker detection kit for breast carcinoma in situ according to any one of claims 1 to 9.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810663382 | 2018-06-25 | ||
| CN2018106633824 | 2018-06-25 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110628905A true CN110628905A (en) | 2019-12-31 |
Family
ID=68968369
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910556557.6A Pending CN110628905A (en) | 2018-06-25 | 2019-06-25 | Diagnostic marker detection kit for breast in-situ cancer and detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110628905A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6057105A (en) * | 1995-03-17 | 2000-05-02 | Ngi/Cancer Tech Company, Llc | Detection of melanoma or breast metastasis with a multiple marker assay |
| US20070092900A1 (en) * | 2005-10-26 | 2007-04-26 | Stacey Simon N | Methods for diagnosing and characterizing breast cancer and susceptibility to breast cancer |
| CN101988124A (en) * | 2010-09-03 | 2011-03-23 | 华东师范大学 | Amplification method of fragments of epidermal growth factor receptor (EGFR) gene exon 19 by nested polymerase chain reaction (PCR) method |
| CN104928356A (en) * | 2014-03-21 | 2015-09-23 | 中国科学院上海巴斯德研究所 | Rapid sensitive breast cancer susceptibility gene SNP detection method based on PCR primer 3' terminal nucleotide dideoxy modification |
-
2019
- 2019-06-25 CN CN201910556557.6A patent/CN110628905A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6057105A (en) * | 1995-03-17 | 2000-05-02 | Ngi/Cancer Tech Company, Llc | Detection of melanoma or breast metastasis with a multiple marker assay |
| US20070092900A1 (en) * | 2005-10-26 | 2007-04-26 | Stacey Simon N | Methods for diagnosing and characterizing breast cancer and susceptibility to breast cancer |
| CN101988124A (en) * | 2010-09-03 | 2011-03-23 | 华东师范大学 | Amplification method of fragments of epidermal growth factor receptor (EGFR) gene exon 19 by nested polymerase chain reaction (PCR) method |
| CN104928356A (en) * | 2014-03-21 | 2015-09-23 | 中国科学院上海巴斯德研究所 | Rapid sensitive breast cancer susceptibility gene SNP detection method based on PCR primer 3' terminal nucleotide dideoxy modification |
Non-Patent Citations (4)
| Title |
|---|
| DANIELE CAMPA 等: "Genetic risk variants associated with in situ breast cancer", 《BREAST CANCER RESEARCH》 * |
| 刘玲等: "巢式PCR联合焦磷酸测序检测乙肝病毒耐药基因的方法建立和初步临床应用", 《中西医结合肝病杂志》 * |
| 刘镭等: "一种快速检测乳腺癌患者外周血高表达基因FAM83A的巢式PCR法", 《临床检验杂志》 * |
| 左欣鹭等: "建立快速检测循环癌细胞高表达基因KRT19的巢式PCR新方法", 《重庆医学》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109112216B (en) | Triple qPCR (quantitative polymerase chain reaction) detection kit and method for DNA methylation | |
| CN109825586B (en) | DNA methylation qPCR kit for lung cancer detection and use method | |
| CN109504780B (en) | DNA methylation qPCR kit for lung cancer detection and use method thereof | |
| CN106811525B (en) | Kit and system for predicting early postoperative recurrence of stage III gastric cancer patient | |
| JP6395131B2 (en) | Method for acquiring information on lung cancer, and marker and kit for acquiring information on lung cancer | |
| CN115820847A (en) | Detection reagent for methylation of cervical cancer related genes and application thereof | |
| CN113652490B (en) | Primer probe combination and kit for early screening and/or prognosis monitoring of bladder cancer | |
| CN112980947A (en) | Primer and kit for detecting circulating microRNA (microribonucleic acid) related to lung cancer diagnosis and treatment | |
| CN108866187B (en) | Long-chain non-coding RNA marker related to lung cancer auxiliary diagnosis and application thereof | |
| CN107177676B (en) | Use of long-chain non-coding RNA NONHSAT113026 as molecular marker for diagnosing kidney cancer | |
| EP4144859A1 (en) | Tumor detection reagent and kit | |
| CN113355414A (en) | Esophageal cancer detection kit and application thereof | |
| CN105255869B (en) | Application of ABCC4 gene polymorphism site rs3742106 and detection primer and kit thereof | |
| CN111254199A (en) | Lung cancer related KEAP1 gene methylation detection kit | |
| CN108796078B (en) | Primer and probe set for diagnosing, detecting or screening digestive tract cancer | |
| CN110438210A (en) | The enriched multiple detection method of non-small cell lung cancer targeted drug correlation low frequency mutation | |
| CN113337608B (en) | Combined marker for early diagnosis of liver cancer and application thereof | |
| CN112609002B (en) | Peripheral blood miRNA colon cancer diagnosis marker combination and detection kit thereof | |
| CN110628905A (en) | Diagnostic marker detection kit for breast in-situ cancer and detection method and application thereof | |
| CN102021228B (en) | Specific primers for tissue or whole blood EGFR gene mutation detection | |
| CN111304322B (en) | Preparation method of kit for joint detection of esophageal cancer by four novel circRNAs | |
| CN116555423A (en) | Lung cancer methylation marker combination, detection product and application thereof | |
| CN108165546A (en) | A kind of miRNA biomarker, composition and application thereof | |
| CN113430272A (en) | Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit | |
| CN102732637B (en) | Multiplex nested methylation specific PCR (Polymerase Chain Reaction) detection kit, using method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191231 |
|
| RJ01 | Rejection of invention patent application after publication |