CN110592206A - Kit for detecting Huafa drug effect by using rs9934438 - Google Patents

Abstract

The invention discloses a kit for detecting the drug effect of a Huafa method by using rs 9934438; the kit comprises a MassARRAY chip, three primers for detecting gene VKORC1rs9934438SNP sites which are respectively called forward primers, reverse primers and extension primers, the sequences of the primers are respectively shown as SEQ ID No. 1-3 in sequence, wherein the primers are used for identifying the polymorphic sites of genes related to warfarin drug effect and adverse reaction. The kit can carry out high-throughput detection on the loci, and has the advantages of high sensitivity, high specificity, stable detection result, high reliability and the like; meanwhile, the method is suitable for the gene analysis fields of clinical disease mutation detection, pharmacogenomics analysis, forensic medicine identification and the like.

Description

Kit for detecting Huafa drug effect by using rs9934438

Technical Field

The invention belongs to the technical field of genes, and relates to a kit for detecting the drug effect of a Huafa method by using rs 9934438.

Background

Warfarin is a bishydroxycoumarin derivative with a chemical structure of 3- (a-phenylacetone) -4-hydroxycoumarin. Warfarin, as a coumarin-based oral anticoagulant, is used for preventing and treating deep vein thrombosis and pulmonary embolism; prevention of thromboembolic complications (stroke or systemic circulation embolism) after myocardial infarction; preventing atrial fibrillation, heart valve disease or thromboembolic complication caused by artificial valve replacement, wherein the discharge mode mainly passes through the kidney; in the liver, however, vitamin K is involved in the warfarin metabolic pathway. The in vivo unactivated vitamin K dependent coagulation factors II, VII, IX, X and protein C, S, Z are only activated by gamma-carboxylation by gamma-glutamyl carboxylase (GGCX), and a cascade reaction occurs to cause blood coagulation. Reduced vitamin K is an essential auxiliary factor of GGCX, so the content of reduced vitamin K in vivo directly influences the function of GGCX, vitamin K epoxide reductase subunit 1(VKORC1) reduces oxidized vitamin K into reduced vitamin K, and warfarin inhibits VKORC1 and the generation of reduced vitamin K, thereby playing the anticoagulation role. The sensitivity of VKORC1 gene mutation types to warfarin drug effect and drug resistance of adverse drug reactions can explain the specificity and difference of individual drug reactions, thereby having important influence on warfarin drug use research. A large number of clinical researches show that warfarin has the advantages of large adaptation disease range and low price, but the solution of the defect of large difference among individuals caused by narrow treatment window is also a hotspot of current social researches. This is also a difficult problem encountered during warfarin administration, since the individual sensitivity to the drug, the need for drug dosage varies, and it is clearly unreasonable for clinicians to adjust drug dosage, usually based on personal experience and patient clinical phenotype: the optimal drug effect dose is taken as a base line, the given dose is small, the anticoagulant treatment effect cannot be achieved, thrombus is caused, and the given dose is large, and serious bleeding events are caused due to excessive anticoagulation.

Vitamin K epoxide reductase complex 1(vitamin K epoxide reductase complex 1, VKORC1) is located on chromosome 16P11.2 at about 4.5 kb. The research shows that patients with VKORC1 gene defect often have thrombotic diseases, the functional variation of the gene is also found to be the key reason for the drug resistance of warfarin and the influence on the dose difference of warfarin, and the genetic polymorphism of the gene explains 20-30% of the dose difference. The search of the existing literature does not find related reports that VKORC1rs9934438SNP sites are used as warfarin pharmacodynamic molecular markers in Chinese population, and the application of the research result is that the treatment effect of patients on antiplatelet drugs can be better understood by detecting the polymorphism of VKORC1 gene.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a kit for detecting the drug effect of the Huafa method by using rs 9934438. In particular to a method for detecting the polymorphic site of VKORC1 gene rs9934438 related to the curative effect and adverse reaction of warfarin medicaments by utilizing a multiplex PCR technology, a single base extension technology and a mass spectrum technology and a corresponding kit.

The purpose of the invention is realized by the following technical scheme:

in a first aspect, the invention relates to a primer set for SNP detection of genes related to individualized administration of warfarin, which comprises: PCR primers with sequences shown as SEQ ID No.1 and SEQ ID No. 2 and extension primers with sequences shown as SEQ ID No. 3 are used for detecting VKORC1rs9934438SNP sites in peripheral blood DNA.

In a second aspect, the invention relates to a kit for SNP detection of genes related to individualized administration of warfarin, which comprises the primer set.

As one embodiment of the kit of the invention, the kit further comprises a detection reagent, a detection chip and a detection carrier.

The detection reagent comprises a PCR mixed reaction solution, an SAP enzyme mix reaction solution and a UEP extension mix reaction solution.

As an embodiment of the kit of the present invention, the kit further comprises a resin for purification, a target for spotting and mass spectrometric detection, and a human genomic DNA extraction reagent.

The primer is designed on a gene typing MassARRAY platform in Chinese Han population, and is more efficient, accurate and high-flux compared with the prior art.

In a third aspect, the present invention also relates to a method for using the kit for SNP detection of individual drug use related genes in warfarin for non-diagnostic purposes, which comprises the following steps:

s1, performing PCR primer dilution and UEP extension primer dilution by using the primer group;

s2, PCR reaction;

s3, SAP digestion reaction;

s4, UEP extension reaction;

s5, purifying resin.

In step S2, the PCR mixed reaction solution adopted in the PCR reaction includes deionized water, PCR Buffer, and MgCl₂dNTPs, heat-resistant Taq DNA polymerase and an amplification primer mix.

In step S3, the SAP enzyme mix reaction solution used in the SAP digestion reaction includes deionized water, SAP Buffer, and SAP enzyme.

In step S4, the UEP extension mix reaction solution used in the UEP extension reaction includes deionized water, Gold Buffer, Termination mix, UEP primer mix, and high temperature resistant extension enzyme.

In step S5, the resin for purification is dropped into the single-base-charged extension product obtained in step S4.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention integrates the technologies of multiplex PCR, single base extension, mass spectrum detection and the like, can detect trace samples while amplifying a detection template, and has very high detection sensitivity;

2. single base extension is also called micro sequencing, and uses a specific probe to identify DNA, so that the method has the advantages of good specificity, low false positive and the like;

3. the high-throughput sequencing technology has high speed and high efficiency, and can complete hundreds of sample detections in 3-4 hours;

4. the operation is simple, and meanwhile, the pollution is reduced under the automatic operation;

5. the invention can detect a plurality of patients and can obtain different gene locus information at the same time;

6. the research overcomes the defect of high cost of detecting a small amount of SNP loci at one time in the prior art;

7. the invention lays a foundation for researching the relation between the VKORC1 gene polymorphism of the population in China and the clinical medication safety, provides a theoretical basis for clinical individualized medication, and provides a guidance basis for the research and development of new drugs based on the pharmacogenomics concept.

Detailed Description

The present invention will be described in detail with reference to examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that it would be apparent to those skilled in the art that several modifications and improvements can be made without departing from the inventive concept. All falling within the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally following conventional conditions, such as molecular cloning by Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1 primer design and Synthesis

Aiming at gene polymorphism sites related to the warfarin medication of VKORC1rs9934438, corresponding specific PCR primer sequences (SEQ ID No:1 to SEQ ID No:2) and specific extension primer sequences (SEQ ID No:3) are designed; the specific sequence is shown in table 1:

TABLE 1

Numbering	Targeting sites	Sequence (5'-3')	Use of
				SEQ ID NO:1	rs9934438	ACGTTGGATGGTGATTTCCAAGAAGCCACC	PCR forward primer
SEQ ID NO:2	rs9934438	ACGTTGGATGAGATGAAAAGCAGGGCCTAC	PCR reverse primer
				SEQ ID NO:3	rs9934438	GTGCCAGGAGATCATCGAC	Extension primer

Example 2 sample DNA extraction

The extracted 5ml blood was collected in a vacuum blood collection tube containing 3.2% trisodium citrate and lithium heparin, and left to stand for at least 6 hours. The tube was inverted 3-5 times to ensure adequate mixing of the blood with the anticoagulant. By usingDNA extraction is carried out by a DNA Mini Kit (250) Kit; the DNA concentration is measured in a Saimerfi NanoDrop 2000 ultramicro ultraviolet spectrophotometer; when the sample is measured, three values of concentration, 260/280 and 260/230 need to be recorded, so that the concentration does not meet the requirement of searching possible pollution reasons, and simultaneously, laboratory staff is required to split the DNA sample, so that the times of sample freeze thawing are reduced in the experimental process, and the high quality of the DNA is ensured. And then diluting the extracted sample to 10-20 ng/mu L by using deionized water so as to meet the basic requirement of quality control of a subsequent genotyping sample.

Example 3 biological experiments

Detecting the gene polymorphism of VKORC1 gene and warfarin drug effect according to the instruction by using ABI 9700 type PCR instrument; the reagents involved are shown in table 2:

TABLE 2

Serial number	Reagent	Principal Components	X number of sample size
				1	PCR primer mixture	PCR primer	1*1.1X
2	PCR reaction solution	Taq enzyme, dNTP, PCR buffer	4*1.1X
				3	Enzyme digestion reaction solution	SAP enzyme, SAP buffer	2*1.1X
4	Extension primer mixture	Extension primer	0.94*1.1X
				5	Extension reaction solution	Termination mix, single base elongase	2*1.1X
6	Quality control sample	Human genome DNA (20 ng/. mu.L)	1*1.1X

1. And (3) PCR reaction conditions: at 95 ℃ for 2 min; 45 cycles (95 ℃, 30 s; 56 ℃, 30 s; 72 ℃, 60 s); 72 ℃ for 5 min.

2. SAP digestion reaction conditions: at 37 ℃ for 40 min; 85 ℃ for 5 min.

3. UEP extension reaction conditions: 30s at 94 ℃; 40 external cycles (94 ℃, 5 s; 5 internal cycles (52 ℃, 5 s; 80 ℃, 5 s)); 72 ℃ for 3 min.

4. And (3) purification: add 16. mu.L of DI water to each tube extension, add MassARRAY kit resin until well mixed and centrifuge.

5. Sample application: using a micropipette, 1. mu.L of the purified product was spotted onto the target slide.

6. And (3) computer detection: 24 needles of the sample application mechanical arm are cleaned by NaOH; sample application; and (4) detecting by mass spectrometry.

Analysis shows that the VKORC1rs9934438SNP site has statistical significance with warfarin drug dose, thereby showing significant individual difference (P <0.0001) (Table 3).

TABLE 3

Therefore, the difference of the VKORC1rs9934438 site polymorphism distribution in Chinese Han people and the corresponding difference of warfarin drug dosage are shown, and the individual difference is statistically significant.

In conclusion, the invention provides theoretical and prognostic foundation for VKORC1rs9934438 gene polymorphism and clinical guiding medication in cardiovascular and cerebrovascular populations in China, and lays genetic foundation for individualized pharmacogenomics.

The foregoing description of specific embodiments of the present invention has been presented. It is to be understood that the present invention is not limited to the above-described embodiments, and those skilled in the art can make various changes or modifications within the scope of the appended claims without affecting the spirit of the invention.

Sequence listing

<110> Shanghai university of transportation

<120> kit for detecting Huafa drug effect by rs9934438

<130> DAG41296

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgttggatg gtgatttcca agaagccacc 30

<210> 2

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acgttggatg agatgaaaag cagggcctac 30

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtgccaggag atcatcgac 19

Claims (10)

1. A primer group for SNP detection of genes related to individualized administration of warfarin, comprising: PCR primers with sequences shown as SEQ ID No.1 and SEQ ID No. 2 and extension primers with sequences shown as SEQ ID No. 3 are used for detecting VKORC1rs9934438SNP sites in peripheral blood DNA.

2. A kit for SNP detection of genes related to individualized administration of warfarin, which comprises the primer set of claim 1.

3. The kit of claim 2, further comprising a detection reagent, a detection chip, and a detection carrier.

4. The kit of claim 3, wherein the detection reagents comprise a PCR mix reaction, an SAP enzyme mix reaction, and a UEP extension mix reaction.

5. The kit of claim 3, further comprising a resin for purification, a target for spotting and mass spectrometric detection, and a human genomic DNA extraction reagent.

6. A method for the non-diagnostic use of the kit for the SNP detection of genes related to the individualized administration of warfarin according to claim 2, characterized in that it comprises the following steps:

s1, performing PCR primer dilution and UEP extension primer dilution by using the primer group;

s2, PCR reaction;

s3, SAP digestion reaction;

s4, UEP extension reaction;

s5, purifying resin.

7. The use of the method according to claim 6, wherein in step S2, the PCR mixture solution used in the PCR reaction comprises deionized water, PCR Buffer, and MgCl₂dNTPs, heat-resistant Taq DNA polymerase and an amplification primer mix.

8. The use of claim 6, wherein in step S3, the SAP digestion reaction uses an SAP enzyme mix reaction solution comprising deionized water, SAP Buffer, and SAP enzyme.

9. The use method according to claim 6, wherein in step S4, the UEP extension reaction uses UEP extension mix reaction solution containing deionized water, Gold Buffer, Termination mix, UEP primer mix and high temperature resistant extension enzyme.

10. The use of claim 6, wherein in step S5, the purification resin is dropped into the single base extension product obtained in step S4.