CN110628812B - Method for increasing number of plant nodules based on gene negative regulation - Google Patents
Method for increasing number of plant nodules based on gene negative regulation Download PDFInfo
- Publication number
- CN110628812B CN110628812B CN201910935366.0A CN201910935366A CN110628812B CN 110628812 B CN110628812 B CN 110628812B CN 201910935366 A CN201910935366 A CN 201910935366A CN 110628812 B CN110628812 B CN 110628812B
- Authority
- CN
- China
- Prior art keywords
- plant
- vector
- gene
- nodules
- receptor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention discloses a method for increasing the number of plant nodules based on negative regulation of genes, which comprises the steps of extracting total RNA in plant tissues; synthesizing a PCR reaction template through reverse transcription PCR; constructing a recombinant expression vector for knocking out a corresponding gene as a knock-out vector; transforming the receptor plant by agrobacterium-mediated hairy root transformation to lower the expression of the corresponding gene in the receptor plant and increase the nodulation number of the root system of the receptor plant. The recombinant expression vector constructed by the invention is used for transforming a receptor soybean plant to obtain a transgenic plant, and the number of root nodules of a soybean root system can be obviously increased.
Description
Technical Field
The invention relates to the technical field of genetic engineering, in particular to a method for cultivating a plant with high nodulation capacity.
Background
Soybean is an important grain and oil economic crop, and nitrogen in the air can be converted into ammonia nitrogen which can be absorbed and utilized by plants through root nodules, so that the nitrogen nutrition necessary for the growth and development of the soybean is provided. The symbiotic nitrogen fixation process mediated by the root nodules not only influences the normal growth and yield of the soybeans, but also is beneficial to saving energy and reducing environmental chemical pollution. At present, the improvement of symbiotic nitrogen fixation efficiency becomes one of important ways for improving soybean yield and ensuring agricultural sustainable development, and the molecular mechanism for understanding the nodulation and nodule generation and development of soybeans on a molecular level is an important basis for more reasonably utilizing the characteristic of high nodulation nitrogen fixation efficiency of soybeans.
Plant hormones are involved in the formation and development processes of leguminous nodules, where cytokinins (cytokinins) play a key role in regulating nodule development (Ferguson and Mathesius, 2014). In leguminous plants, the development of root-nodule-like structures can be induced by exogenous administration of cytokinins (Mathesius et al, 2000; Heckmann et al, 2011). Overexpression of the LOG gene (cytokinin nucleoside 5' -monophosphate phosphohydrolase) in Medicago truncatula leads to a reduction in the number of nodules (Mortier et al, 2014), Isopentenyltransferases (IPTs) are key components of cytokinin biosynthesis, and LjIPT3 induced by rhizobium infestation in leaves in Lotus corniculatus can promote cytokinin synthesis and transport underground to achieve inhibition of secondary nodules (Sasaki et al, 2014); in addition to this, the cytokinin oxidase/dehydrogenase gene (CKX) induced by rhizobial infestation is expressed in the rhizobial radical and developing nodules, the cytokinin content in the CKX3 mutant in Medicago truncatula is significantly increased and the occurrence of nodules is suppressed, indicating that a moderate amount of cytokinin is particularly important for the nodulation of leguminous plants (Dugald et al, 2016).
Acquired-function mutations of the Lotus japonicus cytokinin receptor can produce spontaneous nodules (Gonzalez-Rizzo et al, 2006), while the cytokinin receptor mutants cre1 and lhk1 in alfalfa and Lotus japonicus lose their ability to form rhizobia primordia. Response Regulators (RR) are downstream key components of cytokinin signaling, where A-response regulators are negative regulators in the cytokinin signaling pathway, including ARR3-ARR9 and ARR15-ARR17, which have only 10 receptor domains and a short C-terminus; whereas type B response regulators are positive regulators in the cytokinin signaling pathway, including ARR1, ARR2, ARR10-ARR14, ARR18-ARR21, which have 11 signal-accepting domains, C-terminal DNA binding domains and transcriptional activation domains that can directly regulate downstream target genes and activate expression of type a response regulators (Jennifer et al, 2008).
However, the role of RR in regulating soybean nodulation is not seen at present. No report is made about whether the B-type response factor RR11 has a regulating effect in soybean root nodulation and symbiotic nitrogen fixation.
Disclosure of Invention
The invention aims to solve the technical problem of providing a method for increasing the number of plant nodules based on negative gene regulation.
In order to solve the technical problems, the technical scheme adopted by the invention is as follows.
A method for increasing the number of plant nodules based on negative gene regulation by down-regulating expression in a plant of SEQ ID NO: 1 or a homologous gene thereof to increase the number of nodules in the root system of a recipient plant.
As a preferred technical scheme of the invention, the knockout vector is constructed and the recipient plant is transformed to regulate the expression of the corresponding gene in the recipient plant and increase the nodulation number of the root system of the recipient plant.
As a preferred technical scheme of the invention, the operation steps comprise: A. firstly, extracting total RNA in plant tissues; B. synthesizing a PCR reaction template through reverse transcription PCR; C. constructing a recombinant expression vector for knocking out a corresponding gene as a knock-out vector; D. transforming the receptor plant by agrobacterium-mediated hairy root transformation to lower the expression of the corresponding gene in the receptor plant and increase the nodulation number of the root system of the receptor plant.
As a preferred technical scheme of the invention, the skeleton vector of the knockout vector in the step C is a pB7 GWIIW 2 vector.
As a preferred embodiment of the present invention, the step of constructing the knockout vector in step C comprises: c-1, constructing a pDONR207 vector plasmid containing a target gene sequence; c-2, constructing a target knockout vector through LR reaction.
As a preferred technical scheme of the invention, the operation process of the step C-1 is as follows: b, carrying out PCR by using plant cDNA obtained by reverse transcription in the step B as a template to amplify a target gene segment; wherein the sequence of the forward primer used for amplification is shown as SEQ ID NO:2 is shown in the specification; the reverse primer is shown as SEQ ID NO:3 is shown in the specification; the amplification procedure was: 5min at 95 ℃; 30 cycles of 95 ℃ for 30sec, 56 ℃ for 30sec, 68 ℃ for 1.5 min; 70sec at 72 ℃; carrying out 1% agarose gel electrophoresis on the PCR amplification product, and recovering and purifying a band near 1500bp by adopting a Shanghai crude gel recovery kit; the recovered DNA fragment was ligated to the vector pDONR207, 1. mu.l pDONR207 vector was added to 5. mu.l of the system, 3. mu.l fragment was recovered, 1. mu.l BP enzyme was mixed, ligated overnight at 25 ℃ and transferred to E.coli competent cells by heat shock, cultured overnight, selected for positive cloning and sequenced.
As a preferred technical scheme of the invention, the operation process of the step C-2 is as follows: and C-1, extracting the pDONR207 vector plasmid containing the correct sequencing obtained in the step C-1, connecting to a pB7GWIW2 skeleton vector through LR reaction, thermally shocking the connecting product to transform a competent escherichia coli DH5 alpha strain, culturing overnight at 37 ℃, and selecting a positive clone for sequencing to obtain the target recombinant expression vector.
As a preferred technical scheme of the invention, the acceptor plant is a plant of the Papilionaceae family.
The technical innovation of the invention also comprises a recombinant expression vector with a negative regulation function, which comprises a pB7 GWIIW 2 skeleton vector and a sequence table SEQ ID NO: 1.
The technical innovation of the invention also comprises a transformant and a plant receptor with the recombinant expression vector.
Adopt the produced beneficial effect of above-mentioned technical scheme to lie in: referring to the following example 3, the recombinant expression vector (knock-out vector) constructed by the present invention is used to transform a recipient soybean plant to obtain a transgenic plant, which can significantly increase the number of root nodules of soybean root system.
Drawings
FIG. 1 is an example of the expression pattern of a gene of interest in roots, leaves and tumors (FIG. 1A) and in response to chronic rhizobium infestation (FIG. 1B). The gene is mainly expressed in the root nodule, and the expression of the target gene is obviously induced in the soybean root infected by rhizobium, and the result shows that the target gene participates in the process of nodulation and nitrogen fixation of the soybean root system.
Fig. 2 is a phenotypic analysis of soybean nodules after overexpression and knockout of GmRR11L1 in examples 2-3, and the number of nodules is significantly reduced in a transgenic root system (EV) transformed by an empty vector when a transgenic root expressing GmRR11L1 is up-regulated under the same experimental environment (fig. 2A-2C), and fig. 2A is an analysis of expression level of GmRR11L1 in the transgenic root system, and the result shows that the expression of GmRR11L1 in the transgenic root system is significantly up-regulated; downregulation of transgenic roots expressing GmRR11L1 the number of nodules was significantly increased compared to transgenic root lines (EV) transformed with empty vector (fig. 2D-2F), and fig. 2D is an analysis of the expression level of GmRR11L1 in transgenic root lines, showing that the expression of GmRR11L1 was significantly downregulated in transgenic root lines.
Detailed Description
The following examples illustrate the invention in detail. The raw materials and various devices used in the invention are conventional commercially available products, and can be directly obtained by market purchase. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemicals, unless otherwise specified. The percentages (%) in the following examples are by mass unless otherwise specified. The quantitative tests in the following examples, unless otherwise specified, were set up in triplicate and the results averaged.
Example 1, tissue expression patterns of genes of interest and their analysis of expression patterns in response to treatment with rhizobia.
1) Obtaining materials: the material used for the experiment was williams 82 (W82); the material was carried out according to the following procedure: sterilizing semen glycines seed with 70% ethanol solution for 30sec, sowing in vermiculite matrix soaked in low nitrogen nutrient solution, culturing in culture room, 16 hr light/8 hr dark, light intensity of 7000LUX, temperature of 26 deg.C, and relative humidity of 70%. 10 days after sowing, inoculation treatment was performed with USDA110 having an OD600 of 0.08, and gene expression was detected by sampling at the corresponding time points, while in the case of expression patterns in roots, leaves and tumors, samples were taken in inoculum 28 DAI.
2) Isolation of mRNA: extracting soybean total RNA by using a Trizol method, namely putting tissues into grinding, grinding the tissues for 3 times by using liquid nitrogen, adding 0.1-0.2g of the ground tissues into a 1mL centrifuge tube, then adding 1mL TRI pure reagent, fully shaking to obtain a cracking product which is clear transparent viscous liquid, and standing for 5min at room temperature; ② adding 200 mu L chloroform, shaking and mixing evenly, standing for 5min at room temperature, 4 ℃, 12000r/min, centrifuging for 15 min; thirdly, transferring the supernatant into another centrifugal tube, adding isopropanol with the same volume, uniformly mixing by oscillation, precipitating at-20 ℃ for 30min, at 4 ℃ at 12000r/min, and centrifuging for 10 min; fourthly, the supernatant is discarded, the supernatant is washed by 75 percent ethanol (prepared by DEPC treated sterile water), the temperature is 4 ℃, 12000r/min, the centrifugation is carried out for 10min, the centrifugation is repeated twice, the air drying is carried out for about 10min at room temperature, and about 20 mu l of DEPC treated RNase Free water (DEPC water) is added for dissolving and precipitating.
3) Reverse transcription into cDNA: the extracted mRNA was reverse transcribed into cDNA using TaKaRa reverse transcription kit.
4) Real-time fluorescent quantitative PCR analysis: the specific experimental method adopted by the SuperReal PreMix Plus (SYBR Green) kit from TIANGEN company is as follows: mu.l of the cDNA template obtained in the above step, 0.2. mu.l of each forward and reverse primer, 5. mu.l of 2 XSuperReal PreMix Plus, ddH were added to a 10. mu.l system2O4.4. mu.l; the amplification procedure was: 95 ℃ for 15 min; 95 ℃ for 10 sec; 60 ℃, 34sec, 40 cycles; 65 ℃, 5sec, 95 ℃, 5 sec; wherein the content of the first and second substances,
the forward primer is: CTTGCAGAAATACAGGCTTTAT (SEQ ID NO: 4);
the reverse primer is: ATCATTTTGTTGCTTGATTACTG (SEQ ID NO: 5).
5) As a result: as shown in FIG. 1, the expression of the target gene was significantly induced as the time after the treatment with Rhizobium increased, indicating that the target gene was induced by Rhizobium.
Example 2 Up-regulation of expression of genes of interest using overexpression vectors to alter the number of nodules.
1) Extraction of Total RNA from Soybean root tissue of Wilimas82
Treating the mortar at the high temperature of 180 ℃ for 8h or burning to eliminate RNase pollution; reagents such as chloroform, isopropanol, ethanol and the like are used and are not polluted when being newly unsealed; treating other equipment such as gun head, centrifuge tube and reagent such as ultrapure water and NaAc with 1 ‰ DEPC water overnight, sterilizing at 121 deg.C for 30min, and oven drying at 65 deg.C; extracting soybean total RNA by using a Trizol method:
(1) grinding 100mg of soybean root material with liquid nitrogen, adding 1mL of TRI pure reagent, fully homogenizing, sucking the homogenate liquid into a 1.5mL centrifuge tube, and standing at room temperature for 5 min;
(2) adding 200 μ l chloroform, shaking, mixing, standing for 5min at 4 deg.C and 12000r/min, and centrifuging for 10 min;
(3) taking the supernatant in another centrifuge tube, adding isopropanol with the same volume, shaking, mixing uniformly, precipitating at-20 deg.C for 30min, at 4 deg.C, 12000r/min, and centrifuging for 10 min;
(4) discarding the supernatant, washing with 1mL of 75% ethanol (prepared with DEPC-treated sterile water), centrifuging at 4 deg.C for 10min at 12000r/min, repeating twice, air drying at room temperature for about 10min, and adding about 20 μ l of DEPC-treated RNase Free water (DEPC water) to dissolve the precipitate;
2) reverse transcription PCR
(1) Mu.l RNA and 3. mu.l oligo (dt)18 were added sequentially to a 200. mu.l PCR tube treated with DEPC; incubating 4 μ L dNTPs at 65 deg.C for 5min, and rapidly cooling on ice;
(3) the following solutions were added in the following order: 5X M-MLV buffer (Invitrogen corporation) 4. mu.l, RNase inhibitor 1. mu.l, M-MLV 1. mu.l, 0.1M DTT 2. mu.l;
(4) mixing the above reaction solution, and reacting at 37 deg.C for 30 min;
(5) after the reaction is finished, treating at 70 ℃ for 10min to inactivate the activity of the reverse transcriptase; the first strand of the reaction-synthesized cDNA can be used as a template for a PCR reaction.
3) Construction of recombinant expression vectors
(1) Cloning of target Gene fragments
Designing a primer pair for constructing an over-expression vector according to a target coding sequence (SEQ ID NO: 1), and introducing gateway joints into the tail ends of the primers respectively; carrying out PCR by taking cDNA of the soybean sequencing variety W82 as a template to amplify a gene segment; the primer sequence is as follows:
a forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATAATGGTTGTTTCTCTT (SEQ ID NO: 2);
reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTC CAGAACTGGCATAATCATTG (SEQ ID NO: 3);
the amplification procedure was: 5min at 95 ℃; 30 cycles of 95 ℃ for 30sec, 56 ℃ for 30sec, 68 ℃ for 1.5 min; 70sec at 72 ℃;
carrying out 1% agarose gel electrophoresis on the PCR amplification product, and recovering and purifying a band of about 1500bp by adopting a Shanghai crude rubber recovery kit;
the recovered DNA fragment was ligated with vector pDONR207 (Invitrogen), 1. mu.l of pDONR207 vector was added to 5. mu.l of the system, 3. mu.l of the recovered fragment and 1. mu.l of BP enzyme were mixed, and the mixture was ligated overnight at 25 ℃ and transferred to E.coli competent cells by heat shock, cultured overnight, cloned positively, and subjected to Shanghai's sequencing.
(2) Construction of recombinant expression vectors
a. Extracting pDONR207 vector plasmid containing correctly sequenced gene sequence;
b. attachment to C3F by LR reaction;
c. transforming the ligation product obtained in the step 3 into a competent escherichia coli DH5 alpha strain through heat shock, culturing overnight at 37 ℃, and selecting a positive clone for sequencing; sequencing results show that the recombinant plasmid GmRR11L1-C3F is obtained.
4) Agrobacterium K599 mediated hairy root transformation:
(1) the agrobacterium transformation adopts a liquid nitrogen freezing and dissolving method to transform agrobacterium, and the specific operation is as follows:
a. taking out 200 mul of frozen competent cells, thawing, adding 5-10 mul of plasmid GmRR11L1-C3F, uniformly mixing the walls of the flick tubes, and standing on ice for 20-30 min;
b. placing in liquid nitrogen for 5min, taking out, melting tube at 37 deg.C (5min), adding 800 μ l LB (non-resistance) liquid culture medium, and oscillating at 28 deg.C at low speed (150r/min) for 4-5 hr;
c, 4000r/min, 30sec, removing supernatant, adding 100 ul LB liquid culture medium, suspending thalli, and plating to contain 50mg/ml kanamycin);
d. culturing at 28 deg.C until white transformant grows out, and using for hairy root transformation;
(2) agrobacterium K599-mediated hairy root transformation
Using soybean variety W82 as material, collecting seed material, sterilizing with chlorine for 10 hr, and placing in a container B5Germinating on culture medium (culture medium formula: 2% sucrose, 0.8G agar powder (sigma), 1 XGAMBORG B-5BASAL (Phyto Technology Laboratories, cat # G398) with pH adjusted to 5.7) for 5 days, cutting cotyledons just before opening, cross-cutting at the lower end of cotyledons, and immersing in activated Agrobacterium K599 for 30min (OD 599)600After 0.6), explants were transferred to 1/2MS medium (medium formula: 2% sucrose, 0.8 agar powder (sigma), 0.5 × MURA SHIGE&SKOOG BASAL MEDIOM w/VITAMINS (Phyto Technology Laboratories, cat # G519), pH adjusted to 5.7; after 3 days of upper co-culture, the medium is transferred to 1-Inducing hairy root on 2MS culture medium, growing hairy root after 7 days, selecting hairy root composite seedling with near development stage to transfer into vermiculite after soybean true leaf grows and hairy root reaches 7-8cm, culturing for 1 week, inoculating Rhizobium USDA110 (OD)6000.08)30 mL/strain, and counting the number of nodules after 28 days of culture.
5. Observation of results
The results are shown in fig. 2, which shows that the transgenic roots of the up-regulated expression plasmid GmRR11L1-C3F have significantly reduced number of nodules compared with the transgenic root system (EV) transformed by an empty vector under the identical experimental environment (fig. 2A-2C), and fig. 2A shows that the expression of the target gene in the transgenic root system is significantly up-regulated by analyzing the expression level of the target gene in the transgenic root system.
Example 3 modification of the number of nodules by downregulation of the expression of the gene of interest using a knock-out vector.
1) Extraction of Total RNA from Soybean root tissue of Wilimas82
Treating the mortar at the high temperature of 180 ℃ for 8h or burning to eliminate RNase pollution; reagents such as chloroform, isopropanol, ethanol and the like are used and are not polluted when being newly unsealed; treating other equipment such as gun head, centrifuge tube and reagent such as ultrapure water and NaAc with 1 ‰ DEPC water overnight, sterilizing at 121 deg.C for 30min, and oven drying at 65 deg.C; extracting soybean total RNA by using a Trizol method:
(1) grinding 100mg of soybean root material with liquid nitrogen, adding 1mL of TRI pure reagent, fully homogenizing, sucking the homogenate liquid into a 1.5mL centrifuge tube, and standing at room temperature for 5 min;
(2) adding 200 μ l chloroform, shaking, mixing, standing for 5min at 4 deg.C and 12000r/min, and centrifuging for 10 min;
(3) taking the supernatant in another centrifuge tube, adding isopropanol with the same volume, shaking, mixing uniformly, precipitating at-20 deg.C for 30min, at 4 deg.C, 12000r/min, and centrifuging for 10 min;
(4) discarding the supernatant, washing with 1mL of 75% ethanol (prepared with DEPC-treated sterile water), centrifuging at 4 deg.C for 10min at 12000r/min, repeating twice, air drying at room temperature for about 10min, and adding about 20 μ l of DEPC-treated RNase Free water (DEPC water) to dissolve the precipitate;
2) reverse transcription PCR
(1) Mu.l RNA and 3. mu.l oligo (dt)18 were added sequentially to a 200. mu.l PCR tube treated with DEPC; incubating 4 μ L dNTPs at 65 deg.C for 5min, and rapidly cooling on ice;
(3) the following solutions were added in the following order: 5X M-MLV buffer (Invitrogen corporation) 4. mu.l, RNase inhibitor 1. mu.l, M-MLV 1. mu.l, 0.1M DTT 2. mu.l;
(4) mixing the above reaction solution, and reacting at 37 deg.C for 30 min;
(5) after the reaction is finished, treating at 70 ℃ for 10min to inactivate the activity of the reverse transcriptase; the first strand of the reaction-synthesized cDNA can be used as a template for a PCR reaction.
3) Construction of recombinant expression vectors
(1) Cloning of target Gene fragments
Designing a primer pair for constructing an over-expression vector according to a coding sequence (SEQ ID NO: 1) of a target gene, and respectively introducing gateway joints into the tail ends of the primers; carrying out PCR by taking cDNA of the soybean sequencing variety W82 as a template to amplify a gene fragment of a target gene; the primer sequence is as follows:
a forward primer: GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGGATAATGGTTGTTTCTCTT (SEQ ID NO: 2);
reverse primer: GGGGACCACTTTGTACAAGAAAGCTGGGTC CAGAACTGGCATAATCATTG (SEQ ID NO: 3);
the amplification procedure was: 5min at 95 ℃; 30 cycles of 95 ℃ for 30sec, 56 ℃ for 30sec, 68 ℃ for 1.5 min; 70sec at 72 ℃;
carrying out 1% agarose gel electrophoresis on the PCR amplification product, and recovering and purifying a band of about 1500bp by adopting a Shanghai crude rubber recovery kit;
the recovered DNA fragment was ligated with vector pDONR207 (Invitrogen), 1. mu.l of pDONR207 vector was added to 5. mu.l of the system, 3. mu.l of the recovered fragment and 1. mu.l of BP enzyme were mixed, and the mixture was ligated overnight at 25 ℃ and transferred to E.coli competent cells by heat shock, cultured overnight, cloned positively, and subjected to Shanghai's sequencing.
(2) Construction of recombinant expression vectors
a. Extracting pDONR207 vector plasmid containing correctly sequenced gene sequence;
b. the GmRR11L1 was ligated to pB7 GWIIW 2 by LR reaction;
c. transforming the ligation product obtained in the step 3 into a competent escherichia coli DH5 alpha strain through heat shock, culturing overnight at 37 ℃, and selecting a positive clone for sequencing; sequencing results show that a recombinant plasmid GmRR11L1-pB7 GWIIW 2 is obtained.
4) Agrobacterium K599 mediated hairy root transformation:
(1) the agrobacterium transformation adopts a liquid nitrogen freezing and dissolving method to transform agrobacterium, and the specific operation is as follows:
a. taking out 200 mul of frozen competent cells, thawing, adding 5-10 mul of plasmid GmRR11L1-pB7GWIW2, uniformly mixing the walls of the flicking tubes, and standing on ice for 20-30 min;
b. placing in liquid nitrogen for 5min, taking out, melting tube at 37 deg.C (5min), adding 800 μ l LB (non-resistance) liquid culture medium, and oscillating at 28 deg.C at low speed (150r/min) for 4-5 hr;
c, 4000r/min, 30sec, removing supernatant, adding 100 ul LB liquid culture medium, suspending thalli, and plating to contain 50mg/ml kanamycin);
d. culturing at 28 deg.C until white transformant grows out, and using for hairy root transformation;
(2) agrobacterium K599-mediated hairy root transformation
Using soybean variety W82 as material, collecting seed material, sterilizing with chlorine for 10 hr, and placing in a container B5Germinating on culture medium (culture medium formula: 2% sucrose, 0.8G agar powder (sigma), 1 XGAMBORG B-5BASAL (Phyto Technology Laboratories, cat # G398) with pH adjusted to 5.7) for 5 days, cutting cotyledons just before opening, cross-cutting at the lower end of cotyledons, and immersing in activated Agrobacterium K599 for 30min (OD 599)600After 0.6), explants were transferred to 1/2MS medium (medium formula: 2% sucrose, 0.8 agar powder (sigma), 0.5 × MURA SHIGE&SKOOG BASAL MEDIOM w/VITAMINS (Phyto Technology Laboratories, cat # G519), pH adjusted to 5.7; after 3 days of co-cultivation, transferring to 1/2MS culture medium to induce hairy root, after 7 days, hairy root grows out, after soybean true leaf grows out and hairy root reaches 7-8cm, selecting hairy root composite seedling with near development stage, transferring into vermiculite, culturing for 1 week, inoculating Rhizobium USDA110 (OD)600＝008)30 mL/strain, and counting the number of nodules after 28 days of culture.
5. Observation of results
The results are shown in fig. 2, which shows that the transgenic roots of the expression plasmid GmRR11L1-pB7GWIW2 have significantly increased number of nodules compared with the transgenic root system (EV2) transformed by an empty vector under the same experimental environment (fig. 2D-2F), and fig. 2D shows that the expression of the target gene in the transgenic root system is significantly reduced through analyzing the expression level of the target gene in the transgenic root system.
In the above examples, it can be seen that the overexpression vector constructed by the invention can specifically overexpress the GmRR11L1 gene in soybean. The gene is positioned on a soybean No. 18 chromosome, and a real-time fluorescent quantitative PCR detection result shows that the expression of the GmRR11L1 gene in soybean roots is induced by rhizobium infection; nodulation analysis of the hairy root transformation chimeric seedling shows that the soybean nodulation number can be remarkably inhibited by up-regulating expression GmRR11L1, and can be remarkably increased by knocking out GmRR11L1, which indicates that GmRR11L1 has an important function in soybean nodulation development and cultivates and forms transgenic soybean with the increased nodulation number.
The above description is only presented as an enabling solution for the present invention and should not be taken as a sole limitation on the solution itself.
Sequence listing
<110> university of agriculture in Huazhong
<120> method for increasing number of plant nodules based on gene negative regulation
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1368
<212> DNA
<213> Glycine genus Soybean (Glycine MAX)
<400> 1
atggataatg gttgtttctc ttccccaaag cgtgattttc ctgctggtct gagagttctg 60
gttgtggatg atgatcctac gtggctcaag atccttgaga agatgctaaa gaagtgcaat 120
tatgaagtga ccacatgttg tttagcaagg catgctctaa gcttgcttcg tgaacggaag 180
gatggatatg atatagtgat cagcgatgta aacatgcctg acatggatgg ttttaaactt 240
cttgagcatg ttgggcttga gatggatctt cctgtcatta tgatgtctgt ggatggggaa 300
acaagcaagg tgatgaaagg tgttcaacat ggagcctgtg attatctcct taagcctata 360
aggatgaaag aactgagaaa catatggcag catgtcttca gaaaaaagat acatgaggca 420
aaagaatttg aaagttttga gagcattcac ttgatgagaa atggatcaga gctatcagat 480
gatgggaacc tgtttgctgt agaagatgtt acctcatcaa agaaaagaaa agatgctgat 540
agcaaacacg atgacaaaga atgtttggat ccatcatcca ccaagaaagc tagagtagtc 600
tggtctgtag atcttcatca gaagtttgtt aaagcagtga atcagattgg atttgataaa 660
gtggggccca agaaaatact agatctgatg aatgtcccat ggctgactag agagaatgtt 720
gctagccact tgcagaaata caggctttat ttgagtagga ttcagaaaga aaacgatcag 780
agatcttcct caagtggaat gaagcattca gattttcctt caaaagatat gggaagtttt 840
ggttttcaga actcagtaat caagcaacaa aatgatgttg caattgacaa ctacaatcat 900
tcagatggat cattacaact tcagaatgtg gaaactaaaa gtcatgaagc tgatcccaag 960
ggaattgttt cacagtccac catagcaaaa aaaggaagga ttttgactgg taacattgct 1020
gacacgaaca tgagagagag tttaagggtt ggccttaatc aaacttttcc ccctctagag 1080
tcagaaggaa accatgcagt gtttgattgt tccatgccaa caccatactc ttggactgaa 1140
gttccacaca tgcaactcaa agaagaacac aagtcacttg tttatttaga agatagcttc 1200
aatcagttgc cattacatgg taagcagcag caacacatcc atgtggatca atcacaatca 1260
gttgcttcaa ttagttccgc tccctcaata accgaggaag aggctgctgc ttgtatagaa 1320
ccaaaacctt gtttgcagat tacaacaatg attatgccag ttctgtga 1368
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 2
cttgcagaaa tacaggcttt at 22
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 3
atcattttgt tgcttgatta ctg 23
<210> 4
<211> 53
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 4
ggggacaagt ttgtacaaaa aagcaggctt catggataat ggttgtttct ctt 53
<210> 5
<211> 50
<212> DNA
<213> Artificial sequence (Artificial sequence)
<400> 5
ggggaccact ttgtacaaga aagctgggtc cagaactggc ataatcattg 50
Claims (7)
1. A method for increasing the number of plant nodules based on negative gene regulation, comprising: by down-regulating expression in a plant of SEQ ID NO: 1 or homologous genes thereof, so as to increase the number of nodules of a root system of a recipient plant; the plant is soybean.
2. A method for increasing the number of plant nodules according to claim 1 based on gene negative regulation, wherein: and constructing a knockout vector and converting a receptor plant to down-regulate the expression of a corresponding gene in the receptor plant and increase the nodulation number of a root system of the receptor plant.
3. A method for increasing the number of plant nodules according to claim 2 based on negative gene regulation, wherein: the operation steps comprise: A. firstly, extracting total RNA in plant tissues; B. synthesizing a PCR reaction template through reverse transcription PCR; C. constructing a recombinant expression vector for knocking out a corresponding gene as a knock-out vector; D. transforming the receptor plant by agrobacterium-mediated hairy root transformation to lower the expression of the corresponding gene in the receptor plant and increase the nodulation number of the root system of the receptor plant.
4. A method for increasing the number of plant nodules according to claim 3 based on negative gene regulation, wherein: and C, the skeleton vector of the knockout vector in the step C is a pB7 GWIIW 2 vector.
5. A method for increasing the number of plant nodules according to claim 4 based on negative gene regulation, wherein: the construction step of the knockout vector in step C comprises: c-1, constructing a pDONR207 vector plasmid containing a target gene sequence; c-2, constructing a target knockout vector through LR reaction.
6. A method for increasing the number of plant nodules according to claim 5 based on negative gene regulation, wherein: the operation process of the step C-1 is as follows: b, carrying out PCR by using plant cDNA obtained by reverse transcription in the step B as a template to amplify a target gene segment; wherein the sequence of the forward primer used for amplification is shown as SEQ ID NO:2 is shown in the specification; the reverse primer is shown as SEQ ID NO:3 is shown in the specification; the amplification procedure was: 5min at 95 ℃; 30 cycles of 95 ℃ for 30sec, 56 ℃ for 30sec, 68 ℃ for 1.5 min; 70sec at 72 ℃; carrying out 1% agarose gel electrophoresis on the PCR amplification product, and recovering and purifying a band near 1500bp by adopting a Shanghai crude gel recovery kit; the recovered DNA fragment was ligated to the vector pDONR207, 1. mu.l pDONR207 vector was added to 5. mu.l of the system, 3. mu.l fragment was recovered, 1. mu.l BP enzyme was mixed, ligated overnight at 25 ℃ and transferred to E.coli competent cells by heat shock, cultured overnight, selected for positive cloning and sequenced.
7. A method for increasing the number of plant nodules according to claim 5 based on negative gene regulation, wherein: the operation process of the step C-2 is as follows: and C-1, extracting the pDONR207 vector plasmid containing the correct sequencing obtained in the step C-1, connecting to a pB7GWIW2 skeleton vector through LR reaction, thermally shocking the connecting product to transform a competent escherichia coli DH5 alpha strain, culturing overnight at 37 ℃, and selecting a positive clone for sequencing to obtain the target recombinant expression vector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910935366.0A CN110628812B (en) | 2019-09-29 | 2019-09-29 | Method for increasing number of plant nodules based on gene negative regulation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910935366.0A CN110628812B (en) | 2019-09-29 | 2019-09-29 | Method for increasing number of plant nodules based on gene negative regulation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110628812A CN110628812A (en) | 2019-12-31 |
| CN110628812B true CN110628812B (en) | 2021-09-14 |
Family
ID=68974688
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910935366.0A Active CN110628812B (en) | 2019-09-29 | 2019-09-29 | Method for increasing number of plant nodules based on gene negative regulation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110628812B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592096A (en) * | 2019-07-29 | 2019-12-20 | 吉林省农业科学院 | Soybean nodulation middle and later stage regulation gene GmRSD and application method thereof |
-
2019
- 2019-09-29 CN CN201910935366.0A patent/CN110628812B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592096A (en) * | 2019-07-29 | 2019-12-20 | 吉林省农业科学院 | Soybean nodulation middle and later stage regulation gene GmRSD and application method thereof |
Non-Patent Citations (2)
| Title |
|---|
| Mini-Review: Nod Factor Regulation of Phytohormone Signaling and Homeostasis During Rhizobia-Legume Symbiosis;William P. Buhian等;《Front Plant Sci.》;20180903;第9卷(第1247期);摘要，第6页第2段，表1 * |
| XM_014770949.2;NCBI;《Genbank》;20180831;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110628812A (en) | 2019-12-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108841863B (en) | Method for cultivating high-nodulation nitrogen-fixing plant | |
| CN112831478B (en) | Protein OsCAT8 for regulating rice chalkiness and coding gene and application thereof | |
| CN107541520B (en) | OsSAUR11 gene related to rice root development and stress resistance, coding protein and application | |
| CN112626080B (en) | R gene for controlling soybean-rhizobium matching property, protein and application thereof | |
| CN111675755B (en) | Bermuda grass transcription factor CdWRKY50 for regulating and controlling plant salt tolerance and application thereof | |
| CN104946664A (en) | Poplar salt-tolerance related gene PeHKT1 and expression protein and application thereof | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN102586272B (en) | Key gene PeWOX11b for adventitious root development of poplar and application of key gene PeWOX11b | |
| CN102586273B (en) | Key gene PeWOX11a in development of adventitious roots of poplar and application of key gene PeWOX11a | |
| CN109852634B (en) | Method for cultivating high-nodulation nitrogen-fixing transgenic plant | |
| CN109810978B (en) | Method for cultivating high-nodulation/nitrogen-fixing transgenic plant | |
| CN104328127A (en) | Tumorous stem mustard stress resistance gene BjEFh1 as well as plant expression vector and application thereof | |
| CN109337884B9 (en) | Pyruvate kinase gene and application thereof | |
| CN110628812B (en) | Method for increasing number of plant nodules based on gene negative regulation | |
| CN111518186A (en) | Plant salt-resistant protein MsVNI1, and coding gene and application thereof | |
| CN110592096A (en) | Soybean nodulation middle and later stage regulation gene GmRSD and application method thereof | |
| CN109880845B (en) | Method for improving plant nodulation nitrogen fixation efficiency | |
| CN115806979A (en) | Arabidopsis long-chain non-coding RNA-DANA1 and application thereof in plant drought tolerance | |
| CN109694880B (en) | Method for cultivating high-nodulation transgenic plant based on RNA interference technology | |
| CN115322977A (en) | Application of laugh LacOMT and coding gene thereof in improving mercury stress tolerance of plants | |
| CN114540381A (en) | Apple histone deacetylase MdHDA6 gene and application thereof | |
| CN109553666B (en) | Potassium transport protein KUP9 from tobacco, and coding gene and application thereof | |
| CN114292863B (en) | Nitrate transport protein and application of encoding gene thereof in improving quantity of hairy root nodules of crops | |
| CN116286705B (en) | Broussonetia papyrifera homocysteine thiomethyltransferase gene BpHMT2 and application thereof | |
| CN108588069A (en) | The precursor-gene of mulberry tree miR171a and its application in enhancing plant salt endurance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |