CN110592193A - Detection method and kit for transgenic herbicide-resistant exogenous gene based on LAMP technology - Google Patents
Detection method and kit for transgenic herbicide-resistant exogenous gene based on LAMP technology Download PDFInfo
- Publication number
- CN110592193A CN110592193A CN201910894267.2A CN201910894267A CN110592193A CN 110592193 A CN110592193 A CN 110592193A CN 201910894267 A CN201910894267 A CN 201910894267A CN 110592193 A CN110592193 A CN 110592193A
- Authority
- CN
- China
- Prior art keywords
- lamp
- primer
- resistant
- transgenic herbicide
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to a method for identifying the authenticity of related components of transgenic corn, and particularly relates to a method for detecting exogenous herbicide-resistant bar genes and pat genes of transgenic corn by using a loop-mediated isothermal amplification (LAMP) technology. According to the method, specific LAMP primers are designed according to the exogenous herbicide-resistant bar gene and pat gene of the transgenic corn, and a matched kit, a detection method and application are provided. The invention combines a visual report mode and uses a neutral red pH indicator to carry out colorimetric detection, thereby realizing one-step visual colorimetric detection. The method is carried out under the isothermal condition, does not need precise temperature changing equipment, is convenient, accurate and high in resolution, does not need to open a cover in the detection process, and is suitable for on-site rapid detection.
Description
Technical Field
The invention belongs to a method for detecting and identifying related components of transgenes, and particularly relates to a method for respectively detecting exogenous bar genes and pat genes of transgenic herbicide resistance by using LAMP technology.
Background
Since the first acquisition of transgenic plants in 1983, transgenic technologies (GMOs) have been rapidly developed and applied to various fields such as agriculture, medicine, industry, and the like. In 1996, transgenic crops began to be commercially planted, and the planting area of global transgenic crops increased year by year. However, the transgenic crops have been controversial for risks of human health, ecological environment and the like, and in order to regulate and manage the transgenic crops and guarantee the awareness of consumers, all the countries in the world strive to make corresponding laws and regulations so as to strengthen the management of the transgenic crops and the products thereof. Therefore, it is urgently needed to establish a set of rapid, simple, convenient and accurate detection method and establish a transgenic organism safety detection technical system so as to meet the daily on-site rapid detection requirements of related inspection institutions.
With the development of molecular biology techniques, many detection methods targeting DNA molecules have been widely used. At present, the methods for detecting transgenic crops mainly comprise a qualitative PCR method, a real-time fluorescent quantitative PCR method (RT-PCR), a loop-mediated isothermal amplification technology (LAMP) and the like. The qualitative PCR technology is complex to operate, the real-time fluorescence quantitative PCR method is high in detection cost, and both methods are difficult to realize field detection. The loop-mediated isothermal amplification (LAMP) technology is a nucleic acid in-vitro amplification technology which is carried out under isothermal conditions, shows higher sensitivity and amplification efficiency in shorter reaction time, and currently, the LAMP method is one of the most commonly used isothermal amplification means. However, the conventional LAMP reaction product analysis means is a real-time fluorescence reporting mode and a terminal fluorescence/turbidity reporting method, and special detection equipment is required, so that the LAMP reaction product analysis means is also difficult to be suitable for field rapid screening. In recent years, visual analysis methods have shown advantages in rapid field testing. The visual dye colorimetric analysis improves the recognition rate of naked eyes, is simpler to operate, can be directly used for rapid field detection under the condition of ensuring the accuracy rate of the visual dye colorimetric analysis, reports that neutral red (N-red) of a pH indicator is used as a one-step visual reporting method, and has greater advantages in the field of field rapid detection of the LAMP technology.
Disclosure of Invention
The invention aims to provide LAMP primers, a kit, a detection method and application for detecting transgenic herbicide-resistant exogenous bar genes and pat genes based on LAMP technology.
The specific LAMP primer for detecting the transgenic herbicide-resistant exogenous bar gene is designed according to a conserved region of a DNA sequence of the transgenic herbicide-resistant exogenous bar gene. LAMP primers are designed by finding transgenic herbicide-resistant exogenous bar genes from GeneBank. The nucleotide sequence is shown as follows:
outer primer barB 3: AGGTGGACGGCGAGGT
Outer primer barF 3: TGCATGCGCACGCTC
Inner primer barBIP: TGGCGGGGGGAGACGTACAGGGTCCCTGGAAGGCA
Inner primer barFIP: TGCTGAAGTCCCTGGAGGCACAGTTGGGCAGCCCGATG
Loop primer barLB: CGGTTGACTCGGCCGTCCAGTCGTAGGCGTTGCG
Loop primer barLF: GGGCTTCAAGAGCGTGGTCGCTGT are provided.
The specific LAMP primer designed by the transgenic herbicide-resistant exogenous pat gene is designed according to the sequence of the transgenic herbicide-resistant exogenous pat gene. LAMP primers are designed by finding out exogenous cry1Ab genes in transgenic Bt176 from GeneBank. The nucleotide sequence is shown as follows:
outer primer patB 3: GGTAACTGGCCTAACTGGC
Outer primer patF 3: GGCGCAAGGTTTTAAGTCTG
Inner primer patBIP: ATTGCGCGCAGCTGGATACAA-GGAGGAGCTGGCAACTCA
Inner primer patFIP: TACCCCGGGCTGTGTATCCC-ATAGGCCTTCCAAACGATCC
The loop primer patLB: GCATGGTGGATGGCATGATGTTGGTTTTTGGCAAAGGGA
Loop primer patLF: AAGCCTCATGCAACCTAACAGAT are provided.
The basic detection kit for detecting the transgenic herbicide-resistant exogenous bar gene or pat gene based on the LAMP technology comprises LAMP outer primers, inner primers, DNA polymerase, dNTPs, betaine, 10x LAMP reaction buffer solution and deionized water of the corresponding genes.
The kit for detecting the transgenic herbicide-resistant exogenous bar gene or pat gene based on LAMP technology also comprises LAMP outer primers, inner primers, loop primers, DNA polymerase, dNTPs, betaine, 10xLAMP reaction buffer solution and deionized water of the corresponding genes.
The basic detection kit or the accelerated detection kit for detecting the transgenic herbicide-resistant exogenous bar gene or pat gene based on the LAMP technology can also comprise a signal reporter molecule for indicating the detection result: where the result is indicated by a fluorescent signal, the signal reporter may be a fluorescent molecule such as SYBR Green I; where the result is indicated by a macroscopic colorimetric signal, the signal reporter may be hydroxynaphthol blue or neutral red, or the like.
Preferably, the 10xLAMP reaction buffer comprises 200mmol/L Tris-HCl (pH8.8), 600mmol/L KCl, 80mmol/L MgSO4，100mmol/L(NH4)2SO4，1％Triton X-100。
Particularly, when neutral red is used as the signal reporter, the preferable reaction buffer solution includes 50mmol/L Tris-HCl (pH8.8), 600mmol/L KCl, and 80mmol/L MgSO4，100mmol/L(NH4)2SO4，1％Triton X-100。
The invention relates to a detection method of a transgenic herbicide-resistant exogenous bar gene or pat gene based on LAMP technology, which comprises the following detection steps:
(1) extracting DNA of a sample to be detected;
(2) taking the DNA extracted in the step (1) as a template, and selecting the LAMP primer or kit of the transgenic herbicide-resistant exogenous bar gene or pat gene to carry out LAMP reaction;
(3) analyzing LAMP amplification products: if the amplification signal exists, the sample to be detected contains related gene components corresponding to the primer or the kit; and if no amplification signal exists, the sample to be detected does not contain corresponding related gene components.
The LAMP reaction of the LAMP technology-based detection method for the transgenic herbicide-resistant exogenous bar gene or pat gene can adopt a basic amplification reaction system (comprising an LAMP outer primer, an inner primer, DNA polymerase, dNTPs, betaine, 10x LAMP reaction buffer solution and deionized water) or an accelerated amplification reaction system (comprising an LAMP outer primer, an inner primer, a loop primer, DNA polymerase, dNTPs, betaine, 10x LAMP reaction buffer solution and deionized water).
The basic amplification reaction system is preferably:
when a real-time fluorescent reporter system is used, the concentration of the added fluorescent dye SYBR Green I is 1/50000; when a colorimetric reporter system is used, the concentration of neutral red added as a pH indicator is 100 mu mol/L;
finally make up to 25 μ L with ddH 2O.
The above-mentioned system for accelerating amplification reaction is preferably:
when a real-time fluorescent reporter system is used, the concentration of the added fluorescent dye SYBR Green I is 1/50000; when a colorimetric reporter system is used, the concentration of neutral red added as a pH indicator is 100 mu mol/L;
finally using ddH2Make up to 25. mu.L of O.
According to the detection kit and the detection method for detecting the transgenic herbicide-resistant exogenous bar or pat gene based on the LAMP technology, when the result is indicated by macroscopic colorimetric signals, when the signal reporter molecules are neutral red, yellow is a negative result, and pink is a positive result.
As used herein, the following words/terms have the following meanings, unless otherwise specified.
"DNA": deoxyribonucleic acid. Is a biological macromolecule with genetic information, is formed by connecting 4 main deoxyribonucleotides through 3 ', 5' -phosphodiester bonds, and is a carrier of the genetic information.
"LAMP": loop-mediated isothermal amplification. The method is a technology for in vitro isothermal amplification of DNA specific fragments, the amplification process is divided into an initial product forming stage and a cyclic amplification stage, and finally DNA macromolecular fragments with a large number of inverted repeat sequences are generated.
The invention has obvious advantages over the prior art, and the main advantages thereof comprise:
1. specificity. The primers for detecting the transgenic herbicide-resistant exogenous bar or pat genes based on the LAMP technology are designed according to the DNA sequences published in GenBank, and experimental results show that the specificity of each primer combination is good, and the target components can be accurately detected.
2. And (4) rapidity. The method of the invention is very quick in detection, and the detection result can be obtained within at most 1 h.
3. And (5) practicability. The method for detecting the relevant components of the transgenosis only needs a simple thermostat, so the method is more suitable for quick detection on site.
4. And (4) economy. When the kit is combined with a neutral red pH indicator for colorimetric detection, primers and probe sequences are not required to be modified, the synthesis is convenient, and one-step visual colorimetric detection can be realized, so that the detection cost is greatly reduced.
Drawings
FIG. 1 shows the results of the specific test of the transgenic herbicide-resistant exogenous bar gene detection method in example 1 (tube 1: transgenic maize Bt176 DNA template; tube 2: non-transgenic maize DNA template).
FIG. 2 shows the results of the specificity test of the method for detecting transgenic herbicide-resistant exogenous pat genes in example 2 (tube 1: transgenic maize 59122DNA template; tube 2: transgenic maize TC1507 DNA template; and tube 3: non-transgenic maize DNA template).
Detailed Description
The invention will be further illustrated by way of example with reference to the accompanying drawings. It will be understood by those skilled in the art that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.
Example 1 specificity test of herbicide-resistant exogenous bar Gene detection method
(1) Sample DNA was extracted according to the DNA extraction kit instructions.
And (3) performing LAMP reaction by using DNA extracted from 1 part of non-transgenic corn sample and 1 part of transgenic corn Bt176 sample as templates.
(2) The LAMP primer of the herbicide-resistant exogenous bar gene detection method has the following primer sequence:
outer primer barB 3: AGGTGGACGGCGAGGT
Outer primer barF 3: TGCATGCGCACGCTC
Inner primer barBIP: TGGCGGGGGGAGACGTACAGGGTCCCTGGAAGGCA
Inner primer barFIP: TGCTGAAGTCCCTGGAGGCACAGTTGGGCAGCCCGATG
Loop primer barLB: CGGTTGACTCGGCCGTCCAGTCGTAGGCGTTGCG
Loop primer barLF: GGGCTTCAAGAGCGTGGTCGCTGT are provided.
(3) LAMP reaction system and reaction conditions
When a real-time fluorescent reporter system is used, the concentration of the added fluorescent dye SYBR Green I is 1/50000; when using a colorimetric reporter, the pH indicator neutral Red was added at a concentration of 100. mu. mol/L.
Finally, the reaction system was made up to 25. mu.L with ultrapure water.
The LAMP reaction conditions are as follows: react at 61 ℃ for 1 h.
Negative Controls (NC) were: ultrapure water corresponding to the volume of the template was added to the reaction tube.
(4) Detection method
When the neutral red is used for colorimetric analysis, the whole reaction is placed in a thermostat or a water bath kettle for reaction for 1 hour and then directly taken out for visual observation.
(5) The result of the detection
As shown in the attached figure 1, the method is used for simultaneously amplifying DNA of a non-transgenic corn sample and a transgenic corn Bt176 sample. In a neutral red visualization system, after the reaction is carried out for 1 hour, the transgenic corn Bt176 standard reaction tube has a pink positive amplification result, but the non-transgenic corn still has a yellow negative result. The method for detecting the herbicide-resistant exogenous bar gene established in the research has good accuracy.
Example 2 specificity test of herbicide-resistant exogenous pat Gene detection method
(1) Sample DNA was extracted according to the DNA extraction kit instructions.
And performing LAMP reaction by using DNA extracted from 1 part of non-transgenic corn sample, 1 part of transgenic corn 59122 sample and 1 part of transgenic corn TC1507 sample as templates.
(2) The LAMP primer of the herbicide-resistant exogenous pat gene detection method has the following primer sequence:
outer primer patB 3: GGTAACTGGCCTAACTGGC
Outer primer patF 3: GGCGCAAGGTTTTAAGTCTG
Inner primer patBIP: ATTGCGCGCAGCTGGATACAA-GGAGGAGCTGGCAACTCA
Inner primer patFIP: TACCCCGGGCTGTGTATCCC-ATAGGCCTTCCAAACGATCC
The loop primer patLB: GCATGGTGGATGGCATGATGTTGGTTTTTGGCAAAGGGA
Loop primer patLF: AAGCCTCATGCAACCTAACAGAT are provided.
(3) LAMP reaction system and reaction conditions
When a real-time fluorescent reporter system is used, the concentration of the added fluorescent dye SYBR Green I is 1/50000; when a colorimetric reporter system is used, the concentration of neutral red added as a pH indicator is 100 mu mol/L;
finally, the reaction system was made up to 25. mu.L with ultrapure water.
The LAMP reaction conditions are as follows: react at 61 ℃ for 1 h.
Negative Controls (NC) were: ultrapure water corresponding to the volume of the template was added to the reaction tube.
(4) Detection method
When the neutral red is used for colorimetric analysis, the whole reaction is placed in a thermostat or a water bath kettle for reaction for 1 hour and then directly taken out for visual observation.
(5) The result of the detection
As shown in the attached figure 2, the method is used for simultaneously amplifying DNA of a non-transgenic corn sample, a transgenic corn 59122 sample and a transgenic corn TC1507 sample. In a neutral red visualization system, after the reaction is carried out for 1 hour, pink positive amplification results appear in reaction tubes of a transgenic corn 59122 standard product and a transgenic corn TC1507 standard product, but non-transgenic corn still has yellow negative results. The method for detecting the herbicide-resistant exogenous pat gene established in the research has good accuracy.
Claims (21)
1. The LAMP technology-based specific LAMP primer of the transgenic herbicide-resistant exogenous bar gene is characterized in that: the design is carried out according to the specificity of the transgenic herbicide-resistant exogenous bar gene.
2. The specific LAMP primer of the transgenic herbicide-resistant exogenous bar gene as claimed in claim 1, which is characterized in that: comprises an outer primer, an inner primer and a loop primer, and preferably comprises the following components:
outer primer barB 3: AGGTGGACGGCGAGGT
Outer primer barF 3: TGCATGCGCACGCTC
Inner primer barBIP: TGGCGGGGGGAGACGTACAGGGTCCCTGGAAGGCA
Inner primer barFIP: TGCTGAAGTCCCTGGAGGCACAGTTGGGCAGCCCGATG
Loop primer barLB: CGGTTGACTCGGCCGTCCAGTCGTAGGCGTTGCG
Loop primer barLF: GGGCTTCAAGAGCGTGGTCGCTGT are provided.
3. A basic detection kit for detecting transgenic herbicide-resistant exogenous bar genes based on LAMP technology is characterized in that: comprises the LAMP outer primer and the LAMP inner primer of claim 2.
4. An accelerated detection kit for detecting transgenic herbicide-resistant exogenous bar genes based on LAMP technology is characterized in that: comprises the LAMP outer primer, the LAMP inner primer and the LAMP loop primer of claim 2.
5. The LAMP technology-based specific LAMP primer of the transgenic herbicide-resistant exogenous pat gene is characterized by comprising the following steps: designed according to the specificity of the transgenic herbicide-resistant exogenous pat gene.
6. The specific LAMP primer of the transgenic herbicide-resistant exogenous pat gene as claimed in claim 5, which is characterized in that: comprises an outer primer, an inner primer and a loop primer, and preferably comprises the following components:
outer primer patB 3: GGTAACTGGCCTAACTGGC
Outer primer patF 3: GGCGCAAGGTTTTAAGTCTG
Inner primer patBIP: ATTGCGCGCAGCTGGATACAA-GGAGGAGCTGGCAACTCA
Inner primer patFIP: TACCCCGGGCTGTGTATCCC-ATAGGCCTTCCAAACGATCC
The loop primer patLB: GCATGGTGGATGGCATGATGTTGGTTTTTGGCAAAGGGA
Loop primer patLF: AAGCCTCATGCAACCTAACAGAT are provided.
7. A basic detection kit for detecting transgenic herbicide-resistant exogenous pat genes based on LAMP technology is characterized in that: comprises the LAMP outer primer and the LAMP inner primer of claim 6.
8. An accelerated detection kit for detecting transgenic herbicide-resistant exogenous pat genes based on LAMP technology is characterized in that: comprises the LAMP outer primer, the LAMP inner primer and the LAMP loop primer of claim 6.
9. The test kit according to claim 3 or 4 or 7 or 8, characterized in that: also comprises DNA polymerase, dNTPs, 10 × LAMP reaction buffer solution and deionized water.
10. The test kit according to claim 3 or 4 or 7 or 8, characterized in that: a signal reporter molecule can be further included for indicating the detection result, and when the result is indicated by a fluorescent signal, the signal reporter molecule can be a fluorescent molecule such as SYBR GreenI; the signal reporter may be hydroxynaphthol blue or neutral red, as indicated by a macroscopic colorimetric signal.
11. The 10x LAMP reaction buffer according to claim 9, characterized in that: preferably 200mM Tris-HCl (pH8.8), 600mM KCl, 80mM MgSO4，100mM(NH4)2SO4，1％Triton X-100。
12. The 10x LAMP reaction buffer according to claim 9, characterized in that: when neutral red is used as the signal reporter, 50mM Tris-HCl (pH8.8), 600mM KCl, 80mM MgSO4，100mM(NH4)2SO4，1％ Triton X-100。
13. The detection method of the transgenic herbicide-resistant gene based on the LAMP technology is characterized by comprising the following steps:
(1) extracting DNA of a sample to be detected;
(2) taking the DNA extracted in the step (1) as a template, and selecting the LAMP primer of the transgenic herbicide-resistant gene of claim 1, 2, 5 or 6 or the kit of claim 3, 4, 7 or 8 to perform LAMP reaction;
(3) analyzing LAMP amplification products: if the amplification signal exists, the sample to be detected contains related gene components corresponding to the primer or the kit; and if no amplification signal exists, the sample to be detected does not contain corresponding related gene components.
14. The LAMP technology-based detection method of transgenic herbicide-resistant genes as claimed in claim 13, which is characterized in that: the LAMP reaction can adopt a basic amplification reaction system (comprising LAMP outer primers, inner primers, DNA polymerase, dNTPs, betaine, 10x LAMP reaction buffer solution and deionized water) or an accelerated amplification reaction system (comprising LAMP outer primers, inner primers, loop primers, DNA polymerase, dNTPs, betaine, 10x LAMP reaction buffer solution and deionized water).
15. The basic amplification reaction system of claim 14, wherein: the system is preferably such that,
when a real-time fluorescent reporter system was used, the concentration of the fluorochrome SYBR Green I added was 1/50000; when a colorimetric reporter system is used, the concentration of neutral red added as a pH indicator is 100 mu mol/L; finally using ddH2Make up to 25. mu.L of O.
16. The system for accelerating amplification according to claim 14, wherein: the system is preferably such that,
when a real-time fluorescent reporter system was used, the concentration of the fluorochrome SYBR Green I added was 1/50000; when a colorimetric reporter system is used, the concentration of neutral red added as a pH indicator is 100 mu mol/L; finally using ddH2Make up to 25. mu.L of O.
17. The detection kit according to any one of claims 3, 4, 7 or 8 or the LAMP technology-based method for detecting a transgenic herbicide-resistant gene according to claim 13, wherein: the reaction temperature is 55-65 ℃, and the reaction time is at most 1 h.
18. The detection kit according to any one of claims 3, 4, 7 or 8 or the LAMP technology-based method for detecting a transgenic herbicide-resistant gene according to claim 13, wherein: when the result is indicated by a macroscopic colorimetric signal, when the signal reporter is neutral red, yellow is a negative result, and pink is a positive result.
19. Use of the specific LAMP primer of any one of claims 1 or 2 or 5 or 6.
20. Use of the test kit according to any one of claims 3 or 4 or 7 or 8.
21. Use of the LAMP technology-based method for detecting a transgenic herbicide-resistant gene according to claim 13.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910894267.2A CN110592193A (en) | 2019-09-20 | 2019-09-20 | Detection method and kit for transgenic herbicide-resistant exogenous gene based on LAMP technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910894267.2A CN110592193A (en) | 2019-09-20 | 2019-09-20 | Detection method and kit for transgenic herbicide-resistant exogenous gene based on LAMP technology |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110592193A true CN110592193A (en) | 2019-12-20 |
Family
ID=68861945
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910894267.2A Pending CN110592193A (en) | 2019-09-20 | 2019-09-20 | Detection method and kit for transgenic herbicide-resistant exogenous gene based on LAMP technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110592193A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106367520A (en) * | 2016-10-18 | 2017-02-01 | 中国农业大学 | Transgenic maize BT176 detection method based on loop-mediated isothermal amplification extinction technology |
| CN106755545A (en) * | 2017-03-11 | 2017-05-31 | 吉林省农业科学院 | The LAMP detection primer group of pat gene, kit and detection method in genetically modified crops |
| US20190119722A1 (en) * | 2015-12-08 | 2019-04-25 | Shanghai Jiao Tong University | High-throughput and rapid nucleic acids detection method based on capillary microarrays |
-
2019
- 2019-09-20 CN CN201910894267.2A patent/CN110592193A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20190119722A1 (en) * | 2015-12-08 | 2019-04-25 | Shanghai Jiao Tong University | High-throughput and rapid nucleic acids detection method based on capillary microarrays |
| CN106367520A (en) * | 2016-10-18 | 2017-02-01 | 中国农业大学 | Transgenic maize BT176 detection method based on loop-mediated isothermal amplification extinction technology |
| CN106755545A (en) * | 2017-03-11 | 2017-05-31 | 吉林省农业科学院 | The LAMP detection primer group of pat gene, kit and detection method in genetically modified crops |
Non-Patent Citations (5)
| Title |
|---|
| CONG WANG等: "GMO detection in food and feed through screening by visual loop-mediated isothermal amplification assays", 《ANAL BIOANAL CHEM》 * |
| MONIKASINGH等: "Real-time and visual loop-mediated isothermal amplification: Efficient GMO screening targeting pat and pmi marker genes", 《FOOD CONTROL》 * |
| 张苗: "转基因产品快速、高通量检测方法研究", 《中国优秀硕士学位论文全文数据库农业科技辑》 * |
| 李荣: "环介导等温扩增技术对外源转基因成分检测及其协同验证", 《中国优秀硕士学位论文全文数据库医药卫生科技辑》 * |
| 胡银岗主编: "《植物基因工程》", 28 February 2006, 西北农林科技大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108060257B (en) | Primer composition for detecting pythium androsaceus based on loop-mediated isothermal amplification technology and detection method thereof | |
| CN113186313A (en) | Salmonella detection primer group, method and kit based on RPA-LbCas12a-TTECDS system | |
| CN104789658B (en) | A kind of ring isothermal duplication primer of quick detection citrus Tylenchulus Semipenetrans and its application | |
| AU2020102244A4 (en) | Primer group, kit and detection method for rapidly detecting carbapenemases genes | |
| CN107177700A (en) | A kind of LAMP primer group, kit and detection method for detecting cucumber mosaic virus | |
| CN107345246B (en) | Diatom rbcL gene analysis method and application thereof in forensic detection | |
| CN115109859A (en) | Multi-mode composite functional helicobacter pylori nucleic acid detection test paper | |
| CN111607658A (en) | Primer probe system, kit and detection method for human fungal infection detection | |
| CN110564822B (en) | LAMP technology-based transgenic corn Bt 176-related gene detection method and kit | |
| CN116516058A (en) | Method and kit for visually detecting phytophthora sojae | |
| CN109097449B (en) | Real-time fluorescence LAMP detection method and kit based on metal ruthenium complex | |
| CN116516036A (en) | Primer and probe combination for detecting Pantoea ananatis by LAMP method and application | |
| CN103773867A (en) | LAMP detection primer group of cry2Ab gene in transgenic crop and detection kit as well as detection method | |
| CN114231603B (en) | Primer, reagent, identification method and kit for identifying paeonia boita | |
| CN110592193A (en) | Detection method and kit for transgenic herbicide-resistant exogenous gene based on LAMP technology | |
| CN110079632A (en) | A kind of InDel Molecular marker kit of single 609 purity detectings in corn variety Shan | |
| CN108384884A (en) | One group of corn SSR molecular marker and its application | |
| CN104328209A (en) | Primer and kit for fast detection method of leukemia minimal residual disease WT1 gene | |
| CN114350786A (en) | For detecting HLA-B15: primer group of 02 allele and application thereof | |
| CN110804674B (en) | Primer probe composition and kit for detecting soybean root rot based on recombinase polymerase amplification method and application of primer probe composition and kit | |
| CN109504744B (en) | Multiplex loop-mediated isothermal nucleic acid amplification detection method and kit based on high-resolution fusion | |
| CN114164296B (en) | Primer probe composition for detecting pythium oligandrum, kit and application and detection method | |
| CN117511935B (en) | LAMP (loop-mediated isothermal amplification) detection primer and rapid detection method for pepper anthracnose based on TUB2 | |
| CN111118118B (en) | Rate type ctDNA quantitative detection method | |
| CN117511934B (en) | LAMP (loop-mediated isothermal amplification) detection primer and rapid detection method for pepper anthracnose based on SOD2 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20191220 |
|
| WD01 | Invention patent application deemed withdrawn after publication |