CN110628820A - Optically controlled gene transcription inhibition system and inhibition and construction method - Google Patents

Abstract

The invention discloses a light-operated gene transcription inhibition system and inhibition and construction methods. Different sgRNAs are designed to target different target genes by mainly utilizing a CRISPR system. By introducing a light-operated transcription inhibition system, under different illumination conditions, HDAC is driven to indirectly act on a target gene through the interaction of blue light-dependent light-responsive protein cib1 and cry2, so that the HDAC is combined to a target gene locus, histone deacetylation is carried out, the transcription of the gene is inhibited, and the light-operated gene transcription inhibition is realized. The accurate targeting of VEGF factors and receptor genes is realized by using a CRISPR gene targeting-light genetic gene regulation technology; meanwhile, by utilizing the optogenetic regulation and control technology, the dynamic real-time controllable regulation of VEGF factors and receptor molecules is realized according to individual differences.

Description

Optically controlled gene transcription inhibition system and inhibition and construction method

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a light-operated gene transcription inhibition system and inhibition and construction methods.

Background

With the increase of the aging population, the problems of the elderly become prominent, wherein common fundus diseases (such as macular degeneration, fundus hemorrhage, diabetic retinopathy and the like) often cause serious vision decline and even blindness, and the life quality of the middle-aged and the elderly is seriously affected. However, the clinical treatment of the above fundus diseases still has the defects which are difficult to solve, such as: 1) the treatment effect is not lasting, 2) the treatment effect is volatile control, 3) the treatment effect is not synergistic, and the like, so that the clinical treatment effect is not good.

At present, the method for treating neovascular fundus oculi lesions by using the VEGF resistant method is a current clinical general strategy. The treatment process needs to be repeated for many times, but the effect is not good enough, and the injury can not be effectively reversed. The current treatment situation not only causes heavy economic burden for families of patients, but also easily causes the best treatment time of fundus oculi pathological changes to cause irreversible damage and even blindness, and seriously affects the living quality of the patients.

Aiming at the current clinical situation that neovascular fundus lesions are difficult to prevent and treat, the project combines a CRISPR gene targeting technology and a light genetic protein regulation technology and provides a VEGF-resistant strategy highly-synergistic treatment strategy. The overall objective of the project is to combine the CRISPR gene targeting technology with the optogenetic protein regulation technology to construct a novel precise controllable nano drug delivery system and provide a novel anti-VEGF strategy high-synergistic treatment strategy. The strategy 1) realizes the long-term positioning of a target gene by using a CRISPR gene targeting technology, and effectively improves the durability of a treatment process; 2) by utilizing the optogenetic protein regulation and control technology, the precise regulation and control of the treatment dosage are realized, and the controllability of the treatment process is effectively improved; 3) by utilizing the anti-VEGF combination technology, the simultaneous down-regulation of VEGF factors and receptors is realized, and the synergy in the treatment process is effectively improved. The performance of the system is further verified through in vivo and in vitro cell animal experiments, the clinical situation of the treatment of the fundus diseases is effectively improved, and a novel durable, controllable and synergistic VEGF-resistant strategy is finally provided for clinic.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide various light-operated gene transcription inhibition systems and inhibition and construction methods. The system can design different sgRNAs through a CRISPR system, and the HDAC histone deacetylation system is used for performing light-operated transcription inhibition on different target genes, so that the system is simple and efficient.

The technical scheme adopted by the invention for solving the technical problems is as follows: a light-operated gene transcription inhibition system comprises sgRNA, dCas9-cib1, cry2-HDAC plasmid expression vector;

the sgRNA is a targeting part of a gene suppression system, different sgRNAs are designed to have specific targeting, and dCas9 enzyme can be recruited;

the cib1 and cry2 are blue light dependent photoresponse proteins and can generate photoresponse interaction under the regulation and control of 488nm blue light;

the HDAC is a protease, and plays an important role in structure modification and gene expression regulation of chromosomes;

under the action of blue light, HDAC is combined to a target gene locus, histone is deacetylated, the histone is tightly combined with DNA with negative charge, chromatin is tightly coiled, and the transcription of genes is inhibited.

The second technical scheme of the invention is a construction method of a light-operated gene transcription inhibition system, which mainly comprises the following steps:

constructing a gene targeting sgRNA plasmid expression vector:

pmU6-gRNA is used as a vector, a pair of primers is designed according to the sgRNA, digestion linearization pmU6-sgRNA plasmid is used, the digested vector is recovered, and the sgRNA base after annealing pairing is connected with the recovered vector;

wherein the nucleotide sequence of the sgRNA sequence is SEQ.No. 1;

constructing an expression plasmid dCas9-cib 1:

using pcDNA3.1(+) as a vector, designing a vector reverse PCR primer and an cib1 primer, and connecting cib1 to a dCas9 vector in a homologous recombination manner;

wherein the amino acid sequence of the-dCas 9-cib 1-sequence is SEQ.No. 2;

construction of the cry2-HDAC expression plasmid:

using pcDNA3.1(+) as a vector, designing a vector reverse PCR primer and a cry2 primer, and connecting cry2 to an HDAC vector in a homologous recombination manner;

wherein the amino acid sequence of said-cry 2-HDAC-sequence is SEQ.No. 3;

fourth, cell culture and cell transfection:

and (3) building a light-operated platform, and performing illumination treatment on the cells to realize the light-operated transcription inhibition of the target gene.

Step four, the construction of the light-operated platform is as follows:

the light control platform consists of a blue light LED array and is powered by an external power supply;

the LED working mode is as follows: continuous, pulsed, light emitting;

the intensity is controlled by the power supply;

the conditions of the light treatment are as follows: the illumination condition is blue light 488nm, frequency 1Hz, power 0.75w, illumination 0-25

And (4) hours.

The third technical scheme of the invention is a use method of the light-operated gene transcription inhibition system, which comprises the following steps:

the application method at the cell level comprises the following steps: transfection of sgRNA plasmid, dCas9-cib1 expression plasmid, cry2-HDAC expression plasmid: cells were plated one day in 12-well plates one day in advance, and 1.2ug of DNA, 4ul of transfection reagent were diluted with 25ul of serum-free medium, respectively; standing at room temperature for 5 min; adding the transfection reagent diluent into the DNA diluent, fully and uniformly mixing, and standing for 15min at room temperature; adding the transfection compound to a culture container containing cells and a complete culture medium, and replacing the culture medium after culturing for 4-6 hours;

and after the materials are cultured for 24 hours in a light-shielding manner, different illumination conditions of 488nm, frequency of 0.01-1 Hz, power of 0.75w and illumination of 0-24 hours are provided.

The fourth technical scheme is that the method utilizes a CRISPR system, targets the sirtuin (CRY2, CIBN) to the specific cell VEGF under the blue light effect through sgRNA targeting and the spontaneous aggregation property of the photoresponsive protein under the blue light effect of 488nm, regulates the transcription of the sirtuin and realizes the transcription inhibition of the light-operated gene.

The method utilizes sgRNA in a CRISPR system to target a target gene, and realizes the light-operated gene transcription inhibition by introducing a light-operated gene transcription inhibition system and driving HDAC to indirectly act on the target gene through the interaction of light-operated cib1 and cry2 under different illumination conditions.

The invention has the following beneficial effects:

1. the accurate targeting of VEGF factors and receptor genes is realized by using a CRISPR gene targeting-light genetic gene regulation technology; meanwhile, by utilizing the optogenetic regulation and control technology, the dynamic real-time controllable regulation of VEGF factors and receptor molecules is realized according to individual differences.

2. The gene delivery vector respectively takes the sgRNA of the CRISPR system as a targeting element and the light-sensitive genes cry2 and cib1 as regulating elements. Accurate regulation and control of different disease processes in retinal neovascular diseases are realized by controlling different frequencies and different durations of 488nm blue light illumination.

3. Creatively and organically fuses 'CRISPR gene targeting-light genetic protein regulation' and develops a set of light genetic CRISPR system which can realize specific gene targeting and thus carry out transcription inhibition.

4. The light-operated platform is built, so that light-operated gene transcription inhibition with different frequencies and different durations can be realized.

5. The high efficiency of HDAC deacetylation transcription inhibition is utilized, and the space-time accuracy of optogenetics is utilized. Compared with the traditional treatment method, the method improves the precision controllability.

6. Provides a new idea for researching the controllable transcription inhibition of genes.

Drawings

FIG. 1: the light response protein cib1, cry2 interaction characterizes confocal images;

FIG. 2: a light-controlled gene expression inhibition qPCR profile;

FIG. 3: and (3) a western-blot diagram for suppressing expression of light-controlled genes.

Detailed Description

To further illustrate the present invention, the present invention will now be described in detail by way of specific embodiments.

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the method used in the present invention is a method,

unless otherwise specified, all methods are conventional in the art.

Designing and constructing a light-operated gene transcription inhibition system, wherein the system comprises sgRNA, dCas9-cib1, cry2-HDAC plasmid expression vectors;

the sgRNA is a targeting part of a gene suppression system, different sgRNAs are designed to have specific targeting, and dCas9 enzyme can be recruited; the cib1 and cry2 are blue light dependent photoresponse proteins and can generate photoresponse interaction under the regulation and control of 488nm blue light; the HDAC is a protease, and plays an important role in the structural modification and gene expression regulation of chromosomes. Under the action of blue light, HDAC is combined to a target gene locus, histone is deacetylated, the histone is tightly combined with DNA with negative charge, chromatin is tightly coiled, and the transcription of genes is inhibited.

A method for constructing the light-operated gene transcription inhibition system comprises the following steps:

constructing a gene targeting sgRNA plasmid expression vector:

pmU6-gRNA is used as a vector, a pair of primers is designed according to the sgRNA, a linearized pmU6-sgRNA plasmid is cut by enzyme, the cut vector is recovered, and the sgRNA base after annealing pairing is connected with the recovered vector;

wherein the nucleotide sequence of the sgRNA sequence is SEQ.No. 1;

the nucleotide sequence of the sgRNA sequence is as follows:

gcgctccccaccggcccgtg

constructing an expression plasmid dCas9-cib 1:

using pcDNA3.1(+) as a vector, designing a vector reverse PCR primer and an cib1 primer, and connecting cib1 to a dCas9 vector in a homologous recombination manner;

wherein, the nucleotide sequence of the-dCas 9-cib 1-sequence is SEQ.No. 2;

the nucleotide sequence of the dCas9-cib1 is as follows:

atggacaagaagtactccatcggcctcgcgatcggcaccaactccgtgggctgggcggtcatcaccgacgagtacaaggtcccctccaagaagttcaaggtcctgggcaacaccgaccggcactcgatcaagaagaacctgatcggcgccctgctcttcgacagcggcgagaccgccgaggcgacccgcctgaagcggaccgcgcgtcgccgctacacccggcgcaagaaccgcatctgctacctgcaggaaatcttctccaacgagatggccaaggtggacgactcgttcttccaccgcctggaggagagcttcctggtggaggaggacaagaagcacgagcgccacccgatcttcggcaacatcgtggacgaggtggcctaccacgagaagtaccccaccatctaccacctccgcaagaagctggtggactcgaccgacaaggcggacctgcggctcatctacctggccctcgcgcacatgatcaagttccgcggccacttcctcatcgagggcgacctgaacccggacaactccgacgtggacaagctcttctccagctggtgcagacctacaaccagctgttcgaggagaaccccatcaacgccagcggcgtggacgccaaggcgatcctctccgcgcgcctgagcaagtcccggcgcctggagaacctcatcgcccagctgccgggcgagaagaagaacggcctcttcggcaacctgatcgcgctgtcgctcggcctgacccccaacttcaagagcaacttcgacctggccgaggacgcgaagctccagctgtccaaggacacctacgacgacgacctggacaacctgctcgcccagatcggcgaccagtacgcggacctcttcctggccgcgaagaacctctcggacgccatcctgctcagcgacatcctgcgggtcaacaccgagatcaccaaggccccgctgtcggcgagcatgatcaagcggtacgacgagcaccaccaggacctgaccctgctcaaggccctcgtgcgccagcagctgcccgagaagtacaaggaaatcttcttcgaccagtccaagaacggctacgccggctacatcgacggcggcgcgtcgcaggaggagttctacaagttcatcaagccgatcctggagaagatggacggcaccgaggagctgctcgtcaagctgaaccgcgaggacctgctccgcaagcagcggaccttcgacaacggctccatcccgcaccagatccacctgggcgagctccacgccatcctccggcgccaggaggacttctaccccttcctgaaggacaaccgcgagaagatcgagaagatcctgaccttccgcatcccgtactacgtcggccccctggcccgcggcaactcccggttcgcgtggatgacccggaagtcggaggagaccatcaccccgtggaacttcgaggaggtcgtggacaagggcgcgtccgcgcagtcgttcatcgagcgcatgaccaacttcgacaagaacctcccgaacgagaaggtcctgcccaagcactccctgctctacgagtacttcaccgtgtacaacgagctgaccaaggtcaagtacgtgaccgagggcatgcggaagccggccttcctgtcgggcgagcagaagaaggcgatcgtggacctgctcttcaagaccaaccgcaaggtcaccgtgaagcagctgaaggaggactacttcaagaagatcgagtgcttcgactccgtcgagatcagcggcgtggaggaccgcttcaacgcctccctgggcacctaccacgacctgctcaagatcatcaaggacaaggacttcctcgacaacgaggagaacgaggacatcctggaggacatcgtcctcaccctgaccctcttcgaggaccgcgagatgatcgaggagcggctcaagacctacgcccacctgttcgacgacaaggtgatgaagcagctgaagcgtcgccgctacaccggctggggccgcctctcccggaagctgatcaacggcatccgggacaagcagagcggcaagaccatcctggacttcctcaagtccgacggcttcgccaaccgcaacttcatgcagctcatccacgacgacagcctgaccttcaaggaggacatccagaaggcccaggtctcgggccagggcgacagcctccacgagcacatcgccaacctggcgggctccccggcgatcaagaagggcatcctccagaccgtcaaggtcgtggacgagctggtcaaggtgatgggccgccacaagcccgagaacatcgtgatcgagatggcccgggagaaccagaccacccagaagggccagaagaactcgcgcgagcggatgaagcggatcgaggagggcatcaaggagctcggcagccagatcctgaaggagcacccggtcgagaacacccagctgcagaacgagaagctgtacctctactacctgcagaacggccgcgacatgtacgtggaccaggagctcgacatcaaccggctgtccgactacgacgtggacgcgatcgtgccgcagtccttcctgaaggacgactcgatcgacaacaaggtcctgacccgctcggacaagaaccggggcaagtccgacaacgtgccctcggaggaggtcgtgaagaagatgaagaactactggcgccagctgctcaacgccaagctcatcacccagcgcaagttcgacaacctgaccaaggccgagcggggcggcctgagcgagctcgacaaggcgggcttcatcaagcgccagctggtcgagacccggcagatcaccaagcacgtggcccagatcctggactcccggatgaacaccaagtacgacgagaacgacaagctgatccgcgaggtcaaggtgatcaccctcaagagcaagctggtctccgacttccgcaaggacttccagttctacaaggtccgggagatcaacaactaccaccacgcccacgacgcgtacctgaacgccgtcgtgggcaccgcgctgatcaagaagtacccgaagctggagtccgagttcgtctacggcgactacaaggtctacgacgtgcgcaagatgatcgccaagagcgagcaggagatcggcaaggccaccgcgaagtacttcttctactccaacatcatgaacttcttcaagaccgagatcaccctggccaacggcgagatccgcaagcggcccctgatcgagaccaacggcgagaccggcgagatcgtctgggacaagggccgcgacttcgccaccgtccggaaggtgctgtcgatgccgcaggtcaacatcgtgaagaagaccgaggtgcagaccggcggcttcagcaaggagtccatcctccccaagcgcaacagcgacaagctgatcgcccggaagaaggactgggacccgaagaagtacggcggcttcgacagccccaccgtcgcctactccgtgctggtcgtggcgaaggtcgagaagggcaagagcaagaagctgaagtccgtgaaggagctgctcggcatcaccatcatggagcgctcctcgttcgagaagaacccgatcgacttcctggaggccaagggctacaaggaggtcaagaaggacctcatcatcaagctgcccaagtacagcctgttcgagctggagaacggccgcaagcggatgctcgcctccgcgggcgagctgcagaagggcaacgagctggccctcccgtcgaagtacgtcaacttcctgtacctcgcgtcccactacgagaagctgaagggctcgcccgaggacaacgagcagaagcagctcttcgtggagcagcacaagcactacctggacgagatcatcgagcagatcagcgagttcagcaagcgcgtcatcctggccgacgcgaacctcgacaaggtgctgtccgcctacaacaagcaccgcgacaagccgatccgggagcaggcggagaacatcatccacctgttcaccctcaccaacctgggcgcccccgccgcgttcaagtacttcgacaccaccatcgaccgcaagcggtacacctccaccaaggaggtcctcgacgcgaccctgatccaccagagcatcaccggcctgtacgagacccgcatcgacctgtcccagctcggcggcgactgaggcggcggcggaatgtcggtcctagagcgccaaagggctcacctcaagtacctcaatcccacctttgattctcctctcgccggcttctttgccgattcttcaatgattaccggcggcgagatggacagctatctttcgactgccggtttgaatcttccgatgatgtacggtgagacgacggtggaaggtgattcaagactctcaatttcgccggaaacgacgcttgggactggaaatttcaagaaacggaagtttgatacagagactaaggattgtaatgagaagaagaagaagatgacgatgaacagagatgacctagtagaagaaggagaagaagagaagtcgaaaataacagagcaaaacaatgggagcacaaaaagcatcaagaagatgaaacacaaagccaagaaagaagagaacaatttctctaatgattcatctaaagtgacgaaggaattggagaaaacggattatattcatgttcgtgcacgacgaggccaagccactgatagtcacagcatagcagaacgagttagaagagaaaagatcagtgagagaatgaagtttctacaagatttggttcctggatgcgacaagatcacaggcaaagcagggatgcttgatgaaatcattaactatgttcagtctcttcagagacaaatcgagttcttatcgatgaaactagcaattgtgaatccaaggccggattttgatatggatgacatttttgccaaagaggttgcctcaactccaatgactgtggtgccatctcctgaaatggttctttccggttattctcatgagatggttcactctggttattctagtgagatggttaactccggttaccttcatgtcaatccaatgcagcaagtgaataccagttctgatccattgtcatgcttcaacaatggcgaagctccttcgatgtgggactctcatgtgcagaatctctatggcaatttaggagtttgattaagaaaccaatccacaacataacaatgttccctaattcaaattattcatcggaag

construction of the cry2-HDAC expression plasmid:

using pcDNA3.1(+) as a vector, designing a vector reverse PCR primer and a cry2 primer, and connecting cry2 to an HDAC vector in a homologous recombination manner;

wherein the nucleotide sequence of the-cry 2-HDAC-sequence is SEQ.No. 3;

the nucleotide sequence of the-cry 2-HDAC-sequence is as follows:

ATGCCTAAGAAAAAGAGGAAGGTGAAGATGGACAAAAAGACTATAGTTTGGTTTAGAAGAGACCTAAGGATTGAGGATAATCCTGCATTAGCAGCAGCTGCTCACGAAGGATCTGTTTTTCCTGTCTTCATTTGGTGTCCTGAAGAAGAAGGACAGTTTTATCCTGGAAGAGCTTCAAGATGGTGGATGAAACAATCACTTGCTCACTTATCTCAATCCTTGAAGGCTCTTGGATCTGACCTCACTTTAATCAAAACCCACAACACGATTTCAGCGATCTTGGATTGTATCCGCGTTACCGGTGCTACAAAAGTCGTCTTTAACCACCTCTATGATCCTGTTTCGTTAGTTCGGGACCATACCGTAAAGGAGAAGCTGGTGGAACGTGGGATCTCTGTGCAAAGCTACAATGGAGATCTATTGTATGAACCGTGGGAGATATACTGCGAAAAGGGCAAACCTTTTACGAGTTTCAATTCTTACTGGAAGAAATGCTTAGATATGTCGATTGAATCCGTTATGCTTCCTCCTCCTTGGCGGTTGATGCCAATAACTGCAGCGGCTGAAGCGATTTGGGCGTGTTCGATTGAAGAACTAGGGCTGGAGAATGAGGCCGAGAAACCGAGCAATGCGTTGTTAACTAGAGCTTGGTCTCCAGGATGGAGCAATGCTGATAAGTTACTAAATGAGTTCATCGAGAAGCAGTTGATAGATTATGCAAAGAACAGCAAGAAAGTTGTTGGGAATTCTACTTCACTACTTTCTCCGTATCTCCATTTCGGGGAAATAAGCGTCAGACACGTTTTCCAGTGTGCCCGGATGAAACAAATTATATGGGCAAGAGATAAGAACAGTGAAGGAGAAGAAAGTGCAGATCTTTTTCTTAGGGGAATCGGTTTAAGAGAGTATTCTCGGTATATATGTTTCAACTTCCCGTTTACTCACGAGCAATCGTTGTTGAGTCATCTTCGGTTTTTCCCTTGGGATGCTGATGTTGATAAGTTCAAGGCCTGGAGACAAGGCAGGACCGGTTATCCGTTGGTGGATGCCGGAATGAGAGAGCTTTGGGCTACCGGATGGATGCATAACAGAATAAGAGTGATTGTTTCAAGCTTTGCTGTGAAGTTTCTTCTCCTTCCATGGAAATGGGGAATGAAGTATTTCTGGGATACACTTTTGGATGCTGATTTGGAATGTGACATCCTTGGCTGGCAGTATATCTCTGGGAGTATCCCCGATGGCCACGAGCTTGATCGCTTGGACAATCCCGCGTTACAAGGCGCCAAATATGACCCAGAAGGTGAGTACATAAGGCAATGGCTTCCCGAGCTTGCGAGATTGCCAACTGAATGGATCCATCATCCATGGGACGCTCCTTTAACCGTACTCAAAGCTTCTGGTGTGGAACTCGGAACAAACTATGCGAAACCCATTGTAGACATCGACACAGCTCGTGAGCTACTAGCTAAAGCTATTTCAAGAACCCGTGAAGCACAGATCATGATCGGAGCAGCAGCAGGAGGAGGTGGAAGCGGAGGAGGAGGTAGCgccaagaccgtggcgtatttctacgaccccgatgtgggcaacttccactatggagctggacacccaatgaaacctcatcgcctggcattgactcatagcctagtcctgcattatggtctctataagaagatgatcgtcttcaagccttaccaggcctcccagcatgacatgtgccgcttccattctgaggactacatcgacttcctgcagagagtcagccccaccaatatgcagggtttcaccaagagccttaatgccttcaacgtgggtgatgactgcccagtgtttccaggacttttcgagttctgctcccgttacacaggcgcatctctgcaaggagcaacacagctaaacaacaagatctgtgatattgccatcaactgggccggtggtctacatcatgccaagaaatttgaggcctctggcttctgctatgtcaatgacatagtaattggtatcctggagctgcttaagtaccaccctcgggtgctctacattgatatcgacatccaccatggtgacggggttcaggaagccttctacctcactgaccgggtcatgactgtgtccttccacaaatacggaaattacttctttcctggaacaggtgacatgtatgaagttggagcagagagtggccgctactattgtctcaatgtgcccttacgagatggcattgatgaccagagttacaagcaccttttccagccagtcatcagccaggtggtggacttctaccagccgacgtgcatcgtgctccagtgtggcgctgactccctgggctgtgatcgattaggctgcttcaatctcagcattcgaggacatggggaatgtgttgaatatgtcaagagtttcaatatccctctcctggtactgggaggtggtggctacactgtccgaaatgttgcccggtgttggacatatgaaacatctctgctggtagaagaggccattagtgaggaacttccctatagtgaatacttcgagtactttgccccagatttcacactccatccagatgtcagcacccgcatcgagaatcagaactcacgccagtatctggaccagatccgccagacaatctttgaaaacttgaagatgctgaaccatgcacccagtgtccagattcatgatgtcccggcagacctcctgacgtatgacaggactgacgaggccgacgctgaagagagaggtcccgaggagaactacagcaggccagaagcacccaatgagttctatgatggcgaccatgacaacgacaaggaaagtgatgtggagatttag

fourth, cell culture and cell transfection:

and (3) building a light-operated platform, and performing illumination treatment on the cells to realize the light-operated transcription inhibition of the target gene.

Step four, the construction of the light-operated platform is as follows:

the light control platform consists of a blue light LED array and is powered by an external power supply; the LED working mode is as follows: continuous and pulse, the luminous intensity is controlled by the power;

the conditions of the light treatment are as follows: the illumination condition is 488nm of blue light, the frequency is 1Hz, the power is 0.75w, and the illumination is carried out for 0-25 hours.

The method for using the light-operated gene transcription inhibiting system comprises the following steps:

the application method at the cell level comprises the following steps: transfection of sgRNA plasmid, dCas9-cib1 expression plasmid, cry2-HDAC expression plasmid: cells were plated one day in 12-well plates one day in advance, and 1.2ug of DNA, 4ul of transfection reagent were diluted with 25ul of serum-free medium, respectively; standing at room temperature for 5 min; adding the transfection reagent diluent into the DNA diluent, fully and uniformly mixing, and standing for 15min at room temperature; adding the transfection complex to a culture vessel containing cells and complete medium, and replacing the medium after culturing for 4-6 hours;

the method is characterized in that after the materials are cultured for 24 hours in a light-shielding manner, different illumination conditions of 488nm, frequency of 0.01-1 Hz and power of 0.75w are provided for illumination for 0-24 hours, and the method is used.

A method for repressing transcription of a photocontrol gene using a photocontrol gene transcription repression system, comprising: according to the method, a CRISPR system is utilized, through sgRNA targeting, the spontaneous aggregation property of photoresponsive proteins (CRY2 and CIBN) under the action of 488nm blue light, deacetylases (HDACs) are targeted to specific cell VEGF under the action of the blue light, the transcription of the cells is regulated, and the optically-controlled gene transcription inhibition is realized.

A method of photoregulating protein degradation using a photoproteolytic system, comprising: the method utilizes sgRNA in a CRISPR system to target a target gene, and realizes the light-operated gene transcription inhibition by introducing a light-operated gene transcription inhibition system and driving HDAC to indirectly act on the target gene through the interaction of light-operated cib1 and cry2 under different illumination conditions.

Example 1

Construction of gene-targeted sgRNA plasmid expression vector: the design of guidearna targeting VEGF factor is taken as an example:

the sgRNA expression vector has a construction sequence of SEQ.No.1, which is specifically as follows:

gcgctccccaccggcccgtg

(1) firstly, determining a 20bpVEGF target sequence (the genome sequence should be 20bp + NGG);

(2) since the initial base needed for transcription of U6humanpromoter is G, if the first 20bp is G, the part is skipped; adding a G outside the 20bp forehead to form a G +20bp sequence;

(3) adding caccg before 20bp or G +20bp 5' to form a cacc-G +20bp sequence which is a Forward sequence (directly synthesized by the company);

(4) reverse complementation is carried out on 20bp or G +20bp, aaac is added before 5', and the sequence is a Reverse sequence (directly synthesized by the company);

(5) annealing the forward and reverse bases (with the molar concentration of 100 mu M) of the synthesized sgRNA to enable the sgRNA to base pair and form a double-stranded structure;

(6) carrying out enzyme digestion on the linearized pmU6-sgRNA plasmid, and recovering the vector after enzyme digestion;

(7) diluting the sgRNA base subjected to annealing pairing by ultrapure water according to a ratio of 1:200, and connecting the sgRNA base with the recovered carrier;

(8) transforming the ligation product, and plating an ampicillin resistance solid culture plate;

(9) and (3) selecting a monoclonal colony, extracting a plasmid after amplification culture, sequencing the connection vector by using a universal primer of humanU6, and detecting whether the sgRNA base fragment is correctly inserted into the plasmid.

Example 2

The interaction efficiency of the interaction between the light control protein cib1 and cry2 is verified, and 293T cells are taken as an example:

cell transfection experiments were performed on cib1-GEP expression plasmid with a fluorescent tag, cry2-mcherry plasmid: cells were plated one day in advance in confocal dishes and 1ug of DNA, 2ul of transfection reagent were diluted with 50ul of serum-free medium, respectively. Standing at room temperature for 5 min; adding the transfection reagent diluent into the DNA diluent, fully and uniformly mixing, and standing for 15min at room temperature; adding the transfection compound to a culture container containing cells and a complete culture medium, replacing the culture medium after culturing for 4-6 hours, culturing and expressing for 48 hours, and observing the interaction of the photoproteins in real time under the action of 488nm laser by using a confocal microscope. The results are shown in FIG. 1 and show that cib1 with a green fluorescent label and cry2 with a red fluorescent label can fuse under the action of light after the introduction of 488nm blue light.

Example 3:

(1) the sgRNA, dCas9-cib1, cry2-HDAC plasmid expression vector was subjected to cell transfection experiments: cells were plated one day in 12-well plates and 1.2ug of DNA, 4ul of transfection reagent were diluted with 25ul of serum-free medium, respectively. Standing at room temperature for 5 min; adding the transfection reagent diluent into the DNA diluent, fully and uniformly mixing, and standing for 15min at room temperature; adding the transfection complex to a culture container containing cells and complete culture medium, replacing the culture medium after culturing for 4-6 hours, and continuing culturing for 24-48 hours.

(2) Setting a control group (only transfecting dCas9-cib1 and cry2-HDAC plasmid expression vectors) and an experimental group (transfecting sgRNA, dCas9-cib1 and cry2-HDAC plasmids) to respectively set a dark group and an illumination group, and after the illumination group illuminates for 24 hours according to 488nm, frequency of 1Hz and power of 0.75w, verifying the VEGF gene expression inhibition condition at the mRNA level by utilizing qPCR. The results of the experiment are shown in FIG. 2, and are obtained by analyzing the expression amount: the blank group, the control group and the dark group have higher VEGF expression level, and the illumination group has lower VEGF expression level, which indicates that the target gene expression is inhibited.

(3) Setting a control group (only transfected dCas9-cib1 and cry2-HDAC plasmid expression vector) and an experimental group (transfected sgRNA, dCas9-cib1 and cry2-HDAC plasmid) respectively setting a dark group and an illumination group, and after the illumination group illuminates for 24 hours according to 488nm, the frequency of 1Hz and the power of 0.75w, verifying the VEGF gene expression inhibition condition at a protein level by using western-blot. The results of the experiment are shown in FIG. 3, and are obtained by analyzing the expression amount: the blank group, the control group and the dark group have higher VEGF expression level, and the illumination group has lower VEGF expression level, which indicates that the target gene expression is inhibited.

Example 4:

(1) the sgRNA, dCas9-cib1, cry2-HDAC plasmid expression vector was subjected to cell transfection experiments: cells were plated one day in 12-well plates and 1.2ug of DNA, 4ul of transfection reagent were diluted with 25ul of serum-free medium, respectively. Standing at room temperature for 5 min; adding the transfection reagent diluent into the DNA diluent, fully and uniformly mixing, and standing for 15min at room temperature; adding the transfection complex to a culture container containing cells and complete culture medium, replacing the culture medium after culturing for 4-6 hours, and continuing culturing for 24-48 hours.

(2) Setting a control group (only transfecting dCas9-cib1, cry2-HDAC plasmid expression vector, I and III in the figure four) and an experimental group (transfecting sgRNA, dCas9-cib1, cry2-HDAC plasmid, II and IV in the figure four) respectively setting a dark group and a light group, and using qPCR to verify the VEGF gene expression inhibition condition at the mRNA level after the light group irradiates for 48 hours according to 488nm, frequency of 1Hz and power of 0.75 w. The experimental result analyzes the expression quantity to obtain: the blank group, the control group and the dark group have higher VEGF expression level, and the illumination group has lower VEGF expression level, which indicates that the target gene expression is inhibited.

(3) Setting a control group (only transfecting dCas9-cib1, cry2-HDAC plasmid expression vector, I and III in the figure four) and an experimental group (transfecting sgRNA, dCas9-cib1, cry2-HDAC plasmid, II and IV in the figure four) respectively setting a dark group and an illumination group, and using a western-blot to verify the VEGF gene expression inhibition condition at a protein level after 48 hours of illumination according to 488nm, frequency of 1Hz and power of 0.75w in the illumination group. Results analysis of expression yields: the blank group, the control group and the dark group have higher VEGF expression level, and the illumination group has lower VEGF expression level, which indicates that the target gene expression is inhibited.

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the disclosure of the embodiments and the accompanying drawings.

Sequence listing

<110> Tianjin university

<120> light-operated gene transcription inhibition system and inhibition and construction method

<160> 3

<170> SIPOSequenceListing 1.0

<210> 4

<211> 20

<212> DNA

<213> mouse (Mus musculus)

<400> 4

gcgctcccca ccggcccgtg 20

<210> 5

<211> 5138

<212> DNA

<213> mouse (Mus musculus)

<400> 5

atggacaaga agtactccat cggcctcgcg atcggcacca actccgtggg ctgggcggtc 60

atcaccgacg agtacaaggt cccctccaag aagttcaagg tcctgggcaa caccgaccgg 120

cactcgatca agaagaacct gatcggcgcc ctgctcttcg acagcggcga gaccgccgag 180

gcgacccgcc tgaagcggac cgcgcgtcgc cgctacaccc ggcgcaagaa ccgcatctgc 240

tacctgcagg aaatcttctc caacgagatg gccaaggtgg acgactcgtt cttccaccgc 300

ctggaggaga gcttcctggt ggaggaggac aagaagcacg agcgccaccc gatcttcggc 360

aacatcgtgg acgaggtggc ctaccacgag aagtacccca ccatctacca cctccgcaag 420

aagctggtgg actcgaccga caaggcggac ctgcggctca tctacctggc cctcgcgcac 480

atgatcaagt tccgcggcca cttcctcatc gagggcgacc tgaacccgga caactccgac 540

gtggacaagc tcttctccag ctggtgcaga cctacaacca gctgttcgag gagaacccca 600

tcaacgccag cggcgtggac gccaaggcga tcctctccgc gcgcctgagc aagtcccggc 660

gcctggagaa cctcatcgcc cagctgccgg gcgagaagaa gaacggcctc ttcggcaacc 720

tgatcgcgct gtcgctcggc ctgaccccca acttcaagag caacttcgac ctggccgagg 780

acgcgaagct ccagctgtcc aaggacacct acgacgacga cctggacaac ctgctcgccc 840

agatcggcga ccagtacgcg gacctcttcc tggccgcgaa gaacctctcg gacgccatcc 900

tgctcagcga catcctgcgg gtcaacaccg agatcaccaa ggccccgctg tcggcgagca 960

tgatcaagcg gtacgacgag caccaccagg acctgaccct gctcaaggcc ctcgtgcgcc 1020

agcagctgcc cgagaagtac aaggaaatct tcttcgacca gtccaagaac ggctacgccg 1080

gctacatcga cggcggcgcg tcgcaggagg agttctacaa gttcatcaag ccgatcctgg 1140

agaagatgga cggcaccgag gagctgctcg tcaagctgaa ccgcgaggac ctgctccgca 1200

agcagcggac cttcgacaac ggctccatcc cgcaccagat ccacctgggc gagctccacg 1260

ccatcctccg gcgccaggag gacttctacc ccttcctgaa ggacaaccgc gagaagatcg 1320

agaagatcct gaccttccgc atcccgtact acgtcggccc cctggcccgc ggcaactccc 1380

ggttcgcgtg gatgacccgg aagtcggagg agaccatcac cccgtggaac ttcgaggagg 1440

tcgtggacaa gggcgcgtcc gcgcagtcgt tcatcgagcg catgaccaac ttcgacaaga 1500

acctcccgaa cgagaaggtc ctgcccaagc actccctgct ctacgagtac ttcaccgtgt 1560

acaacgagct gaccaaggtc aagtacgtga ccgagggcat gcggaagccg gccttcctgt 1620

cgggcgagca gaagaaggcg atcgtggacc tgctcttcaa gaccaaccgc aaggtcaccg 1680

tgaagcagct gaaggaggac tacttcaaga agatcgagtg cttcgactcc gtcgagatca 1740

gcggcgtgga ggaccgcttc aacgcctccc tgggcaccta ccacgacctg ctcaagatca 1800

tcaaggacaa ggacttcctc gacaacgagg agaacgagga catcctggag gacatcgtcc 1860

tcaccctgac cctcttcgag gaccgcgaga tgatcgagga gcggctcaag acctacgccc 1920

acctgttcga cgacaaggtg atgaagcagc tgaagcgtcg ccgctacacc ggctggggcc 1980

gcctctcccg gaagctgatc aacggcatcc gggacaagca gagcggcaag accatcctgg 2040

acttcctcaa gtccgacggc ttcgccaacc gcaacttcat gcagctcatc cacgacgaca 2100

gcctgacctt caaggaggac atccagaagg cccaggtctc gggccagggc gacagcctcc 2160

acgagcacat cgccaacctg gcgggctccc cggcgatcaa gaagggcatc ctccagaccg 2220

tcaaggtcgt ggacgagctg gtcaaggtga tgggccgcca caagcccgag aacatcgtga 2280

tcgagatggc ccgggagaac cagaccaccc agaagggcca gaagaactcg cgcgagcgga 2340

tgaagcggat cgaggagggc atcaaggagc tcggcagcca gatcctgaag gagcacccgg 2400

tcgagaacac ccagctgcag aacgagaagc tgtacctcta ctacctgcag aacggccgcg 2460

acatgtacgt ggaccaggag ctcgacatca accggctgtc cgactacgac gtggacgcga 2520

tcgtgccgca gtccttcctg aaggacgact cgatcgacaa caaggtcctg acccgctcgg 2580

acaagaaccg gggcaagtcc gacaacgtgc cctcggagga ggtcgtgaag aagatgaaga 2640

actactggcg ccagctgctc aacgccaagc tcatcaccca gcgcaagttc gacaacctga 2700

ccaaggccga gcggggcggc ctgagcgagc tcgacaaggc gggcttcatc aagcgccagc 2760

tggtcgagac ccggcagatc accaagcacg tggcccagat cctggactcc cggatgaaca 2820

ccaagtacga cgagaacgac aagctgatcc gcgaggtcaa ggtgatcacc ctcaagagca 2880

agctggtctc cgacttccgc aaggacttcc agttctacaa ggtccgggag atcaacaact 2940

accaccacgc ccacgacgcg tacctgaacg ccgtcgtggg caccgcgctg atcaagaagt 3000

acccgaagct ggagtccgag ttcgtctacg gcgactacaa ggtctacgac gtgcgcaaga 3060

tgatcgccaa gagcgagcag gagatcggca aggccaccgc gaagtacttc ttctactcca 3120

acatcatgaa cttcttcaag accgagatca ccctggccaa cggcgagatc cgcaagcggc 3180

ccctgatcga gaccaacggc gagaccggcg agatcgtctg ggacaagggc cgcgacttcg 3240

ccaccgtccg gaaggtgctg tcgatgccgc aggtcaacat cgtgaagaag accgaggtgc 3300

agaccggcgg cttcagcaag gagtccatcc tccccaagcg caacagcgac aagctgatcg 3360

cccggaagaa ggactgggac ccgaagaagt acggcggctt cgacagcccc accgtcgcct 3420

actccgtgct ggtcgtggcg aaggtcgaga agggcaagag caagaagctg aagtccgtga 3480

aggagctgct cggcatcacc atcatggagc gctcctcgtt cgagaagaac ccgatcgact 3540

tcctggaggc caagggctac aaggaggtca agaaggacct catcatcaag ctgcccaagt 3600

acagcctgtt cgagctggag aacggccgca agcggatgct cgcctccgcg ggcgagctgc 3660

agaagggcaa cgagctggcc ctcccgtcga agtacgtcaa cttcctgtac ctcgcgtccc 3720

actacgagaa gctgaagggc tcgcccgagg acaacgagca gaagcagctc ttcgtggagc 3780

agcacaagca ctacctggac gagatcatcg agcagatcag cgagttcagc aagcgcgtca 3840

tcctggccga cgcgaacctc gacaaggtgc tgtccgccta caacaagcac cgcgacaagc 3900

cgatccggga gcaggcggag aacatcatcc acctgttcac cctcaccaac ctgggcgccc 3960

ccgccgcgtt caagtacttc gacaccacca tcgaccgcaa gcggtacacc tccaccaagg 4020

aggtcctcga cgcgaccctg atccaccaga gcatcaccgg cctgtacgag acccgcatcg 4080

acctgtccca gctcggcggc gactgaggcg gcggcggaat gtcggtccta gagcgccaaa 4140

gggctcacct caagtacctc aatcccacct ttgattctcc tctcgccggc ttctttgccg 4200

attcttcaat gattaccggc ggcgagatgg acagctatct ttcgactgcc ggtttgaatc 4260

ttccgatgat gtacggtgag acgacggtgg aaggtgattc aagactctca atttcgccgg 4320

aaacgacgct tgggactgga aatttcaaga aacggaagtt tgatacagag actaaggatt 4380

gtaatgagaa gaagaagaag atgacgatga acagagatga cctagtagaa gaaggagaag 4440

aagagaagtc gaaaataaca gagcaaaaca atgggagcac aaaaagcatc aagaagatga 4500

aacacaaagc caagaaagaa gagaacaatt tctctaatga ttcatctaaa gtgacgaagg 4560

aattggagaa aacggattat attcatgttc gtgcacgacg aggccaagcc actgatagtc 4620

acagcatagc agaacgagtt agaagagaaa agatcagtga gagaatgaag tttctacaag 4680

atttggttcc tggatgcgac aagatcacag gcaaagcagg gatgcttgat gaaatcatta 4740

actatgttca gtctcttcag agacaaatcg agttcttatc gatgaaacta gcaattgtga 4800

atccaaggcc ggattttgat atggatgaca tttttgccaa agaggttgcc tcaactccaa 4860

tgactgtggt gccatctcct gaaatggttc tttccggtta ttctcatgag atggttcact 4920

ctggttattc tagtgagatg gttaactccg gttaccttca tgtcaatcca atgcagcaag 4980

tgaataccag ttctgatcca ttgtcatgct tcaacaatgg cgaagctcct tcgatgtggg 5040

actctcatgt gcagaatctc tatggcaatt taggagtttg attaagaaac caatccacaa 5100

cataacaatg ttccctaatt caaattattc atcggaag 5138

<210> 6

<211> 2832

<212> DNA

<213> mouse (Mus musculus)

<400> 6

atgcctaaga aaaagaggaa ggtgaagatg gacaaaaaga ctatagtttg gtttagaaga 60

gacctaagga ttgaggataa tcctgcatta gcagcagctg ctcacgaagg atctgttttt 120

cctgtcttca tttggtgtcc tgaagaagaa ggacagtttt atcctggaag agcttcaaga 180

tggtggatga aacaatcact tgctcactta tctcaatcct tgaaggctct tggatctgac 240

ctcactttaa tcaaaaccca caacacgatt tcagcgatct tggattgtat ccgcgttacc 300

ggtgctacaa aagtcgtctt taaccacctc tatgatcctg tttcgttagt tcgggaccat 360

accgtaaagg agaagctggt ggaacgtggg atctctgtgc aaagctacaa tggagatcta 420

ttgtatgaac cgtgggagat atactgcgaa aagggcaaac cttttacgag tttcaattct 480

tactggaaga aatgcttaga tatgtcgatt gaatccgtta tgcttcctcc tccttggcgg 540

ttgatgccaa taactgcagc ggctgaagcg atttgggcgt gttcgattga agaactaggg 600

ctggagaatg aggccgagaa accgagcaat gcgttgttaa ctagagcttg gtctccagga 660

tggagcaatg ctgataagtt actaaatgag ttcatcgaga agcagttgat agattatgca 720

aagaacagca agaaagttgt tgggaattct acttcactac tttctccgta tctccatttc 780

ggggaaataa gcgtcagaca cgttttccag tgtgcccgga tgaaacaaat tatatgggca 840

agagataaga acagtgaagg agaagaaagt gcagatcttt ttcttagggg aatcggttta 900

agagagtatt ctcggtatat atgtttcaac ttcccgttta ctcacgagca atcgttgttg 960

agtcatcttc ggtttttccc ttgggatgct gatgttgata agttcaaggc ctggagacaa 1020

ggcaggaccg gttatccgtt ggtggatgcc ggaatgagag agctttgggc taccggatgg 1080

atgcataaca gaataagagt gattgtttca agctttgctg tgaagtttct tctccttcca 1140

tggaaatggg gaatgaagta tttctgggat acacttttgg atgctgattt ggaatgtgac 1200

atccttggct ggcagtatat ctctgggagt atccccgatg gccacgagct tgatcgcttg 1260

gacaatcccg cgttacaagg cgccaaatat gacccagaag gtgagtacat aaggcaatgg 1320

cttcccgagc ttgcgagatt gccaactgaa tggatccatc atccatggga cgctccttta 1380

accgtactca aagcttctgg tgtggaactc ggaacaaact atgcgaaacc cattgtagac 1440

atcgacacag ctcgtgagct actagctaaa gctatttcaa gaacccgtga agcacagatc 1500

atgatcggag cagcagcagg aggaggtgga agcggaggag gaggtagcgc caagaccgtg 1560

gcgtatttct acgaccccga tgtgggcaac ttccactatg gagctggaca cccaatgaaa 1620

cctcatcgcc tggcattgac tcatagccta gtcctgcatt atggtctcta taagaagatg 1680

atcgtcttca agccttacca ggcctcccag catgacatgt gccgcttcca ttctgaggac 1740

tacatcgact tcctgcagag agtcagcccc accaatatgc agggtttcac caagagcctt 1800

aatgccttca acgtgggtga tgactgccca gtgtttccag gacttttcga gttctgctcc 1860

cgttacacag gcgcatctct gcaaggagca acacagctaa acaacaagat ctgtgatatt 1920

gccatcaact gggccggtgg tctacatcat gccaagaaat ttgaggcctc tggcttctgc 1980

tatgtcaatg acatagtaat tggtatcctg gagctgctta agtaccaccc tcgggtgctc 2040

tacattgata tcgacatcca ccatggtgac ggggttcagg aagccttcta cctcactgac 2100

cgggtcatga ctgtgtcctt ccacaaatac ggaaattact tctttcctgg aacaggtgac 2160

atgtatgaag ttggagcaga gagtggccgc tactattgtc tcaatgtgcc cttacgagat 2220

ggcattgatg accagagtta caagcacctt ttccagccag tcatcagcca ggtggtggac 2280

ttctaccagc cgacgtgcat cgtgctccag tgtggcgctg actccctggg ctgtgatcga 2340

ttaggctgct tcaatctcag cattcgagga catggggaat gtgttgaata tgtcaagagt 2400

ttcaatatcc ctctcctggt actgggaggt ggtggctaca ctgtccgaaa tgttgcccgg 2460

tgttggacat atgaaacatc tctgctggta gaagaggcca ttagtgagga acttccctat 2520

agtgaatact tcgagtactt tgccccagat ttcacactcc atccagatgt cagcacccgc 2580

atcgagaatc agaactcacg ccagtatctg gaccagatcc gccagacaat ctttgaaaac 2640

ttgaagatgc tgaaccatgc acccagtgtc cagattcatg atgtcccggc agacctcctg 2700

acgtatgaca ggactgacga ggccgacgct gaagagagag gtcccgagga gaactacagc 2760

aggccagaag cacccaatga gttctatgat ggcgaccatg acaacgacaa ggaaagtgat 2820

gtggagattt ag 2832

Claims (6)

1. A light-operated gene transcription repression system characterized by: the system comprises sgRNA, dCas9-cib1, cry2-HDAC plasmid expression vector;

the sgRNA is a targeting part of a gene suppression system, different sgRNAs are designed to have specific targeting, and dCas9 enzyme can be recruited;

the cib1 and cry2 are blue light dependent photoresponse proteins, and generate photoresponse interaction under the regulation and control of 488nm blue light;

said HDAC is a class of proteases;

under the action of blue light, HDAC is combined to a target gene locus, histone is deacetylated, the histone is tightly combined with DNA with negative charge, chromatin is tightly coiled, and the transcription of genes is inhibited.

2. The method for constructing a system for suppressing optically controlled gene transcription as claimed in claim 1, which comprises the following steps:

constructing a gene targeting sgRNA plasmid expression vector:

pmU6-gRNA is used as a vector, a pair of primers is designed according to the sgRNA, digestion linearization pmU6-sgRNA plasmid is used, the digested vector is recovered, and the sgRNA base after annealing pairing is connected with the recovered vector;

wherein the nucleotide sequence of the sgRNA sequence is SEQ.No. 1;

constructing an expression plasmid dCas9-cib 1:

using pcDNA3.1(+) as a vector, designing a vector reverse PCR primer and an cib1 primer, and connecting cib1 to a dCas9 vector in a homologous recombination manner;

wherein the amino acid sequence of the-dCas 9-cib 1-sequence is SEQ.No. 2;

construction of the cry2-HDAC expression plasmid:

using pcDNA3.1(+) as a vector, designing a vector reverse PCR primer and a cry2 primer, and connecting cry2 to an HDAC vector in a homologous recombination manner;

wherein the amino acid sequence of said-cry 2-HDAC-sequence is SEQ.No. 3;

fourth, cell culture and cell transfection:

and (3) building a light-operated platform, and performing illumination treatment on the cells to realize the light-operated transcription inhibition of the target gene.

3. The method of constructing a system for suppressing optically controlled gene transcription as claimed in claim 2, wherein: step four, the construction of the light-operated platform is as follows:

the light control platform consists of a blue light LED array and is powered by an external power supply;

the LED working mode is as follows: continuous, pulsed, light emitting;

the intensity is controlled by the power supply;

the conditions of the light treatment are as follows: the illumination condition is 488nm of blue light, the frequency is 1Hz, the power is 0.75w, and the illumination is carried out for 0-25 hours.

4. The method of using a system for the suppression of phototropic gene transcription according to claim 1, comprising: the method comprises the following steps:

the application method at the cell level comprises the following steps: transfection of sgRNA plasmid, dCas9-cib1 expression plasmid, cry2-HDAC expression plasmid: cells were plated one day in 12-well plates one day in advance, and 1.2ug of DNA, 4ul of transfection reagent were diluted with 25ul of serum-free medium, respectively; standing at room temperature for 5 min; adding the transfection reagent diluent into the DNA diluent, fully and uniformly mixing, and standing for 15min at room temperature; adding the transfection compound to a culture container containing cells and a complete culture medium, and replacing the culture medium after culturing for 4-6 hours;

and after the materials are cultured for 24 hours in a light-shielding manner, different illumination conditions of 488nm, frequency of 0.01-1 Hz, power of 0.75w and illumination of 0-24 hours are provided.

5. A method for suppressing photocontrol gene transcription, comprising: according to the method, a CRISPR system is utilized, through sgRNA targeting, the spontaneous aggregation property of photoresponsive proteins (CRY2 and CIBN) under the action of 488nm blue light, deacetylases (HDACs) are targeted to specific cell VEGF under the action of the blue light, the transcription of the cells is regulated, and the optically-controlled gene transcription inhibition is realized.

6. A method for suppressing photocontrol gene transcription, comprising: the method utilizes sgRNA in a CRISPR system to target a target gene, and realizes the light-operated gene transcription inhibition by introducing a light-operated gene transcription inhibition system and driving HDAC to indirectly act on the target gene through the interaction of light-operated cib1 and cry2 under different illumination conditions.