CN110592277A - Primer group for rapid detection of barley streak mosaic virus microfluidic chip and rapid detection method thereof - Google Patents
Primer group for rapid detection of barley streak mosaic virus microfluidic chip and rapid detection method thereof Download PDFInfo
- Publication number
- CN110592277A CN110592277A CN201910705633.5A CN201910705633A CN110592277A CN 110592277 A CN110592277 A CN 110592277A CN 201910705633 A CN201910705633 A CN 201910705633A CN 110592277 A CN110592277 A CN 110592277A
- Authority
- CN
- China
- Prior art keywords
- bsmv
- mosaic virus
- microfluidic chip
- primer
- streak mosaic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 238000001514 detection method Methods 0.000 title claims abstract description 42
- 241000700605 Viruses Species 0.000 title claims abstract description 30
- 235000007340 Hordeum vulgare Nutrition 0.000 title claims abstract description 26
- 240000005979 Hordeum vulgare Species 0.000 title 1
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 46
- 230000003321 amplification Effects 0.000 claims abstract description 38
- 241000209219 Hordeum Species 0.000 claims abstract description 25
- 238000000034 method Methods 0.000 claims abstract description 25
- 238000006243 chemical reaction Methods 0.000 claims abstract description 15
- 229920000936 Agarose Polymers 0.000 claims description 5
- 108020004707 nucleic acids Proteins 0.000 claims description 5
- 150000007523 nucleic acids Chemical class 0.000 claims description 5
- 102000039446 nucleic acids Human genes 0.000 claims description 5
- 238000011901 isothermal amplification Methods 0.000 claims description 3
- 239000007787 solid Substances 0.000 claims description 3
- 230000035945 sensitivity Effects 0.000 abstract description 12
- 238000012216 screening Methods 0.000 abstract description 4
- 230000001133 acceleration Effects 0.000 abstract description 2
- 239000013612 plasmid Substances 0.000 description 18
- 239000013642 negative control Substances 0.000 description 7
- 201000010099 disease Diseases 0.000 description 6
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 6
- 238000005516 engineering process Methods 0.000 description 5
- 108090000623 proteins and genes Proteins 0.000 description 5
- 238000003757 reverse transcription PCR Methods 0.000 description 5
- 241000724681 Barley yellow mosaic virus Species 0.000 description 4
- 238000002965 ELISA Methods 0.000 description 3
- 241000209140 Triticum Species 0.000 description 3
- 235000021307 Triticum Nutrition 0.000 description 3
- 238000010170 biological method Methods 0.000 description 3
- 239000012154 double-distilled water Substances 0.000 description 3
- 239000000203 mixture Substances 0.000 description 3
- 230000000405 serological effect Effects 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 241000710118 Maize chlorotic mottle virus Species 0.000 description 2
- 241000723994 Maize dwarf mosaic virus Species 0.000 description 2
- 241000040340 Oat mosaic virus Species 0.000 description 2
- 102000006382 Ribonucleases Human genes 0.000 description 2
- 108010083644 Ribonucleases Proteins 0.000 description 2
- 241001429320 Wheat streak mosaic virus Species 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 208000024891 symptom Diseases 0.000 description 2
- 108020004635 Complementary DNA Proteins 0.000 description 1
- 241000724309 Hordeivirus Species 0.000 description 1
- 240000008042 Zea mays Species 0.000 description 1
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 1
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000005540 biological transmission Effects 0.000 description 1
- 239000002299 complementary DNA Substances 0.000 description 1
- 235000005822 corn Nutrition 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 231100000053 low toxicity Toxicity 0.000 description 1
- 230000014759 maintenance of location Effects 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 231100000331 toxic Toxicity 0.000 description 1
- 230000002588 toxic effect Effects 0.000 description 1
- 231100000419 toxicity Toxicity 0.000 description 1
- 230000001988 toxicity Effects 0.000 description 1
- 230000003612 virological effect Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer group for rapidly detecting a barley streak mosaic virus microfluidic chip, which consists of the following primers: BSMV-F3-2: as shown in SEQ ID N0.2, BSMV-B3-2: as shown in SEQ ID N0.3, BSMV-FIP-2: as shown in SEQ ID N0.4, BSMV-BIP-2: as shown in SEQ ID N0.5, BSMV-LP-2: as shown in SEQ ID N0.6; also relates to a rapid detection method of the barley streak mosaic virus microfluidic chip. The primer group has strong amplification specificity and high sensitivity, and the minimum detection limit can reach 102copies/ul. The detection method has the advantages of high detection speed, capability of simultaneously detecting a plurality of viruses, 10-15min of peak starting time, 0.5 hour of time consumption in the whole process, great acceleration of the detection speed, improvement of the working efficiency, high sensitivity, minimum detection time and high sensitivityThe detection limit can reach 102The method has the advantages of copies/ul, small reaction system (with a single hole of 5 mu l), cost saving, no need of expensive instruments, simple and convenient operation, and is more suitable for rapid screening in non-laboratory places such as port and the like.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a primer group for rapidly detecting a barley streak mosaic virus microfluidic chip and a rapid detection method thereof.
Background
Barley Streak Mosaic Virus (BSMV) belongs to the genus Hordeuvirus (Hordeivirus), is a viral disease in gramineous crops, and can cause streak mosaic disease in Barley, wheat and corn. BSMV is widely distributed worldwide, once a great loss was caused to barley production. The main transmission route of the barley streak mosaic virus is seeds, even seeds with low toxicity can cause diseases, and offspring seeds generated by each seed with toxicity are toxic. The symptom of the disease is not obvious at a lower temperature (12 ℃), and the wheat variety has a hidden symptom at the later growth stage of the wheat, so the disease is not easy to be determined as the stripe mosaic disease. In view of the high hazard of the barley streak mosaic virus, research work on detection and identification technology of the virus is necessary.
Current assays for the detection and identification of BSMV include biological, serological and molecular biological methods. The biological detection method mainly comprises an electron microscope observation method and an identification host method, and the method is complex in operation and long in period, needs facilities and equipment such as an isolation quarantine greenhouse or an electron microscope and is difficult to be used for on-site rapid detection. The most widely used enzyme-linked immunosorbent assay (ELISA) in the serological method has the defects of low detection sensitivity, easy pollution and the like. The molecular biological method comprises reverse transcription polymerase chain reaction (RT-PCR) and real-time fluorescence RT-PCR technology, compared with the two methods, the method does not need to prepare antibodies, can also obviously improve the sensitivity, has simple and convenient operation process, and is widely applied to the detection of BSMV, but the molecular biological method needs precise and expensive instruments, and only can detect one virus at a time.
Disclosure of Invention
The first technical problem to be solved by the invention is to provide a primer group with strong amplification specificity for rapid detection of a barley streak mosaic virus microfluidic chip aiming at the prior art.
The second technical problem to be solved by the invention is to provide a rapid detection method of a barley streak mosaic virus microfluidic chip, which is simple and convenient to operate, high in detection speed, high in sensitivity and strong in specificity.
The technical scheme adopted for solving the first technical problem is as follows: a primer group for rapid detection of a barley streak mosaic virus microfluidic chip is characterized by comprising the following primers:
BSMV-F3-2 GGATTGTTTGCGTATTTGATCT
BSMV-B3-2 CCGATGATGGTAAGCATTG
BSMV-FIP-2 GTAACTACCTCCGTTGGCGACAAAAACATTCTACGGAATCCG
BSMV-BIP-2 AGAGACGGGTCAAAGAGTATAAGTGGGCAACAACATTCCAGG
BSMV-LP-2 TTGCCCGCAATGCTTACC。
the technical solution adopted to solve the second technical problem is as follows: the method for rapidly detecting the barley mosaic virus microfluidic chip by using the primer group is characterized by comprising the following steps of: first, a reaction solution is mixed with each primer of the primer set, and then template nucleic acid is added for amplification and the amplification result is read.
Further, preferably, each primer in the primer set is immobilized on a chip, and then the reaction solution and the template are sequentially added.
Preferably, each primer in the primer group is mixed with a proper amount of agarose solution and then is dripped into a sample adding hole of the chip, and the mixture is dried to be solid at room temperature, so that the primer group is fixed on the chip.
Preferably, the reaction solution is a fluorescent isothermal amplification premix.
Preferably, the amplification conditions are: the amplification temperature is 63.5 ℃, the amplification time is 30min, and the fluorescence channel is FAM. The amplification temperature is only one, so that a precise temperature change instrument is not needed, and rapid detection in non-laboratory places such as ports and the like is facilitated.
Preferably, the concentration of each primer in the primer set is 100 μm.
Further, preferably, the volume ratio of BSMV-F3-2, BSMV-B3-2, BSMV-FIP-2, BSMV-BIP-2 and BSMV-LP-2 in the primer set is 1:8: 4. The primers in the invention can obtain better amplification effect by adopting the volume ratio.
Compared with the prior art, the invention has the advantages that: the primer group for the rapid detection of the barley streak mosaic virus microfluidic chip has strong amplification specificity and high sensitivity, and the lowest detection limit can reach 102copies/ul. The rapid detection method of the barley streak mosaic virus microfluidic chip has the advantages of high detection speed, capability of simultaneously detecting various viruses, 10-15min of peak starting time, 0.5h of time consumed in the whole process, great acceleration of the detection speed, improvement of the working efficiency, high sensitivity and 10-10 lowest detection limit2The copies/u has a small reaction system (a single hole is 5 mu L), saves cost, does not need expensive instruments, is simple and convenient to operate, and is suitable for rapid screening work in non-laboratory places such as ports and the like.
Drawings
FIG. 1 is a graph of the amplification of BSMV positive samples in example 1 of the present invention;
FIG. 2 shows a graph 10 in example 2 of the present invention6Amplification profiles of plasmids at copies/ul concentration;
FIG. 3 shows a graph 10 in example 2 of the present invention5Amplification profiles of plasmids at copies/ul concentration;
FIG. 4 shows a graph 10 in example 2 of the present invention4Amplification profiles of plasmids at copies/ul concentration;
FIG. 5 shows a graph 10 in example 2 of the present invention3Amplification profiles of plasmids at copies/ul concentration;
FIG. 6 shows a graph 10 in example 2 of the present invention2Amplification profiles of plasmids at copies/ul concentration;
FIG. 7 shows a graph 10 in example 2 of the present invention1Amplification profiles of plasmids at copies/ul concentration;
FIG. 8 shows a graph 10 in example 2 of the present invention0Amplification profiles of plasmids at copies/ul concentration;
FIG. 9 shows a graph 10 in example 3 of the present invention2Amplification profiles of plasmid replicate samples at copies/ul concentration;
FIG. 10 is a graph showing the amplification curve of each virus-positive sample in example 4 of the present invention.
Detailed Description
The invention is described in further detail below with reference to the accompanying examples.
The target gene in the invention is a conserved fragment in the gene sequence of barley mosaic virus, and the specific sequence is (5 '-3'):
AGGCCAAATAAGTATTGGCCAATTGTCGCCGGAATCGGTGTCGTTGGATTGTTTGCGTATTTGATCTTTTCAAATCAAAAACATTCTACGGAATCCGGTGATAATATTCACAAATTCGCCAACGGAGGTAGTTACAGAGACGGGTCAAAGAGTATAAGTTATAATCGTAATCATCCTTTTGCCTATGGCAATGCCTCATCCCCTGGAATGTTGTTGCCCGCAATGCTTACCATCATCGGAATCATTTCCTATTTATGGCGAACAAGAGATTCCGTGCTCGGAGACTCAGGCGGAAACAACTCCTGTGGAGAAGACTGTCAGGGCGAATGTCTTAACGGAC (shown in SEQ ID N0.1).
The primer group for the rapid detection of the barley streak mosaic virus microfluidic chip consists of the following primers,
BSMV-F3-2(5 '-3') GGATTGTTTGCGTATTTGATCT (shown as SEQ ID N0.2)
BSMV-B3-2(5 '-3') CCGATGATGGTAAGCATTG (shown as SEQ ID N0.3)
BSMV-FIP-2(5 '-3') GTAACTACCTCCGTTGGCGACAAAAACATTCTACGGAATCCG (shown as SEQ ID N0.4)
BSMV-BIP-2(5 '-3') AGAGACGGGTCAAAGAGTATAAGTGGGCAACAACATTCCAGG (shown as SEQ ID N0.5)
BSMV-LP-2(5 '-3') TTGCCCGCAATGCTTACC (shown in SEQ ID N0.6).
Each primer in the above primer set was synthesized by the applicant's Co., Ltd, the great Gene science and technology, Heihua, Beijing.
The rapid detection method of the barley streak mosaic virus microfluidic chip comprises the following steps: first, the reaction solution is mixed with each primer of the primer set, and then the target nucleic acid is added to perform amplification, and the amplification result is read. In this embodiment, the reaction solution is a fluorescent isothermal amplification premix (Ningbo Aigenic science and technology Co., Ltd.), and the amplification conditions are as follows: the amplification temperature was 63.5 ℃, the amplification time was 30min, and the fluorescence channel was FAM (microfluidics fluorescence Detector MA2000, Ningbo Aigene technology Co., Ltd.). In this embodiment, the concentration of each primer in the primer set is 100 μm, and the volume ratio of the BSMV-F3-2, the BSMV-B3-2, the BSMV-FIP-2, the BSMV-BIP-2, and the BSMV-LP-2 in the primer set is 1:8: 4, specifically, in this embodiment, the total volume of the solution added to each well (8 wells) of the chip is 50ul (5 ul per well, the rest is the error volume), wherein the amount of the template nucleic acid is 29.8ul, the amount of the reaction solution is 18ul, and the amount of the primer set is 2.2ul, wherein the volumes of the BSMV-F3-2, the BSMV-B3-2, the BSMV-FIP-2, the BSMV-BIP-2, and the BSMV-LP-2 are 0.1ul, 0.8ul, and 0.4ul, respectively.
In the present invention, each primer in the primer set may be immobilized on a chip in advance, and then the reaction solution and the template may be added in sequence. The following method is adopted for primer fixation: and mixing each primer in the primer group with a proper amount of agarose solution, then dropping the mixture into a sample adding hole of the chip, and airing the mixture to be solid at room temperature to finish the fixation of the primer group on the chip. The primer fixing method adopted in the invention is a conventional technology in the prior art, and the concentration of the agarose solution and the proportion of each primer to the agarose solution can adopt parameters disclosed in the prior art.
Example 1: test experiment of BSMV Positive samples
The amplification was performed by adding cDNA of a BSMV positive sample (purchased from Agdia, USA) as a template to each well of the chip, and the amplification was performed according to the above-described amplification method, wherein the negative control in this example was double distilled water without RNase, the sequence of wells of the chip is shown in Table 1, the amplification results are shown in Table 2, and the amplification curve is shown in FIG. 1. The experimental result of example 1 shows that the BSMV positive sample can start the peak, and the peak starting time is 10-15 min.
TABLE 1
Note: in Table 1, white is no reaction and black is a negative control.
Example 2: sensitivity test
Plasmids with different concentrations are used as templates and added into each sample adding hole of the chip, amplification is carried out according to the amplification method, wherein the negative control in the embodiment is double distilled water without RNase, the corresponding sequence of the chip holes is shown in Table 3, the amplification result is shown in Table 4, and the amplification curve of the plasmids with different concentrations is shown in FIGS. 2-8. Wherein, the plasmid is puc57 plasmid (produced by Ningbo love gene science and technology Co., Ltd.), puc57 plasmid is spliced with the barley mosaic virus target gene fragment after enzyme digestion, and plasmids which are successfully connected are screened and tested, and the specific method adopts the conventional plasmid splicing technology.
TABLE 3
Note: the concentration of the plasmid in Table 3 is in copies/ul, and black is a negative control.
As can be seen from the experimental results of this example 2, the minimum detection limit of the detection method of the present invention can reach 102copies/ul。
TABLE 2
| Hole site | Name of hole | Ct value | Positive and negative |
| 1 | A1 | 11.78 | + |
| 2 | A2 | 15.61 | + |
| 3 | A3 | 12.20 | + |
| 4 | A4 | 12.09 | + |
| 5 | A5 | 12.11 | + |
| 6 | A6 | 12.95 | + |
| 7 | A7 | 12.29 | + |
| 8 | A8 | 12.64 | + |
| 9 | B1 | 0 | - |
| 10 | B2 | 0 | - |
| 11 | B3 | 0 | - |
| 12 | B4 | 0 | - |
| 13 | B5 | 0 | - |
| 14 | B6 | 0 | - |
| 15 | B7 | 0 | - |
| 16 | B8 | 0 | - |
| 17 | C1 | 0 | - |
| 18 | C2 | 0 | - |
| 19 | C3 | 0 | - |
| 20 | C4 | 0 | - |
| 21 | C5 | 0 | - |
| 22 | C6 | 0 | - |
| 23 | C7 | 0 | - |
| 24 | C8 | 0 | - |
| 25 | D1 | 0 | - |
| 26 | D2 | 0 | - |
| 27 | D3 | 0 | - |
| 28 | D4 | 0 | - |
| 29 | D5 | 0 | - |
| 30 | D6 | 0 | - |
| 31 | D7 | 0 | - |
| 32 | D8 | 0 | - |
Example 3: repeatability test
10 in the above example 22The plasmid copies/ul were used as a template and added to each well of the chip under the same conditions as in example 2, the corresponding sequence of the wells is shown in Table 5, the amplification results are shown in Table 6, and the amplification curve of each replicate is shown in FIG. 9.
TABLE 5
Note: the concentration of the plasmid in Table 5 is in copies/ul, and black is a negative control.
TABLE 4
| Hole site | Name of hole | Ct value | Positive and negative |
| 1 | A1 | 11.67 | + |
| 2 | A2 | 12.16 | + |
| 3 | A3 | 11.93 | + |
| 4 | A4 | 12.18 | + |
| 5 | A5 | 14.26 | + |
| 6 | A6 | 14.14 | + |
| 7 | A7 | 14.15 | + |
| 8 | A8 | 14.04 | + |
| 9 | B1 | 16.02 | + |
| 10 | B2 | 16.08 | + |
| 11 | B3 | 16.01 | + |
| 12 | B4 | 16.21 | + |
| 13 | B5 | 18.11 | + |
| 14 | B6 | 21.41 | + |
| 15 | B7 | 19.79 | + |
| 16 | B8 | 18.73 | + |
| 17 | C1 | 23.54 | + |
| 18 | C2 | 28.82 | + |
| 19 | C3 | 28.04 | + |
| 20 | C4 | 20.03 | + |
| 21 | C5 | 0 | - |
| 22 | C6 | 0 | - |
| 23 | C7 | 0 | - |
| 24 | C8 | 0 | - |
| 25 | D1 | 0 | - |
| 26 | D2 | 0 | - |
| 27 | D3 | 0 | - |
| 28 | D4 | 0 | - |
| 29 | D5 | 0 | - |
| 30 | D6 | 0 | - |
| 31 | D7 | 0 | - |
| 32 | D8 | 0 | - |
TABLE 6
| Hole site | Name of hole | Ct value | Positive and negative |
| 1 | A1 | 16.20 | + |
| 2 | A2 | 16.44 | + |
| 3 | A3 | 16.09 | + |
| 4 | A4 | 16.78 | + |
| 5 | A5 | 17.31 | + |
| 6 | A6 | 15.87 | + |
| 7 | A7 | 17.48 | + |
| 8 | A8 | 16.54 | + |
| 9 | B1 | 17.87 | + |
| 10 | B2 | 17.37 | + |
| 11 | B3 | 17.68 | + |
| 12 | B4 | 17.57 | + |
| 13 | B5 | 17.99 | + |
| 14 | B6 | 17.84 | + |
| 15 | B7 | 18.33 | + |
| 16 | B8 | 17.43 | + |
| 17 | C1 | 18.91 | + |
| 18 | C2 | 17.73 | + |
| 19 | C3 | 17.39 | + |
| 20 | C4 | 18.68 | + |
| 21 | C5 | 18.18 | + |
| 22 | C6 | 17.34 | + |
| 23 | C7 | 19.03 | + |
| 24 | C8 | 18.07 | + |
| 25 | D1 | 0 | - |
| 26 | D2 | 0 | - |
| 27 | D3 | 0 | - |
| 28 | D4 | 0 | - |
| 29 | D5 | 0 | - |
| 30 | D6 | 0 | - |
| 31 | D7 | 0 | - |
| 32 | D8 | 0 | - |
As can be seen from the experimental results of example 3, the CV value of the primer set of the present invention was 4.88% (less than 5%), i.e., the reproducibility was good.
Example 4: experiment of specificity
Total cdnas of BSMV (barley mosaic virus, available from Agdia, usa), MCMV (maize chlorotic mottle virus, available from Agdia, usa), MDMV (maize dwarf mosaic virus, available from Agdia, usa), OMV (oat mosaic virus, laboratory positive sample retention), and WSMV (wheat streak mosaic virus, available from Agdia, usa) were added as templates to each well of the chip, and amplification was performed according to the above-described amplification method, wherein the nucleic acid concentrations of the respective virus samples were the same, the negative control in this example was double distilled water without rnase, the sequences of the wells were as shown in table 7, the amplification results were as shown in table 8, and the amplification curves were as shown in fig. 10.
TABLE 7
Note: in Table 7, white is no reaction and black is shaded as negative control.
TABLE 8
As can be seen from the experimental results of example 4, only the BSMV sample has the peak, and the other samples have no peak, which indicates that the primer set of the present invention has strong amplification specificity.
Therefore, the rapid detection method of the barley streak mosaic virus microfluidic chip has the following advantages:
1. the detection speed is high: according to specific experimental conditions, the time consumption of an electron microscope and a differential host identification method is generally different from several weeks, the time consumption of an ELISA detection method is different from 4 to 5 hours, the time consumption of common RT-PCR is different from 3 to 4 hours, and the time consumption of fluorescence RT-PCR is about 1 hour.
2. The sensitivity is high: the sensitivity of molecular biological detection techniques is generally higher than that of serological detection techniques, about 0.02ng/ul (about 7 x 10)6copies/ul), the sensitivity of the detection method in this application is 102copies/ul, higher sensitivity than molecular biological detection method.
3. More suitable for quick screening work: the detection method has the advantages of small reaction system (5 mu L of single hole), cost saving, no need of expensive instruments, simple and convenient operation, and suitability for rapid screening in non-laboratory places such as port and the like.
Claims (8)
1. A primer group for rapid detection of a barley streak mosaic virus microfluidic chip is characterized by comprising the following primers:
2. a method for rapidly detecting a barley streak mosaic virus microfluidic chip by using the primer set of claim 1, which is characterized by comprising the following steps: first, a reaction solution is mixed with each primer of the primer set, and then template nucleic acid is added for amplification and the amplification result is read.
3. The method for rapidly detecting the barley streak mosaic virus microfluidic chip according to claim 2, wherein each primer in the primer group is fixed on the chip in advance, and then the reaction solution and the template are sequentially added.
4. The method for rapidly detecting the barley streak mosaic virus microfluidic chip according to claim 3, wherein the primers in the primer set are mixed with a proper amount of agarose solution and then spotted into the sample adding holes of the chip, and the sample adding holes are dried to be solid at room temperature, so that the primer set is fixed on the chip.
5. The method for rapidly detecting the barley streak mosaic virus microfluidic chip according to claim 2, wherein the reaction solution is a fluorescent isothermal amplification premix solution.
6. The method for rapidly detecting the barley streak mosaic virus microfluidic chip according to claim 5, wherein the amplification conditions are as follows: the amplification temperature is 63.5 ℃, the amplification time is 30min, and the fluorescence channel is FAM.
7. The method for rapidly detecting the barley streak mosaic virus microfluidic chip according to claim 2, wherein the concentration of each primer in the primer group is 100 μm.
8. The method for rapidly detecting the barley streak mosaic virus microfluidic chip of claim 7, wherein the volume ratio of BSMV-F3-2, BSMV-B3-2, BSMV-FIP-2, BSMV-BIP-2 and BSMV-LP-2 in the primer group is 1:1:8:8: 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910705633.5A CN110592277A (en) | 2019-07-31 | 2019-07-31 | Primer group for rapid detection of barley streak mosaic virus microfluidic chip and rapid detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910705633.5A CN110592277A (en) | 2019-07-31 | 2019-07-31 | Primer group for rapid detection of barley streak mosaic virus microfluidic chip and rapid detection method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110592277A true CN110592277A (en) | 2019-12-20 |
Family
ID=68853225
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910705633.5A Pending CN110592277A (en) | 2019-07-31 | 2019-07-31 | Primer group for rapid detection of barley streak mosaic virus microfluidic chip and rapid detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110592277A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154918A (en) * | 2020-03-01 | 2020-05-15 | 浙江大学 | Method for rapidly detecting chrysanthemum virus B by micro-fluidic chip and used primer |
| CN111621585A (en) * | 2020-04-16 | 2020-09-04 | 大连民族大学 | Rapid detection kit for simultaneously detecting multiple transgenic rape lines and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107099619A (en) * | 2017-05-03 | 2017-08-29 | 上海速创诊断产品有限公司 | A kind of LAMP primer composition thing and its kit for detecting respiratory pathogen |
| CN107119140A (en) * | 2017-06-16 | 2017-09-01 | 北京百康芯生物科技有限公司 | Respiratory tract micro-fluidic chip Fast Detection Technique and kit |
-
2019
- 2019-07-31 CN CN201910705633.5A patent/CN110592277A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107099619A (en) * | 2017-05-03 | 2017-08-29 | 上海速创诊断产品有限公司 | A kind of LAMP primer composition thing and its kit for detecting respiratory pathogen |
| CN107119140A (en) * | 2017-06-16 | 2017-09-01 | 北京百康芯生物科技有限公司 | Respiratory tract micro-fluidic chip Fast Detection Technique and kit |
Non-Patent Citations (4)
| Title |
|---|
| A. ZARZYŃSKA‑NOWAK等: "Molecular analysis of barley stripe mosaic virus isolates differing in their biological properties and the development of reverse transcription loop‑mediated isothermal amplification assays for their detection", 《ARCHIVES OF VIROLOGY》 * |
| A. ZARZYŃSKA等: "Development of a one-step immunocapture real-time RT-PCR assay for the detection of barley stripe mosaic virus strains in barley seedlings", 《ACTA VIROLOGICA》 * |
| 殷宏等: "环介导等温扩增微流控检测方法研究进展" * |
| 王佳莹等: "大麦条纹花叶病毒实时荧光RT-PCR检测方法的建立及应用", 《植物检疫》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111154918A (en) * | 2020-03-01 | 2020-05-15 | 浙江大学 | Method for rapidly detecting chrysanthemum virus B by micro-fluidic chip and used primer |
| CN111621585A (en) * | 2020-04-16 | 2020-09-04 | 大连民族大学 | Rapid detection kit for simultaneously detecting multiple transgenic rape lines and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| CN111235313A (en) | CRISPR-Cas13 method for rapidly detecting novel coronavirus | |
| CN110592277A (en) | Primer group for rapid detection of barley streak mosaic virus microfluidic chip and rapid detection method thereof | |
| CN112322705A (en) | Isothermal amplification fluorescence RMA method for multiple nucleic acid detection | |
| CN114231665A (en) | Phaseolus golden mosaic virus (RPA-LFD) detection kit and application thereof | |
| CN106222298B (en) | LAMP detection kit, detection method and application of RNA virus | |
| CN115852052A (en) | Real-time fluorescent quantitative PCR primer probe combination for detecting CymRSV and method thereof | |
| WO2019001187A1 (en) | Multi-liquid phase gene chip detection primer, kit and method for rapidly distinguishing five pathogens in mouse respiratory tracts | |
| CN111304365A (en) | Novel one-step loop-mediated isothermal detection reagent for gosling gout virus and application thereof | |
| CN106521018A (en) | Primer and method for high-flux detection of transgenic maize containing NOS terminator | |
| CN111534603B (en) | Method for identifying aedes albopictus by using fluorescent RPA | |
| CN111793703B (en) | Kit for detecting mycobacterium tuberculosis nucleic acid by enzyme digestion probe at constant temperature | |
| CN108977578A (en) | Detect the kit and its method of H7N9 avian influenza virus | |
| CN108660256B (en) | Joint gene detection kit and detection method for potato yellow dwarf virus | |
| CN111793719A (en) | Method for detecting new coronavirus by recombinase amplification combined with immune side flow | |
| CN116516036A (en) | Primer and probe combination for detecting Pantoea ananatis by LAMP method and application | |
| CN106636458A (en) | RT-LAMP (reverse transcription and loop-mediated isothermal amplification) detection primer group, RT-LAMP detection kit and RT-LAMP detection method for simian immunodeficiency virus | |
| CN110184386A (en) | For detecting the RT-LAMP detection primer and its application, detection reagent and detection method of ANRSV | |
| CN108411030A (en) | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 | |
| CN116287427A (en) | Primer and probe combination for detecting duck tembusu virus by RAA-LFD and application thereof | |
| CN113736919A (en) | Nucleic acid detection kit and use method thereof | |
| CN114634996A (en) | Primer-probe combination for detecting bovine respiratory diseases, kit and application thereof | |
| CN112391493A (en) | RAA fluorescence detection method, primer probe and kit for citrus greening disease Asian species | |
| CN111575403A (en) | High-throughput digital PCR kit for detecting RNA virus nucleic acid and detection method | |
| CN116536394B (en) | Construction method of marine organism single cell transcriptome library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191220 |