CN111100873B - Method for activating RNA (ribonucleic acid) regulated promoter to overcome transgenic silencing effect - Google Patents

Abstract

The invention discloses a method for activating an RNA (ribonucleic acid) regulation promoter to overcome a transgenic silencing effect, which comprises the steps of selecting a promoter which does not contain an enhancer and has a CpG island at a transcription initiation site as a target promoter, inserting a UCOE (complementary deoxyribonucleic acid) truncation sequence in front of the target promoter through an in-vitro recombination technology, inserting a shRNA (short hairpin ribonucleic acid) gene expression frame for expressing an activation RNA (ribonucleic acid) gene targeted to the target promoter at the downstream of the target promoter, constructing a final vector, and enabling the expression quantity of the EGFP (enhanced green fluorescent protein) gene in the expression frame of the target promoter to be continuously, stably and efficiently expressed by the final vector so; the method can be applied to the field of industrial production of antibodies and protein drugs or gene therapy, improves the production efficiency, reduces the production cost and has good social benefit and economic benefit.

Description

Method for activating RNA (ribonucleic acid) regulated promoter to overcome transgenic silencing effect

Technical Field

The invention belongs to the technical field of biology, relates to an expression vector for recombinant antibody or protein drug production and the like and a construction method thereof, and particularly relates to a method for overcoming a transgenic silencing effect by using an activated RNA (ribonucleic acid) regulated promoter.

Background

Recombinant antibody and protein drugs are specific drugs that have been clinically used in recent years, but their wide application is limited due to their expensive price. The low production efficiency remains an important factor in the cost profile of recombinant antibody and protein pharmaceuticals. In the complicated production link of recombinant antibody and protein medicine, whether the vector can be expressed efficiently or not is one of the key technical factors influencing the production efficiency. Although there are many solutions to high efficiency expression vectors, a central problem remains to overcome positional and silencing effects in transgene expression. Host cells transformed with foreign genes require sustained stable expression over tens of days or even longer production cycles in bioreactors, and silencing effector mechanisms often lead to premature suppression of vectors that are transferred to expression in the cells, thus achieving sustained and efficient production of transgenes in mammalian cells remains a major technical problem for genetically engineered cell production.

Transgene silencing effects are mainly related to factors such as chromatin remodeling, histone modification and DNA methylation. The position effect is often a serious silencing effect because when a recombinant gene is improperly inserted near an allochromosome, the inserted exogenous sequence is repackaged by the chromosome-forming machinery and assembles into a highly concentrated nucleosome, thereby inhibiting its transcription.

There are many methods for overcoming the silencing effect of transgenes, but the effect is not the same, and the standard is far from being formed in the industry. Ubiquitous Chromatin Opening Elements (UCOEs) can form open chromatin on promoters. Open chromatin is usually in a disaggregated state on the cellular structure, is located in the interphase nucleus center, replicates early in the cell cycle, is highly acetylated to histones, and is usually unmethylated in the CpG dinucleotides associated with DNA. Open chromatin on the promoter is regulated by specific regulatory elements, mainly comprising two kinds of regulatory elements, including genetic regulatory elements capable of establishing and maintaining transcription-specific open chromatin structure and performing tissue-specific or ubiquitous gene expression mode; and insulators (insulators) or barrier elements (Antoniou, et al,2003) that form open chromatin boundaries by physical barriers. Genetic control elements that have been established and maintained to establish and maintain a transcription-specific open chromatin structure are Ubiquitous Chromatin Opening Elements (UCOEs) (Antoniou, et al, 2003).

In mammalian cell expression vectors, regulatory sequences, such as UCOE, S/MAR and the like, are added near a promoter to intervene in the apparent modification near the promoter and overcome the silencing effect of transgenes. However, the up-regulation capacity of the expression quantity induced by the action exerted by these regulatory sequences is limited, and the production requirement cannot be met, and the regulation effect is different for different promoters, so that the final effect is unstable or uncontrollable, and the production application is influenced.

Activating RNA is an RNA regulatory method distinct from RNA interference (RNAi). RNA activation is achieved by targeting the promoter of a gene with double-stranded RNA, which in turn increases gene expression by affecting transcriptional or epigenetic regulatory mechanisms, and such small RNAs that activate the gene promoter are called small activating RNAs (sarnas). The phenomenon of chromatin remodeling occurs in the region of the small activating RNA-targeted promoter. The RNA activation can form a continuous open state of an integrated gene promoter region, thereby being beneficial to overcoming the silencing effect of the transgene by the exogenous gene and obtaining continuous and stable expression.

Although the UCOE sequence and the small activating RNA can enable the promoter region regulated by the UCOE sequence and the small activating RNA to form open chromatin when acting independently so as to activate the expression of genes downstream of the promoter, the effect of the UCOE sequence and the small activating RNA when acting independently is limited, and the related technology that the UCOE sequence and the small activating RNA act on the same promoter together to overcome the silencing effect of transgenes is not reported.

Disclosure of Invention

The technical problem to be solved by the invention is to provide a method for overcoming the transgenic silencing effect by using an activated RNA regulation promoter aiming at the problem of low expression efficiency of the existing recombinant antibody and protein expression vector, so as to construct a vector with continuous, stable and efficient expression, meet the industrial production and popularization and use and reduce the cost of recombinant antibody and protein drugs.

In order to solve the technical problems, the method for activating an RNA regulatory promoter to overcome the transgenic silencing effect comprises the following steps:

(1) selecting a promoter which does not contain an enhancer and has a CpG island in a transcription initiation site as a target promoter, and replacing a CMV promoter in an exogenous gene expression frame on a commercial vector pEGFP-C1 with the target promoter to construct an intermediate vector I;

(2) inserting UCOE truncation sequences into the Ase I enzyme cutting sites at the upstream of the exogenous gene expression frame of the intermediate vector I to construct an intermediate vector II;

(3) inserting a shRNA gene expression frame aiming at the expression activation RNA gene of the target promoter into the downstream of the exogenous gene expression frame of the intermediate vector II to obtain a final vector; the sequence of the shRNA gene expression frame for expressing the activating RNA gene is shown as a sequence 1; the final vector can ensure that the expression quantity of the EGFP gene is continuously, stably and efficiently expressed by verification.

Furthermore, the target promoter is a human SOX2 gene promoter.

Furthermore, in the step of constructing the intermediate vector I, the target promoter sequence is amplified by using a primer with AgeI and AseI double enzyme cutting sites, wherein the primer is as follows:

SOX2 # Forward primer: CCGTGATTAAT(AseI) AGACAAGGAAGGTTTTGAGGAC

SOX2 # reverse primer: ATATGACCGGT(Age I) ATCCGGGCTGTTTTTCTGGTT are provided.

The term "CG content or CpG island" as used herein means that the content of CG (i.e., dinucleotide) in a DNA sequence is not less than 60% of the total base content.

The invention constructs a recombinant vector (final vector) by the interaction of the activating RNA and the UCOE sequence on a specific promoter (promoter which does not contain an enhancer and contains a CpG island at a transcription initiation site, namely the target promoter), the final vector is continuously and stably expressed in a period of more than 32 days after transfection of CHO cells, and the expression quantity is obviously higher than that of a control vector which singly uses the UCOE sequence or singly uses the activating RNA for regulation, thereby proving that the activating RNA and the UCOE have a superposition effect on overcoming the transgenic silencing effect. The method of the invention is applied to the fields of recombinant protein and drug production, genetic engineering, gene therapy and the like, and can greatly reduce the cost.

The invention has the beneficial effects that: the invention utilizes the combined action of the UCOE sequence and the activated small RNA on the target promoter, and can play a role in overcoming the application of the transgenic silencing effect, the final vector obtained by the technical scheme can activate the high-efficiency expression of downstream genes after 32 days, and the expression quantity of the downstream genes is obviously higher than that of the downstream genes which are regulated and controlled by the UCOE alone or the activated small RNA alone in the prior art, and the invention provides a novel method for overcoming the transgenic silencing effect more effectively.

Drawings

FIG. 1 is a schematic representation of the structure of the intermediate vector I pSOX 2;

FIG. 2 is a schematic structural diagram of the intermediate vector II pSOX 2-UCOE;

FIG. 3 is a schematic diagram of the structure of a control vector pSOX2-S278 according to the example;

FIG. 4 is a schematic structural diagram of the final vector pSOX 2-U-S278;

FIG. 5 is a graph showing the expression levels of the recombinant vectors pSOX2, pSOX2-UCOE, pSOX2-S278 and pSOX2-U-S278 in ELISA analysis, compared with the expression level of EGFP protein in the commercial vector pEGFP-C1 (note: the vector with X indicates that when there is a difference between the values of the concentration of EGFP expressed by the vector and the other vectors, P is <0.05, and the statistical difference is significant);

FIG. 6 is a graph showing a comparison of the EGFP gene expression levels of the individual expression vectors pSOX2, pSOX2-UCOE, pSOX2-S278, pSOX2-U-S278 against the commercial vector pEGFP-C1 by qRT-PCR quantitation (note: the vector with P indicates that P <0.05, and the statistical difference indicates that P <0.01 when there is a difference between the relative fold values of EGFP expressed in the vector and the other vectors);

FIG. 7 is a graph showing the results of fluorescence intensity measurements of recombinant vectors pSOX2, pSOX2-UCOE, pSOX2-S278, pSOX2-U-S278 and commercial vector pEGFP-C1 (note: the vector with X indicates that when there is a difference between the mean fluorescence intensity values of the vector and the other vectors, P <0.05, the statistical difference is significant).

Detailed Description

The present invention will be described in further detail with reference to the accompanying drawings and examples.

The method for activating the RNA regulated promoter to overcome the transgenic silencing effect comprises the following steps:

(1) selecting a promoter which does not contain an enhancer and has a CpG island in a transcription initiation site as a target promoter, and replacing a CMV promoter in an exogenous gene expression frame on a commercial vector pEGFP-C1 with the target promoter to construct an intermediate vector I;

(2) inserting UCOE truncation sequences into the Ase I enzyme cutting sites at the upstream of the exogenous gene expression frame of the intermediate vector I to construct an intermediate vector II;

(3) inserting a shRNA gene expression frame aiming at the expression activation RNA gene of the target promoter into the downstream of the exogenous gene expression frame of the intermediate vector II to obtain a final vector; the sequence of the shRNA gene expression frame for expressing the activating RNA gene is shown as a sequence 1; the final vector can ensure that the expression quantity of the EGFP gene is continuously, stably and efficiently expressed by verification.

Furthermore, the target promoter is a human SOX2 gene promoter.

Furthermore, in the step of constructing the intermediate vector I, the target promoter sequence is amplified by using a primer with AgeI and AseI double enzyme cutting sites, wherein the primer is as follows:

SOX2 # Forward primer: CCGTGATTAAT(Ase I) AGACAAGGAAGGTTTTGAGGAC

SOX2 # reverse primer: ATATGACCGGT(Age I) ATCCGGGCTGTTTTTCTGGTT are provided.

The invention provides a method for overcoming the transgenic silencing effect, a final vector is constructed by a specific method, and the expression quantity of the EGFP gene expressed by the final vector is obviously improved compared with the expression quantity of the conventional commercial vector pEGFP-C1; the gene expression quantity is remarkably improved, namely, the final vector is transferred into CHO cells, after the CHO cells are cultured for 32 days, fluorescence intensity analysis, quantitative PCR analysis and ELISA analysis are carried out, and compared with a commercial vector pEGFP-C1, the gene expression quantity of the exogenous EGFP gene is remarkably higher than that of the commercial vector pEGFP-C1, and the gene expression quantity can be continuously and stably expressed for more than 32 days.

Example (b): in the method, a promoter which does not contain an enhancer and contains a CpG island at a transcription initiation site is used as a target promoter, and a human SOX2 gene promoter meets the requirement of the target promoter, and the method for constructing the final vector disclosed by the invention is illustrated by taking the human SOX2 gene promoter as an example:

i, replacing a CMV promoter in an exogenous gene expression frame on a PEGFP-C1 vector by a human SOX2 gene promoter to construct an intermediate vector I

(1) Cloning Using human SOX2 Gene promoter

Amplified by the human SOX2 gene promoter, and amplification primers are as follows:

SOX2 # Forward primer: CCGTGATTAAT(Ase I) AGACAAGGAAGGTTTTGAGGAC

SOX2 # reverse primer: ATATGACCGGT(Age I) ATCCGGGCTGTTTTTCTGGTT

Carrying out PCR amplification by using a high-fidelity TAQ enzyme and a 50-microliter system, wherein the amplification conditions are as follows: 5 minutes at 95 ℃; repeating 25 cycles at 95 ℃ for 30 seconds, 55 ℃ for 30 seconds, and 72 ℃ for 45 seconds; 5 minutes at 72 ℃ and stored at normal temperature. The amplified sequence is a promoter sequence (ENSG 00000181449) which contains an enhancer and has the CG content of more than or equal to 60 percent at the transcription initiation site, and the DNA sequence of the sequence is shown as a sequence 2.

(2) The pEGFP-C1 vector was cut with AgeI and AseI, and the large CMV-free fragment was recovered from the gel

The pEGFP-C1 vector is a commercially available vector with better expression effect at present, and the target promoter is used for connecting the vector by the method of the invention to replace a CMV promoter on the pEGFP-C1 vector to construct an intermediate vector I.

(3) And (2) synchronously carrying out double enzyme digestion on the PCR product of the SOX2 gene promoter obtained in the step (1) by AgeI and AseI after gel recovery.

(4) Connection of

Ligation system (10 μ L): 5 mu L of ligation mixture containing T4 DNA ligase, 0.5 mu L of pEGFP-C1 double-restriction large fragment, 4.5 mu L of double-restriction SOX2 gene promoter PCR product, and reaction conditions: ligation was performed at 16 ℃ for 1h (ligation kit was purchased from Dalian Meiren Biotechnology Ltd.).

(5) Transformation of

Preparing ice cakes in advance, adding 100 mu L of competent cells (in an ice-water mixed state) into the connecting system in the step (4), and carrying out ice bath for 30 minutes; turning to 42 ℃ water bath for 90 seconds; transferring into ice bath for 1-2 min; adding LB culture medium, water bath at 37 ℃ for 45 minutes; the centrifuge rotates at the maximum speed of 1 second, most of the supernatant is discarded, mixed evenly and spread on a culture medium containing IPTG and X-gal, and cultured overnight at 37 ℃.

(6) Screening, extracting plasmid, and testing by biological company

Performing liquid culture (containing kanamycin) on colonies screened by colony PCR at 37 ℃ by using a test tube, performing overnight amplification culture by using a triangular flask, and extracting plasmid DNA by using a plasmid small-amount extraction kit; and after enzyme digestion identification by Ase I, observing the enzyme digestion result by electrophoresis. The positive clone plasmid was sent to the organism company for sequencing to confirm that the SOX2 promoter was correctly replaced, thereby obtaining the recombinant vector pSOX2 (i.e., intermediate vector I). The structure of the device is schematically shown in figure 1.

II, inserting UCOE truncation sequence into the Ase I enzyme cutting site at the upstream of the exogenous gene expression cassette of the pSOX2 vector to construct an intermediate vector II

(1) Artificially synthesized UCOE truncation sequence

The UCOE truncation sequence is from Genebank (accession No.: DM 190414.1).

(2) Vector restriction, namely performing single restriction on the AseI site of the vector pSOX2

Vector restriction (50. mu.L system)

pSOX2 vector: 44 μ L

10×NEB Buffer：3.1 5μL

AseⅠ：1μL

Reaction time: 1h at 37 DEG C

And (3) enzyme digestion vector purification:

a. adding 50 mu L of membrane binding solution into the centrifugal tube of the carrier enzyme digestion system and uniformly mixing;

b. transferring the solution to an adsorption column, and placing the adsorption column in a liquid collecting pipe;

c. the rotating speed of the centrifuge is 13,000 revolutions per minute, and the liquid in the liquid collecting pipe is discarded;

d. adding 700 mul of membrane eluent, centrifuging for 13,000 r/min, and discarding the liquid in the liquid collecting tube;

e. repeating the step d;

f. discarding the liquid in the liquid collecting pipe, and centrifuging for 1 minute;

g. transferring the adsorption column into a 1.5ml centrifuge tube;

h. adding 50 μ l nuclease-free deionized water into the adsorption column, standing at room temperature for 1min, and centrifuging for 1 min; the centrifuged product was collected.

(3) Flattening: subjecting the digested pSOX2 vector to blunt end treatment

The digested pSOX2 plasmid (i.e., pSOX2 vector) was blunt-ended:

mu.l of pSOX2 plasmid, 1. mu.l of 10 Xbuffer, 3. mu.l of sterile water were incubated at 70 ℃ for 5 minutes, 0.5. mu. l T4 DNA polymerase was added, the mixture was gently mixed, reacted at 37 ℃ for 5 minutes, and then ethanol precipitation was performed.

(4) Dephosphorizing: dephosphorizing the product after single enzyme digestion

Dephosphorylation can eliminate the phosphate group protruding from the 5' end, so that the plasmid vector can not form a closed circular structure.

9. mu.g of the blunt pSOX2 vector

Alkaline phosphatase buffer (10X) 15. mu.l

Bacterial alkaline phosphatase (1U/. mu.l) 2. mu.l

Supplementing deionized water without nuclease to 150 mu l, reacting in a water bath kettle at 65 ℃ for 30 minutes, and purifying;

a. adding the membrane binding solution with the same volume as the plasmid or the enzyme digestion product into a centrifuge tube, and uniformly mixing;

b. moving the solution into an adsorption column by using a liquid transfer gun, standing the solution for 3 to 5 minutes at room temperature, and centrifuging the solution for one minute;

c. adding the liquid in the collecting pipe into the adsorption column again, centrifuging for 1 minute again, and removing waste liquid;

d. adding 700ul of membrane eluent, centrifuging for one minute, and removing waste liquid;

e. adding 500ul of membrane eluent, centrifuging for 4 minutes, and removing waste liquid;

f. after the empty column is centrifuged for one minute, the adsorption column is moved into a new centrifugal tube;

g. adding 50ul of nuclease-free deionized water on the central membrane of the column, standing at room temperature for 3-5min, centrifuging for 1min, adding the liquid in the collecting tube into the adsorption column, centrifuging again, and storing the product at 4 ℃.

(5) Ligation the UCOE truncation was ligated to the dephosphorylated nickase fragment of step (4) in the same manner as described for ligation of vector pSOX 2.

(6) And (3) transformation: the same procedure as described above for transformation with vector pSOX 2.

(7) Screening, plasmid extraction, detection by Biometrics

By using the same method as the vector pSOX2, plasmid DNA is extracted through colony PCR screening, after enzyme digestion identification by Ase I, the enzyme digestion result is observed through electrophoresis, the positive clone plasmid is sent to a biological company for sequencing, and the replacement of a UCOE truncation sequence is confirmed to be correct, so that an intermediate vector II, named as pSOX2-UCOE, is obtained, and the structural schematic diagram of the intermediate vector II is shown in figure 2.

III, construction of the final vector

(1) Inserting shRNA gene expression frame (specific small activating RNA expression frame) of expression activating RNA gene aiming at SOX2 gene promoter into the downstream of the exogenous gene expression frame of the intermediate vector II to construct a final vector; the sequence of the expression frame of the specific small activating RNA is shown as a sequence 1.

In this example, the promoter of the human SOX2 gene contains CpG island in the region of the Transcription Start Site (TSS), and the small activating RNA used is 21bp small RNA targeting the SOX2 gene-278 bp site, i.e. activating RNA S278.

(2) Screening, plasmid extraction, detection by Biometrics

Screening by colony PCR, extracting plasmid DNA, carrying out enzyme digestion identification by AseI, observing the enzyme digestion result by electrophoresis, sending positive clone plasmid to a biological company for sequencing, confirming that the shRNA gene expression frame of the expression activation RNA gene is correctly connected, and obtaining a final vector which is named as pSOX 2-U-S278; the structure of the device is schematically shown in figure 4.

IV, in order to compare the expression effect of the final vector, inserting a specific small activating RNA expression frame which is the same as that of the final vector into the downstream of the exogenous gene expression frame of the intermediate vector I to construct a comparison vector pSOX 2-S278; the structure of the device is schematically shown in figure 3.

V, verification of high-efficiency expression of expression vector

The vectors pSOX2, pSOX2-UCOE, pSOX2-S278 and pSOX2-U-S278 obtained by the construction are respectively subjected to fluorescence intensity analysis, quantitative PCR analysis and ELISA analysis for verification, and the specific method comprises the following steps:

1. large extract plasmid (using Promega corporation kit)

(1) Taking a 50ml centrifugal tube for marking, pouring the culture bacterial liquid containing the plasmids into the centrifugal tube for multiple times of centrifugation (4000 g/min,10 min), removing supernatant and leaving precipitate;

(2) adding 10ml solution I, vibrating/blowing and uniformly mixing;

(3) adding 10ml solution II, and slightly turning over the mixture up and down for 8-10 times within 2-3 min;

(4) then adding 5ml of precooled N3 buffer, and slightly turning for 10 times to obtain lysate;

(5) preparing an injector, pulling out the piston, and pouring the lysate into a gun barrel after a cap is arranged at an outlet;

(6) taking down the cap, placing a new centrifuge tube below the cap, gently inserting the piston, and collecting liquid through injection;

(7) measuring the liquid volume, adding an ETR solution of 1/10 volumes of the liquid volume, and turning 10 times;

(8) inserting the mixture into ice for ice bath for 10min, turning and uniformly mixing for several times in the ice bath process, and clarifying the liquid from turbidity;

(9) putting into 42 deg.C water bath, and water-bathing for 5min to obtain clear turbid liquid;

(10) centrifuging at 4000g for 5min until a layer of blue substance appears at the bottom of the tube, transferring the supernatant into a new centrifuge tube, adding 1/2 volume of anhydrous ethanol of the supernatant volume, slightly turning over for 6-7 times, and standing at room temperature for 1-2min to obtain a clear solution;

(11) column balancing: taking out HiBind DNA maxicolumns (a green centrifuge tube provided with an adsorption column), adding 3ml of GPS Buffer, standing at room temperature for 4min, centrifuging at 4000g for 3min, and pouring the waste liquid;

(12) transferring the clear liquid into a Hibind column, centrifuging for 3min at 4000g, and pouring the waste liquid;

(13) repeating the previous step until all clear liquid is filtered;

(14) adding 10ml HBC Buffer into the column, centrifuging for 3min at 4000g, and pouring the waste liquid;

(15) adding 15ml of DNA Wash Buffer into the column, centrifuging for 3min at 4000g, and pouring the waste liquid;

(16) adding 10ml of DNA Wash Buffer into the column, centrifuging for 3min at 4000g, and pouring the waste liquid;

(17) centrifuging 4000g of empty column for 10min, putting the adsorption column into a new centrifuge tube, adding 3ml of Endo-free experiment Buffer (endotoxin-free eluent), and standing at room temperature for 5min;

(18) centrifuging at 4000g for 5min, transferring the liquid into the column again, standing for 5min, and centrifuging at 4000g for 5min;

(19) the collected DNA was dispensed into 1.5ml centrifuge tubes and labeled.

2. Transfection

Cell preparation: 1-2 days before the electrotransfer, transferring the cells to a T75 cell culture flask until the confluence degree of the cells before the transformation is about 50-70%, wherein the number of the cells is about 2X 107, and each electrotransfer needs about 106 cells; slowly washing cells with 2.5-10 ml PBS buffer solution, sucking out PBS, digesting cells with 0.4ml 0.25% Trypsin-EDTA pancreatin digestive juice, adding 2.6ml culture medium containing serum, and neutralizing pancreatin; the cells were harvested by centrifugation and resuspended in 1ml HEPES Buffer to a density of 2.5X 106 cells/ml.

3. Electric shock conversion

(1) Setting a electrotransfer program for 280V and 20 ms;

(2) add plasmid to the cuvette (20 ug);

(3) adding 1 × 106 cells, about 400ul, into the cuvette, and mixing by inversion;

(4) placing the electric shock cup into an electric shock groove, performing pulse electric shock once, and placing the electric shock cup on ice for 5min after electric shock;

(5) sucking the shocked cells into a 12-well plate containing 0.8ml of culture medium;

(6) gently shaking the 12-well plate, mixing the cells uniformly, and culturing in a CO2 incubator.

4. G418 screening

(1) And (3) culturing after transfection: culturing for 24 hours or more after transfection until the cell density is increased to 50% -70% confluence;

(2) g418 is added, the culture solution is removed, PBS is washed once, and G418 prepared according to the optimal screening concentration is added for screening and culture;

(3) and (4) changing the screening culture medium every 3-5 days according to the color of the culture medium and the growth condition of cells. When there is massive cell death, the G418 concentration can be halved for maintenance screening. After 10-14 days of screening, resistant clones can be seen;

(4) and (3) monoclonal identification: and extracting total RNA from the monoclonal cell obtained by the limiting dilution method, and detecting whether the target gene exists by RT-PCR.

5. Quantitative detection of EGFP expression level

In the recombinant vectors pSOX2, pSOX2-UCOE, pSOX2-S278 and pSOX2-U-S278, Enhanced Green Fluorescent Protein (EGFP) on the expression frame thereof is used as a marker protein, and the efficiency of expression of the vectors is observed by analyzing the marker protein.

6. Fluorescence intensity analysis

By using a fluorescence microscope, the unified photographing parameters are 10 times of focal length, the green light intensity, the blue light intensity and the white light intensity are all 70%, 4 photos are randomly taken from different angles in each hole, and the fluorescence intensity analysis is carried out by using ImageJ software. The comparative analysis results are shown in FIG. 7.

7. qRT-PCR analysis

(1) Extraction of Total cellular RNA

RNA extraction was performed with Trizol reagent and reverse transcription was performed to cDNA using Promega reverse transcription kit.

(2) Quantitative PCR

The PCR reaction system required by the experiment is 20 ul, the internal reference is GAPDH, and the primers are universal detection primers of EGFP and GAPDH genes respectively. The prepared sample and the internal reference are respectively repeated for 3 times on a Roche quantitative PCR instrument. Use 2^－△△CTThe method analyzes relative change of gene expression.

The comparative analysis results are shown in FIG. 7.

8. ELISA (enzyme-linked immunosorbent assay)

(1) Coating: 0.1ml of antibody solution (blank wells, negative control wells and positive control wells) diluted with 0.05M of carbonate coating buffer pH7.6 to a protein content of 1-10. mu.g/ml was added to reaction wells of a 96-well polystyrene plate and left overnight at 4 ℃. The next day, the well-bore solution was discarded, and the wells were washed 3 times with wash buffer for 3 minutes each time (washing, the same below);

(2) sample adding: adding 0.1ml of diluted sample to be detected into the coated reaction hole, marking, incubating for 1 hour at 37 ℃, and then washing;

(3) adding an enzyme-labeled antibody: adding 0.1ml of freshly diluted enzyme-labeled antibody (the dilution after titration) into each reaction hole, incubating for 0.5-1 hour at 37 ℃, and washing;

(4) adding a substrate solution for color development: adding 0.1ml of temporarily prepared TMB substrate solution into each reaction hole, and keeping the temperature at 37 ℃ for 10-30 minutes;

(5) and (3) terminating the reaction: adding 0.05ml of 2mol/L sulfuric acid into each reaction hole;

(6) and (4) judging a result: the wavelength was adjusted to 450nm in a microplate reader, and the OD value of each well was measured after being zeroed with a blank control well.

The comparative analysis results are shown in FIG. 5.

9. Evaluation of expression efficiency of expression vector

(1) Description of the SOX2 Gene promoter

The SOX2 gene promoter was truncated 1200bp from the 5' UTR region of the SOX2 gene, and contained a TATA box and a transcription start site located in the CpG island region. The pSOX2 plasmid, which was constructed into the final vector, replaced the CMV promoter expressing the foreign gene in the commercial vector pEGFP-C1 with the SOX2 gene promoter. The combined analysis of qRT-PCR, ELISA expression and fluorescence intensity 32 days after transfection of CHO cells with pSOX2 plasmid showed that pSOX2 plasmid was lower in protein amount than the commercial vector pEGFP-C1 (see FIGS. 5-7) that promotes expression of downstream EGFP gene in CHO cells.

(2) Plasmid pSOX2-UCOE with UCOE truncation sequence (intermediate vector II)

Results of qRT-PCR, ELISA and fluorescence intensity analysis show that the expression level of EGFP protein is obviously increased after the SOX2 promoter regulated by the UCOE truncation sequence, namely pSOX2-UCOE plasmid is transformed into CHO cells compared with pSOX2 plasmid, and that the inhibitory effect of the UCOE on the silencing effect of the promoter is obvious when the UCOE acts on the SOX2 promoter alone (see the attached figures 6-7).

(3) pSOX2-S278 plasmid expressing activating RNA (control vector)

The results of analysis by qRT-PCR, ELISA and fluorescence intensity analysis show that the expression level of the control vector pSOX2-S278 with the activating RNA expression cassette is obviously higher than that of the plasmid pSOX2, which shows that the activating effect of the activating RNA on the SOX2 promoter is exerted in the plasmid pSOX2-S278, the activating RNA expression cassette constructed in the plasmid normally functions and exerts the activating effect, and the activating RNA is deduced to change the chromatin state of the SOX2 gene promoter region according to the apparent action mechanism of the activating RNA (see figure 5 and figure 7).

(4) Activation of interaction between RNA and UCOE to regulate and control expression frame of SOX2 gene promoter to overcome transgene silencing

The results of qRT-PCR, ELISA and fluorescence intensity analysis tests show that the expression level of the final vector pSOX2-U-S278 is significantly higher than that of any one of pSOX2-S278 and pSOX2-UCOE, the high expression is still maintained after 32 days, the expression level is significantly higher than that of the commercial vector pEGFP-C1 after 32 days, the phenomenon of forward coordination exists between the sequence of the small activating RNA and the sequence of the UCOE on the apparent regulation effect of the SOX2 promoter, the two effects have a superposition effect, the chromatin regulation effect on the SOX2 gene promoter is jointly exerted, and the transgenic silencing effect caused by the apparent factors is overcome.

The regulatory mechanisms for efficient expression of pSOX2-U-S278 are: the UCOE sequence is connected with a target promoter, and is usually positioned at the upstream of an exogenous gene expression frame, so that the UCOE sequence regulates the promoter and a downstream gene thereof to form open chromatin; because the small activated RNA targets the SOX2 promoter to activate the expression of the downstream gene, open chromatin is formed to promote the expression of the downstream gene, and the UCOE truncation sequence can also regulate and control the promoter to form the open chromatin at a position near the promoter, when the UCOE sequence and the small activated RNA act on the SOX2 gene promoter region through forward coordination on the SOX2 promoter (namely containing a CpG island which is positioned on a transcription starting site), the open chromatin state which is more favorable for overcoming an apparent inhibition mechanism is obtained, so that the more efficient activation of the downstream gene expression effect is obtained.

The above are only some embodiments of the present invention, and the examples are not intended to limit the present invention, and those skilled in the art will appreciate that there are many embodiments that can implement the technical solution of the present invention according to the content of the present specification, and that simple replacement or homogeneous change made according to the technical solution of the present invention should fall into the protection scope of the present invention.

SEQUENCE LISTING

<110> Kunming academy of academic

<120> method for activating RNA-regulated promoter to overcome transgene silencing effect

<130> activating RNA expression cassette sequence:

GCAGGAAGAGGCTATTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTCCAAAGGACGATCACCGCACCTGTAAGGTAAGAGATTTTCAAGAGAAATCTCTTACCTTACAGGTGCTTTTTGGGTG

<140> SOX2 Gene promoter sequence

CAAGGAAGGTTTTGAGGACAGAGGTTTGGGTCTCCTAACTTCTAGTCGGGACTGTGAGAAGGGCGTGAGAGAGTGTTGGCACCTGTAAGGTAAGAGAGGAGAGCGGAAGAGCGCAGTACGGGAGCGGCACCAGAGGGGCTGGAGTTGGGGGGGAGTGCTGTGGATGAGCGGGAGAACAATGACACACCAACTCCTGCACTGGCTGTTTCCAGAAATACGAGTTGGACAGCCGCCCTGAGCCACCCACTGTGCCCTGCCCCACCCCCGCACCTTAGCTGCTTCCCGCGTCCCATCCTCATTTAAGTACCCTGCACCAAAAAGTAAATCAATATTAAGTTTAAAGAAAAAAAAACCCACGTAGTCTTAGTGCTGTTTACCCACTTCCTTCGAAAAGGCGTGTGGTGTGACCTGTTGCTGCGAGAGGGGATACAAAGGTTTCTCAGTGGCTGGCAGGCTGGCTCTGGGAGCCTCCTCCCCCTCCTCGCCTGCCCCCTCCTCCCCCGGCCTCCCCCGCGCGGCCGGCGGCGCGGGAGGCCCCGCCCCCTTTCATGCAAAACCCGGCAGCGAGGCTGGGCTCGAGTGGAGGAGCCGCCGCGCGCTGATTGGTCGCTAGAAACCCATTTATTCCCTGACAGCCCCCGTCACATGGATGGTTGTCTATTAACTTGTTCAAAAAAGTATCAGGAGTTGTCAAGGCAGAGAAGAGAGTGTTTGCAAAAGGGGGAAAGTAGTTTGCTGCCTCTTTAAGACTAGGACTGAGAGAAAGAAGAGGAGAGAGAAAGAAAGGGAGAGAAGTTTGAGCCCCAGGCTTAAGCCTTTCCAAAAAATAATAATAACAATCATCGGCGGCGGCAGGATCGGCCAGAGGAGGAGGGAAGCGCTTTTTTTGATCCTGATTCCAGTTTGCCTCTCTCTTTTTTTCCCCCAAATTATTCTTCGCCTGATTTTCCTCGCGGAGCCCTGCGCTCCCGACACCCCCGCCCGCCTCCCCTCCTCCTCTCCCCCCGCCCGCGGGCCCCCCAAAGTCCCGGCCGGGCCGAGGGTCGGCGGCCGCCGGCGGGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGCGGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCGGCAACCAGAAAAACAGCCCGG

Claims (2)

1. A method of activating an RNA regulated promoter to overcome the effects of transgene silencing, said method comprising the steps of:

(1) selecting a promoter which does not contain an enhancer and has a CpG island at a transcription initiation site as a target promoter, wherein the target promoter is a human SOX2 gene promoter, and the gene sequence of the target promoter is shown as a sequence 2; replacing a CMV promoter in an exogenous gene expression frame on a commercial vector pEGFP-C1 by using the target promoter to construct an intermediate vector I;

(2) inserting UCOE truncation sequences into the Ase I enzyme cutting sites at the upstream of the exogenous gene expression frame of the intermediate vector I to construct an intermediate vector II;

(3) inserting a shRNA gene expression frame aiming at the expression activation RNA gene of the target promoter into the downstream of the exogenous gene expression frame of the intermediate vector II to obtain a final vector; the sequence of the shRNA gene expression frame for expressing the activating RNA gene is shown as a sequence 1;

the final vector can ensure that the expression quantity of the EGFP gene is continuously, stably and efficiently expressed by verification.

2. The method for activating an RNA regulated promoter to overcome the silencing effect of a transgene according to claim 1, wherein in the step of constructing the intermediate vector I, the target promoter sequence is amplified by using AgeI and AseI double enzyme cutting site primers which are:

SOX2 # Forward primer: CCGTGATTAATAGACAAGGAAGGTTTTGAGGAC

SOX2 # reverse primer: ATATGACCGGTATCCGGGCTGTTTTTCTGGTT are provided.

Images