CN110577979B - Rapid screening method of aptamer based on crosslinking reaction and structure switch type aptamer obtained through screening - Google Patents
Rapid screening method of aptamer based on crosslinking reaction and structure switch type aptamer obtained through screening Download PDFInfo
- Publication number
- CN110577979B CN110577979B CN201810589689.4A CN201810589689A CN110577979B CN 110577979 B CN110577979 B CN 110577979B CN 201810589689 A CN201810589689 A CN 201810589689A CN 110577979 B CN110577979 B CN 110577979B
- Authority
- CN
- China
- Prior art keywords
- library
- screening
- magnetic beads
- round
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
Abstract
The invention relates to a novel method for rapidly screening aptamer based on cross-linking reaction and a structural switch type aptamer of human serum albumin obtained by screening through the method. In the method, a target and a nucleic acid aptamer library are subjected to homogeneous incubation, and then the target is captured on magnetic beads through a cross-linking reaction, so that a nucleic acid sequence combined with the target is captured on the magnetic beads; amplifying the magnetically isolated target-bound nucleic acid sequence by Polymerase Chain Reaction (PCR); and (3) carrying out single-chain preparation on the double-chain PCR product to obtain a secondary library, and screening the secondary library in the next round. The process is circulated for 2-3 rounds to realize the rapid enrichment of the library. The method can be used together with other screening technologies, so that the screening efficiency is greatly improved. According to the method, the library after 3 rounds of enrichment is subjected to only 1 round of screening method based on library fixation to obtain SSA of HSA with high affinity and selectivity.
Description
Technical Field
The invention relates to a rapid screening method of aptamers based on a crosslinking reaction and a structure switch type aptamer of human serum albumin obtained by screening, belonging to the technical field of biology.
Background
The screening technique of aptamer, namely Enrichment ligand Evolution (Systematic Evolution of ligand by expression Evolution, SELEX) (Nature,1990,346(6287), 818-822; Science,1990,249(4968),505-510.) is an in vitro screening technique of aptamer based on in vitro synthesis of library, Polymerase Chain Reaction (PCR) and sequencing. The basic principle of SELEX technology is to incubate an oligonucleotide (DNA or RNA) library with a specific target molecule, separate the oligonucleotide bound to the target molecule by a separation technique, perform exponential amplification by a PCR technique, prepare a secondary library by single-stranded the obtained product, and restart a new round of screening using the secondary library as the initial library of the next round. Through multiple rounds of screening processes, the aptamer with high affinity and high specificity is finally obtained.
The SELEX technique has been widely used in various fields since its introduction. However, the traditional SELEX technology is cumbersome to operate and has a long screening period. In order to accelerate the process of screening for aptamers, various improved SELEX techniques have been developed in recent years, shortening the screening cycle. These improved techniques have mostly replaced traditional affinity column or cellulose acetate membrane based separation techniques with more efficient or convenient separation methods by improving the separation steps in the SELEX process. These improved methods include: magnetic bead separation (Nucleic Acids Research 2003,31(18), e110-e118.), capillary electrophoresis (Analytical Chemistry 2004,76(18), 5387. times. 5392.), gel electrophoresis (Nucleic Acids Research 2005,33(17), e141-e147.), microfluidic chip method (Proc. Natl. acid. Sci. U.S.A.2009,106,2989-2994.), surface plasmon resonance (Analytical Biochemistry 2005,342, 312. times. 317). Although various aptamer screening techniques have been developed in recent years, screening of aptamers is still challenging and often faces the problem of screening failure, and new screening techniques are urgently needed.
Among the current various aptamer screening technologies, the method based on target immobilization is most widely applied due to its convenient operation. However, in the method for screening the aptamer for immobilizing the target molecule, the solid phase matrix has serious non-specific adsorption, and the target is immobilized on the solid phase surface to mask the binding site of the target, so that the conformation of the target is influenced, and great uncertainty is caused. These factors all contribute to inefficient and even failure of aptamer screening. The method of screening for homogeneous aptamers avoids such problems by not requiring immobilization of the target molecule to a solid phase medium, but rather incubating the library directly with the target molecule in solution followed by isolation. Because the target molecules are in a free state in the screening process, which is the same as the state in an actual sample, the aptamer obtained by the homogeneous screening technology is theoretically more suitable for later application. Current homogeneous aptamer screening techniques include capillary electrophoresis (Journal of the American Chemical Society 2005,127(9), 3165-.
Although homogeneous aptamer screening methods overcome the problems of traditional methods of aptamer screening for immobilized target molecules, they still have certain drawbacks. For example, capillary electrophoresis requires special equipment and specialized personnel, and high voltage also affects the properties of target proteins; the separation efficiency of membrane separation, centrifugal separation and electrophoretic separation is low, which results in low screening efficiency; the separation efficiency of graphene separation is greatly affected by the physical properties of targets and is difficult to control. There is an urgent need to develop homogeneous aptamer screening techniques that are simpler to operate, more efficient to separate, and more easily controlled.
In addition, while the structural switch type aptamer (SSA) is widely applied in the field of biosensing, the current methods for screening SSA are inefficient (proc.natl.acad.sci.u.s.a.2010,107,14053-14058.) and require 15-20 screening cycles, and the obtained aptamers have poor selectivity and low affinity, and the development of an efficient SSA screening technology is urgently needed.
Disclosure of Invention
The invention aims to provide a novel method for rapidly screening aptamers based on a crosslinking reaction, and the SSA of the obtained human serum albumin is screened by the method.
The invention provides a rapid screening method of a nucleic acid aptamer based on a crosslinking reaction, which comprises the following steps: step 1, library heat treatment; step 2, activating magnetic beads; step 3, magnetic bead negative screening; step 4, incubating the library and the target; step 5, capturing the nucleic acid sequence combined with the target through a cross-linking reaction; step 6, eluting the bound nucleic acid on the magnetic beads; step 7, PCR; and 8, preparing single-stranded DNA.
Wherein the above steps 1-8 are cycled for 2-3 rounds to achieve rapid enrichment of the library.
In the above-described method of the present invention,
step 1, library heat treatment as follows: taking a proper amount of library to carry out heat treatment in a buffer solution: heating in water bath at 95 ℃, quenching in ice bath, and standing at room temperature;
and 3, magnetic bead negative screening as follows: taking part of the NHS activated magnetic beads prepared in the step 2 to incubate with the library in the step 1, carrying out magnetic separation, and using a supernatant in the step 4;
step 7, PCR is as follows: carrying out PCR on the eluent obtained in the step 6, and purifying a PCR product by an ethanol precipitation method;
The method also comprises the following steps:
(1) 1-8, circulating for 2-3 rounds to realize the rapid enrichment of the library to form an enrichment library, and hybridizing and incubating the enrichment library with a biotin-modified probe which is complementary to a middle fixed sequence of the library;
(2) fixing the double-stranded library formed in the step (1) on streptavidin-coated magnetic beads;
(3) incubating the library fixed magnetic beads and the target, magnetically separating after the incubation is finished, and collecting supernatant;
(4) and (3) PCR: carrying out PCR on the supernatant obtained in the step (3), and purifying a PCR product by an ethanol precipitation method;
(5) cloning and sequencing;
(6) selecting a representative enrichment sequence for chemical synthesis;
(7) chemically synthesized sequences were tested for affinity, selectivity and functionality.
In another aspect, the present invention provides a method for rapid screening of aptamers based on a crosslinking reaction, the method comprising: a first round of screening of homogeneous Tb aptamers based on a crosslinking reaction, a second round of screening of homogeneous Tb aptamers based on a crosslinking reaction, a third round of screening of Tb aptamers based on a target immobilized magnetic bead method and a fourth round of screening of Tb aptamers based on a magnetic bead method,
wherein the first round of screening comprises the steps of:
(1) heat treatment of the starting DNA library;
(2) the library was incubated with Tb;
(3) activating the magnetic beads;
(4) incubating the magnetic beads with the DNA-Tb complex;
(5) DNA elution;
(6) performing small-scale PCR to obtain a gel electrophoresis result picture;
(7) selecting the optimal number of amplification rounds according to the gel electrophoresis result diagram in the step (6), and carrying out PCR amplification on all samples obtained in the step (5);
(8) after the PCR reaction is finished, mixing the obtained samples in pairs to ensure that the volume of each group of samples is 200 mu L, and carrying out ethanol precipitation;
(9) carrying out small-scale lambda Exo enzyme digestion;
(10) carrying out large-scale lambda Exo enzyme digestion;
(11) precipitating lambda Exo enzyme digestion products by using ethanol, wherein the operation process is the same as that of (8);
(12) the quantity of the ultraviolet light is determined,
wherein the second round of screening comprises the steps of:
(1) heat treatment of the enriched DNA library;
(2) incubation of the library and Tb, activation of magnetic beads, incubation of the magnetic beads and DNA-Tb compounds, DNA elution, PCR, lambda Exo enzyme digestion, ethanol precipitation and ultraviolet quantification are all screened according to the first round;
wherein the third round of screening comprises the steps of:
(1) activating the magnetic beads;
(2) coupling Tb to the surface of the magnetic beads;
(3) incubating the protein-coated magnetic beads with the enriched library;
(4) DNA elution;
(5) PCR, lambda Exo enzyme digestion, ethanol precipitation and ultraviolet quantification refer to the first round of screening,
wherein the fourth round of screening comprises the steps of:
(1) activating the magnetic beads and coupling Tb to the surfaces of the magnetic beads refer to the third screening (1) and (2);
(2) incubating the magnetic beads coated with the protein with DNA;
(3) DNA elution, PCR, lambda Exo digestion, ethanol precipitation and UV quantification were all referred to the third round of screening.
The method also comprises the following steps: clone sequencing and selecting representative sequences for chemical synthesis and affinity determination.
In still another aspect, the present invention provides a method for rapid screening of aptamers based on a crosslinking reaction, the method comprising: a first round of screening for a homogeneous HSA aptamer based crosslinking reaction, a second round of screening for a homogeneous HSA aptamer based crosslinking reaction, a third round of screening for a homogeneous HSA aptamer based crosslinking reaction, and a fourth round of screening for a library-immobilized SSA,
wherein the first round of screening comprises the steps of:
(1) heat treatment of the starting DNA library;
(2) activating the magnetic beads;
(3) magnetic bead negative screening;
(4) incubation of the library with HSA;
(5) activating the magnetic beads during incubation of the library with HSA;
(6) DNA elution;
(7)PCR；
(8) performing gel cutting purification on the first round screening product by using a UNIQ-10 column type PAGE gel DNA recovery kit;
wherein the second round of screening comprises the steps of:
(1) heat treatment of the starting DNA library;
(2) activating the magnetic beads;
(3) magnetic bead negative screening;
(4) incubation of the library with HSA;
(5) activating magnetic beads during incubation of library with HSA;
(6) DNA elution;
(7)PCR；
(8) cutting and purifying;
(9) lambda Exo enzyme digestion, ethanol precipitation and ultraviolet quantification,
wherein the third round of screening comprises the steps of:
the operation steps of the second round of enrichment library are the same as those of the second round of screening except that 0.048nmol of the second round of enrichment library is input,
wherein the fourth screening comprises the steps of:
(1) hybridizing the third round of products;
(2) cleaning the magnetic beads;
(3) fixing magnetic beads on the library;
(4) incubating library immobilized magnetic beads with HSA;
(5) PCR products are purified by a PCR and ethanol precipitation method, PCR products are purified by a UNIQ-10 column PAGE gel DNA recovery kit, single-chain generation is carried out by lambda Exo, lambda Exo enzyme digestion products are purified by an ethanol precipitation method, and ultraviolet quantification is carried out.
The method also comprises the following steps: cloning and sequencing; representative sequences were selected for chemical synthesis and affinity determination as well as selectivity and functionality testing.
In yet another aspect, the present invention provides a structurally switched aptamer screened according to any of the methods described above. The structural switch type aptamer is Tb-1, Tb-2, Tb-3, Tb-4, HSA-1, HSA-2, HSA-3, HSA-4, HSA-5 or HSA-6.
Specific Experimental procedures of the invention
One screening process of the method of the invention comprises the following steps:
1. library heat treatment: taking a proper amount of library to carry out heat treatment in a buffer solution: heating in water bath at 95 deg.c, quenching in ice bath, and setting at room temperature.
2. Activating magnetic beads: the magnetic beads modified by carboxyl are activated by N-hydroxysuccinimide (NHS) and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride (1-ethyl-3- (3-methylenepropyl) carbodiimide hydrochloride, EDC) to generate magnetic beads modified by NHS active ester.
3. And (3) magnetic bead negative screening: and (3) taking part of the NHS activated magnetic beads prepared in the step (2) to incubate with the library in the step (1), carrying out magnetic separation, and using the supernatant in the step (4).
4. Library and target incubation: and (4) mixing and incubating the library collected in the step (3) and the target according to a certain molar ratio in a screening buffer solution.
5. Capturing nucleic acid sequences bound to the target by a cross-linking reaction: and (4) incubating the NHS activated magnetic beads prepared in the step (2) with the library and target mixed solution in the step (4), carrying out magnetic separation, and washing the magnetic beads.
6. Elution of bound nucleic acids on magnetic beads: and (3) incubating a certain amount of proteinase K with the magnetic beads obtained in the step (5), or adding a buffer solution into the magnetic beads obtained in the step (5), heating, incubating, and collecting supernatant.
7. And (3) PCR: and (4) carrying out PCR on the eluent obtained in the step (6), and purifying a PCR product by an ethanol precipitation method.
8. Preparation of single-stranded DNA: single-strand preparation is carried out by using lambda phage exonuclease (lambda Exo), lambda Exo enzyme digestion products are purified by an ethanol precipitation method, and products in each round are quantified by ultraviolet. The resulting single stranded DNA library is a secondary library that is put into the next round of screening or sequencing by cloning.
And (4) circulating the steps from 1 to 8 for 2 to 3 rounds to realize the rapid enrichment of the library. The enriched library is subjected to the next stage of screening for aptamers, such as screening for SSA.
Screening for SSA comprises the following steps:
(1) hybridizing and incubating the enrichment library with a biotin-modified probe complementary to an intermediate immobilization sequence of the library;
(2) fixing the double-stranded library formed in the step (1) on streptavidin-coated magnetic beads;
(3) incubating library immobilized magnetic beads and a target, carrying out magnetic separation after incubation is finished, and collecting supernatant;
(4) and (3) PCR: carrying out PCR on the supernatant obtained in the step (3), and purifying a PCR product by an ethanol precipitation method;
(5) cloning and sequencing;
(6) selecting a representative enrichment sequence for chemical synthesis;
(7) chemically synthesized sequences were tested for affinity, selectivity and functionality.
The method of the invention has the following advantages:
1. the method does not need solid phase fixation of the target, overcomes the defect that the target is fixed on the solid phase in the prior screening technology, avoids the problems of surface fixation and shielding of target binding sites and influence on target conformation, greatly reduces non-specific adsorption of a solid phase medium to a library, and is very favorable for accelerating the screening efficiency of the aptamer;
2. according to the method, the nucleic acid sequence combined with the target is separated by a magnetic separation technology, expensive or special equipment is not needed, the operation is simple and rapid, and any condition optimization is not needed;
3. the method can be used for the pre-enrichment of the library, and the efficiency and the success rate of the screening technology of the existing aptamer are improved;
4. the method can be used for rapidly screening the SSA, and the obtained SSA has high selectivity and strong affinity.
Drawings
FIG. 1 is a schematic diagram of the method of the present invention.
FIG. 2 is a flowchart of a prior art target-immobilization-based aptamer magnetic bead screening method used in example 1 of the present invention.
FIG. 3 is a graph showing an affinity test of the thrombin aptamer Tb-2 obtained by screening in example 1 of the present invention.
FIG. 4 is a flow chart of SSA screening based on library immobilization as employed in example 2 of the present invention.
FIG. 5 is the percent elution of the first three homogeneous cross-linking reaction-based screens of example 2 determined using the real-time quantitative PCR technique (RT-PCR) of the present invention; the percent elution is the proportion of nucleic acid sequences in the library that bind to the target in the total input library.
FIGS. 6A and 6B are graphs of the ratio of nucleic acids in the supernatant of SSA screening after washing of each bead and incubation with target protein to the total input library (FIG. 6A) and melting temperatures of background and nucleic acids in the target incubators (FIG. 6B) as determined by RT-PCR in example 2 of the present invention.
FIG. 7 is a graph showing an affinity assay of HSA aptamer HSA-6 screened in example 2 of the present invention.
FIGS. 8A and 8B are graphs showing the structural switching performance and specificity of HSA-6 tested by the present invention, i.e., fluorescence method (FIG. 8A) and gel electrophoresis method (FIG. 8B); the fluorescence intensity of the supernatant after magnetic separation was measured in FIG. 8A; figure 8B gel electrophoresis of magnetically separated supernatants after incubation with different targets.
Detailed Description
FIG. 1 is a schematic diagram of the method of the present invention. As shown in fig. 1, each screening cycle comprises 1. library heat treatment; 2. activating the magnetic beads to generate magnetic beads modified by NHS active ester; 3. and (3) magnetic bead negative screening: NHS activated magnetic beads and the library in 1 are incubated, magnetically separated, and the nucleic acid sequence combined with the activated magnetic beads is removed; 4. incubating the library with a target; 5. capturing nucleic acid sequences bound to the target by a cross-linking reaction; 6. elution of bound nucleic acids on magnetic beads: carrying out thermal elution or proteinase K hydrolysis on the target to realize nucleic acid elution; 7, PCR; 8. preparation of single-stranded DNA.
FIG. 2 is a flowchart of a prior art target-immobilization-based aptamer magnetic bead screening method used in example 1 of the present invention. As shown in fig. 2, each screening cycle comprises 1. activated magnetic beads; 2. fixing the target on the magnetic bead; 3. incubating the library with protein-coated magnetic beads; 4. eluting the nucleic acid combined on the magnetic beads by proteinase K; 5, PCR; 6. lambda Exo single stranded DNA preparation. FIG. 3 is a graph showing an affinity test of the thrombin aptamer Tb-2 obtained by screening in example 1 of the present invention.
FIG. 4 is a flow chart of SSA screening based on library immobilization as employed in example 2 of the present invention. As shown in FIG. 4, each screening cycle includes 1. library hybridization to the intermediate complementary sequence; 2. the hybrid chain is fixed on the magnetic bead; 3. incubating the magnetic beads with the fixed hybrid chains with the target; 4, PCR; 5. lambda Exo single strand preparation. FIG. 5 is the percent elution of the first three homogeneous cross-linking reaction-based screens of example 2 determined using the real-time quantitative PCR technique (RT-PCR) of the present invention; the percent elution is the proportion of nucleic acid sequences in the library that bind to the target in the total input library.
FIGS. 6A and 6B are graphs of the ratio of nucleic acids in the supernatant of SSA screening after washing of each bead and incubation with target protein to the total input library (FIG. 6A) and melting temperatures of background and nucleic acids in the target incubators (FIG. 6B) as determined by RT-PCR in example 2 of the present invention. FIG. 7 is a graph showing an affinity assay for HSA aptamer HSA-6 screened in example 2 of the present invention. FIGS. 8A and 8B are the structural switch performance and specificity tests of HSA-6 according to the present invention, which are performed by a fluorescence method (FIG. 8A) and a gel electrophoresis method (FIG. 8B); the fluorescence intensity of the supernatant after magnetic separation was measured in FIG. 8A; figure 8B gel electrophoresis of magnetically separated supernatants after incubation with different targets.
Example 1. screening for human thrombin (Tb) aptamers using a homogeneous thrombin aptamer rapid screening method based on cross-linking reactions.
1. First round screening of homogeneous Tb aptamers based on cross-linking reactions
The following screening steps are shown in FIG. 1:
(1) heat treatment of the starting DNA library: mu.l 100. mu. mol per liter (. mu.M) of P-Tb sequence (Table 1) was added to 1X Tbb-2(1 fold thrombin binding buffer-2: 50 mmol per liter (mM) of 4-hydroxyethylpiperazine ethanesulfonic acid (HEPES), 100mM NaCl, 1mM MgCl 2 、5mM KCl、1mM CaCl 2 pH7.4) so that the total volume of the solution was 490. mu.L. Heating in water bath at 95 deg.C for 10 min, and quenching in ice bath for 5 minAnd (4) standing for 5 minutes at room temperature.
(2) Library incubation with Tb: to the heat-treated DNA library was added 1 microgram (. mu.g) of Tb and incubated at room temperature for 1 hour.
(3) Activating magnetic beads: 10 μ L of the well-mixed magnetic beads were placed in a 1.5mL centrifuge tube and washed three times with 25mM 100 μ L of 2- (N-morpholino) ethanesulfonic acid (MES) solution. 100 μ L each of a 50mg/mL (mg/mL) solution of EDC and a 50mg/mL solution of NHS was freshly prepared in cold 25mM MES solution. To the washed beads, 50. mu.L of freshly prepared EDC solution was added first and mixed, followed by 50. mu.L of freshly prepared NHS solution. The centrifuge tube was placed on a rotary mixer and rotated at room temperature for 30 minutes at a low speed. After the rotation is finished, the centrifuge tube with the magnetic beads is placed on a strong magnet and stands for 4 minutes, and the supernatant is removed. The activated beads were washed four times with 100. mu. LMES solution. Then 10. mu.L of 1X Tbb-2 solution was added.
(4) Incubation of magnetic beads with DNA-Tb complex: the activated magnetic beads were added to the DNA-Tb incubated solution in a total volume of 500. mu.L, and incubated at room temperature for 35 minutes.
(5) DNA elution: after the completion of the incubation, the supernatant was discarded, the magnetic beads were retained, 1.8. mu.L of proteinase K (20mg/mL) was added to the magnetic beads, and the volume was adjusted to 120. mu.L with 1X Tbb-2, and the mixture was placed in an incubator at 52 ℃ for 2 hours. After the reaction, 120. mu.L of the eluate was obtained and heated at 90 ℃ for 20 minutes to inactivate proteinase K.
(6) Small-scale PCR: 8 200 mu L centrifuge tubes were marked with Blank 10, Blank15, Blank 20, Blank 25, PCR 10, PCR 15, PCR 20, and PCR 25, and 6. mu.L nuclease-free water, 2. mu.L 10. mu.M MFP-Tb (Table 1), 2. mu.L 10. mu.M 5' -PO were added to the Blank-marked centrifuge tubes in this order 4 -RP-Tb (Table 1) and 10. mu.L of 2 × Premix
Hot Start. mu.L of nuclease-free water, 2. mu.L of 10. mu.MFP-Tb (Table 1), 2. mu.L of 10. mu.M 5' -PO were added to the PCR-labeled centrifuge tube in this order 4 -RP-Tb (Table 1), 10. mu.L 2 × Premix
Hot Start and 2 μ L of the product from (5). And the PCR instrument was set up as follows: pre-melt treatment at 95 ℃ for 1 minute (min); 25 cycles: 30s at 95 ℃, 30s at 45 ℃ and 30s at 72 ℃ for 30 seconds(s); 72 ℃ for 2 min; 6min at 4 ℃. When the program is operated, the heating volume of the sample is set to be 20 mu L, when the instrument is operated to 20s of the extension step of the 10 th, 15 th, 20 th and 25 th rounds, the program is suspended, the instrument cover is opened, the corresponding numbered tube is taken out, the tube is placed at 4 ℃ for storage, and then the program is continuously operated until the reaction is finished.
A12% denaturing polyacrylamide gel (PAGE) was prepared, and 4.8. mu.L of nuclease-free water, 6. mu.L of 2-fold RNA sample and 1.2. mu.L of PCR product were mixed in a 200. mu.L centrifuge tube. Heat treatment was carried out at 95 ℃ for 10 minutes in an ice bath for 5 minutes. The heat-treated sample was then added to a vertical electrophoresis system, and subjected to preliminary electrophoresis and electrophoresis at 170 volts (V), 1 XTBE buffer, and electrophoresis time 45 minutes. For gel after electrophoresis
gold nucleic acid dye was stained in 1 × TBE buffer for 10 minutes, and electrophoretograms were taken using a gel imaging system.
(7) And (5) performing PCR amplification on all samples obtained in the step (5) after selecting the optimal number of amplification rounds according to the gel electrophoresis result chart in the step (6). 200 μ L of centrifuge tubes were prepared, and 20 μ L of nuclease-free water, 10 μ L of 10 μ M FP-Tb (Table 1) and 10 μ L of 10 μ M5' -PO were added to each of the centrifuge tubes 4 -RP-Tb (Table 1), 50. mu.L 2 × Premix
Hot Start and 10 μ L of the product from (5). And the PCR instrument was set up as follows: pre-melting at 95 deg.C for 1 min; 25 cycles: 30s at 95 ℃, 30s at 45 ℃ and 30s at 72 ℃; 72 ℃ for 2 min; 6min at 4 ℃. When the program was run, the sample heating volume was set to 100. mu.L.
(8) After the PCR reaction was completed, the obtained samples were mixed two by two so that the volume of each sample group was 200. mu.L. Ethanol precipitation was performed as follows:
add 15. mu.L of sodium acetate (3M, pH5.2) solution, mix well.
② adding 4 mu L of DNA mate solution and mixing evenly.
③ adding 2.5 times of volume of absolute ethyl alcohol precooled at the temperature of minus 20 ℃, and mixing evenly.
Fourthly, centrifuging for 20 minutes at the temperature of 4 ℃ and the speed of 15000 turns, carefully absorbing and removing supernatant, and leaving white precipitate.
Fifthly, adding 400 mu L of pre-cooled 70% ethanol solution at the temperature of minus 20 ℃, and washing the precipitate by turning upside down.
Sixthly, centrifuging for 5 minutes at the temperature of 4 ℃ and 15000 turns, carefully removing supernatant, leaving white precipitate, and repeatedly washing for 3 times.
Seventhly, opening the cover, sealing the film, punching holes, volatilizing the ethanol at 40 ℃ until the white precipitate becomes transparent, and refrigerating at-20 ℃.
(9) Small scale lambda Exo digestion
The purified product was dissolved in 100. mu.L of nuclease-free water per tube of ethanol precipitation. Digested sample (total volume 20 μ L): PCR purified product 5u L; 2 μ L of 10-fold reaction buffer; 0 enzyme units (U), 1U, 2U, 3U and 5U λ Exo; add various volumes of nuclease free water to 20. mu.L. The enzyme digestion reaction conditions are as follows: 30 minutes at 37 ℃; inactivating the mixture at 85 ℃ for 15 minutes; 10 minutes at 4 ℃. The product was placed in a refrigerator at 4 ℃ for future use.
Gel electrophoresis conditions: the total volume of electrophoresis loading is 10 mu L, 12% native PAGE, 5 mu L of enzyme digestion product, 1 mu L of 10 times DNA loading buffer, and 4 mu L of nuclease-free water. The pre-electrophoresis and electrophoresis were carried out by a vertical electrophoresis system at 150V in 1 XTBE buffer for 45 minutes. For gel after electrophoresis
gold nucleic acid dye was stained in 1 × TBE buffer for 10 minutes, and electrophoretograms were taken using a gel imaging system.
(10) Large Scale lambda Exo digestion
The minimal amount of lambda Exo capable of completely producing single-stranded DNA was selected for large-scale lambda Exo digestion reactions, which were scaled up. For example: if 2U is the minimum amount of lambda Exo required, 50. mu.L of the ethanol precipitated product in (9), 10. mu.L of 10-fold reaction buffer, 38. mu.L of nuclease-free water and 2. mu.L of 10U/. mu.L lambda Exo are mixed for the cleavage reaction.
(11) The lambda Exo cleavage product was precipitated with ethanol in the same manner as in (8).
(12) Ultraviolet quantification
Dissolving the lambda Exo enzyme digestion product after ethanol precipitation by using 110 mu L of nuclease-free water, fully shaking and mixing uniformly, taking 10 mu L of product to dilute to 100 mu L, and measuring the absorbance of a sample at the position of 260 nanometers (nm) by ultraviolet.
2. Second round screening of homogeneous Tb aptamers based on crosslinking reactions
(1) Heat treatment of the enriched DNA library: 0.1 nanomole (nmol) of the first round of product was added to 1X Tbb-2 to make the total volume of the solution 490. mu.L. Heating in water bath at 95 deg.c for 10 min, quenching in ice bath for 5 min, and maintaining at room temperature for 5 min.
(2) Library and Tb incubation, magnetic bead activation, magnetic bead and DNA-Tb complex incubation, DNA elution, PCR, lambda Exo enzyme digestion, ethanol precipitation and ultraviolet quantification refer to the first round of screening.
3. Third round screening of Tb aptamer based on target immobilized magnetic bead method
The following screening steps are shown in FIG. 2:
(1) activating magnetic beads: mixing the glass bottle with magnetic beads. mu.L of the magnetic beads were pipetted and mixed well with 100. mu.L of a 25mM MES solution (pH5.0) for 10 minutes and then washed twice more. EDC was dissolved in 25mM MES and a 50mg/mL solution of EDC was freshly prepared. NHS was solubilized using 25mM MES and a 50mg/mL solution of NHS was freshly prepared. Add 60. mu.L of the above EDC solution and 60. mu.L of the above NHS solution to the washed beads, mix well and shake at low speed for 30 min at room temperature. The tube was placed on a strong magnet for 4 minutes, and the supernatant removed and washed 2 times with 200. mu.L of 25mM MES solution.
(2) Tb (or Bovine Serum Albumin (BSA)) was coupled to the surface of the magnetic beads: to the activated magnetic beads, 5. mu.g of Tb (or 5. mu.g of BSA as negative sieve protein) was added, and 25mM MES solution was added to give a final volume of 300. mu.L, which was mixed well and incubated at room temperature for 30 minutes. The mixture was allowed to stand on a strong magnet for 4 minutes, and the supernatant and the magnetic beads were separated. By 100 μ L1X Tbb-1(1 fold thrombin binding buffer-1: 50mM Tris, 100mM NaCl, 1mM MgCl) 2 、5mM KCl、1mM CaCl 2 pH7.4) was washed 3 times, and finally the magnetic beads were suspended in 20. mu.L of 1X Tbb-1.
(3) And (3) incubating protein-coated magnetic beads and an enrichment library, namely adding 0.08nmol of the second round enrichment library into 1 × Tbb-1 to ensure that the final volume of the solution is 490 mu L, uniformly mixing, and subpackaging the solution into 5 thin-wall centrifuge tubes for heat treatment: heating in water bath at 95 deg.c for 10 min, quenching in ice bath for 10 min, and setting at room temperature for 10 min. To the above solution, 10. mu.LBSA-coated magnetic beads were added, mixed well, and incubated at room temperature for 1 hour. After the incubation was completed, the magnetic beads and the supernatant were separated by magnetic separation, 10. mu. LTb-coated magnetic beads were added to the supernatant, mixed well, and incubated at room temperature for 1 hour.
(4) DNA elution: and after the incubation is finished, removing the supernatant and leaving the magnetic beads. After adding 200. mu.L of 1X Tbb-1 to the magnetic beads, the mixture was placed on a rotary mixer and mixed well for 5 minutes, and then placed on a powerful magnet for 3 minutes, and washing was repeated 4 times. To the washed magnetic beads, 1.8. mu.L of proteinase K (20mg/ml) was added, and the volume was adjusted to 120. mu.L with 1X Tbb-1, and the mixture was placed in a 52 ℃ incubator for 2 hours (the mixture was mixed by a gun every half an hour). After the reaction, proteinase K was inactivated by heating at 90 ℃ for 20 minutes. After magnetic separation 120. mu.L of eluate was obtained.
(5) PCR, lambda Exo digestion, ethanol precipitation and UV quantification were all referred to the first round of screening.
4. The fourth screening of Tb aptamer based on magnetic bead method:
(1) the magnetic beads were activated and Tb was coupled to the surface of the magnetic beads in accordance with the third screening (1) (2).
(2) Incubation of protein-coated magnetic beads with DNA: taking 0.5nmol of the third round of enrichment library, adding the third round of enrichment library into a 1 × Tbb-1 solution to ensure that the final volume of the solution is 490 μ L, uniformly mixing, and subpackaging the solution into 5 thin-wall centrifuge tubes for heat treatment: heating in water bath at 95 deg.c for 10 min, quenching in ice bath for 10 min, and setting at room temperature for 10 min. To the above solution, 10. mu.L of BSA coated magnetic beads were added, mixed well, and incubated at room temperature for 1 hour. After the incubation was completed, the magnetic beads and the supernatant were separated by magnetic separation, and 10. mu.L of Tb-coated magnetic beads were added to the supernatant, followed by mixing, and incubation at room temperature for 1 hour.
(3) DNA elution, PCR, lambda Exo digestion, ethanol precipitation and UV quantification were all referred to the third round of screening.
5. Cloning and sequencing;
6. selecting representative sequences for chemical synthesis and affinity determination:
(1) activating magnetic beads: the magnetic beads were pipetted at 140. mu.L for activation, and the other procedures were the same as in the first round of screening step (1) of this example.
(2) Coupling Tb to the surface of the magnetic beads: to the activated beads, 25mM MES solution (pH5.0) was added, followed by 14. mu.g Tb to give a final volume of 400. mu.L, and the mixture was thoroughly mixed and incubated at room temperature for 30 minutes. After 4 minutes on a strong magnet, 300. mu.L of the supernatant was removed.
(3) And (3) cleaning magnetic beads: the beads were suspended in 140. mu.L of 1X Tbb-1 by washing 4 times with 200. mu.L of 1X PBS solution containing 20% Tween 20.
(4) The magnetic bead with Tb is incubated with DNA: tb-2 (Table 2) was diluted with 1X Tbb-1 (volume of DNA after dilution: 490. mu.L, concentration: 1 picomole per liter (pM), 100pM, 1 nanomole per liter (nM), 10nM, 20nM, 40nM, 50nM, 60nM, 70nM, 80nM, 90nM, 100nM, 200nM, 300nM in this order, sealed with a sealing membrane, heated in a water bath at 95 ℃ for 10 minutes, quenched in an ice bath for 5 minutes, and allowed to stand at room temperature for 5 minutes. To the treated DNA solutions, 10. mu.L of magnetic beads coated with LTb were added, mixed well, and incubated at room temperature for 1 hour. The beads were washed 4 times with 1X Tbb-1, 200. mu.L each. After completion of washing, 1.8. mu.L of proteinase K (20mg/ml) was added to the magnetic beads, and the volume was adjusted to 120. mu.L with 1X Tbb-1, and the mixture was placed in an incubator at 52 ℃ for 2 hours. After the reaction, 120. mu.L of the eluate was heated at 90 ℃ for 20 minutes to inactivate proteinase K. (Note: when washing the magnetic beads, the solution is preferably left on a strong magnet for at least 3 minutes, and the supernatant is removed as completely as possible.)
(5) RT-PCR determines the amount of DNA in the eluate. Preparing a standard curve: 100 μ M Tb-2 (Table 2) solution was diluted stepwise with nuclease-free water to give final concentrations of 10nM, 1nM, 100pM, 10pM, 1pM, 0.1pM, respectivelyThe standard solution of (1). mu.L of nuclease-free water, 2. mu.L of 10. mu.MFP-Tb, 2. mu.L of 10. mu.M 5' -PO were added to 200. mu.L of LPCR tube in this order 4 -RP-Tb, 10. mu.L of 2 × Premix Taq Hot Start and 3. mu.L of DNA eluate diluted 100-fold (either 3. mu.L of LTb-2 standard solution or 3. mu.L of nuclease-free water) were centrifuged for 2 seconds. Three parallel sets were prepared for each sample and RT-PCR was performed simultaneously.
The fourth round of enriched library was subjected to clonal sequencing through the first two rounds of homogeneous screening based on cross-linking reaction and two rounds of traditional magnetic bead-based screening based on target protein immobilization. All 51 sequences were found to be rich in adenine and thymine. Four of these sequences appeared twice (Table 2). The highly enriched sequence features demonstrate that the methods of the invention enable rapid enrichment of libraries. To further verify whether aptamers with higher affinity were obtained, Tb-2 was chemically synthesized and its dissociation constant was determined. As shown in FIG. 3, the dissociation constant for Tb-2 was 135. + -.29 nanomolar (nM) as determined by RT-PCR techniques. The example shows that the method of the invention can accelerate the efficiency of the traditional magnetic bead aptamer screening method, and the aptamer with nanomolar high affinity can be obtained only by 4 rounds of screening.
Example 2. homogeneous screening of cross-linking reactions greatly expedited screening of Structurally Switched Aptamers (SSA): the screening of Human Serum Albumin (HSA) is exemplified.
1. First round screening of homogeneous HSA aptamers based on a Cross-linking reaction
The following screening steps are shown in FIG. 1:
(1) heat treatment of the starting DNA library: 5 μ L of 100 μ M pool was taken 0 The sequence (Table 1) was added to 1X Tbb-2 to make the total volume of the solution 490. mu.L. Heating in water bath at 95 deg.c for 10 min, quenching in ice bath for 5 min, and maintaining at room temperature for 5 min.
(2) Activating magnetic beads: the procedure was substantially the same as in the first round of screening step (3) of example 1 except that the magnetic beads were washed 2 times with 100. mu.L of 25mM MES solution to remove the last, and 10. mu.L of 1X Tbb-2 was added to disperse the magnetic beads in the solution.
(3) And (3) magnetic bead negative screening: the activated magnetic beads were added to the heat-treated DNA solution in a total volume of 500. mu.L, and incubated at room temperature for 30 minutes.
(4) Incubation of library with HSA: the magnetic beads were removed, and the supernatant was added with 1. mu.g of HSA and incubated at room temperature for 1 hour.
(5) Activated magnetic beads (library performed during incubation with HSA): the operation conditions were substantially the same as those in the first round of the screening step (3) of example 1, and after removing the last magnetic beads and washing them 2 times with 100. mu.L of a 25mM MES solution, 10. mu.L of a 1X Tbb-2 solution containing 0.1% Tween-20 was added to disperse the magnetic beads in the solution.
(6) DNA elution: and after the incubation is finished, removing the supernatant and leaving the magnetic beads. After adding 200. mu.L of 1X Tbb-2 solution to the beads, the mixture was placed on a rotary mixer and mixed thoroughly for 5 minutes, then placed on a powerful magnet for 3 minutes, the supernatant was removed (the supernatant was retained by cutting and used for subsequent RT-PCR monitoring), and the washing was repeated 4 times. To the washed magnetic beads, 1.8. mu.L of proteinase K (20mg/ml) was added, and the volume was adjusted to 120. mu.L with 1X Tbb-2, and the mixture was placed in a 52 ℃ incubator for 2 hours (the mixture was mixed by a gun every half an hour). After the reaction was completed, 120. mu.L of the eluate was obtained by magnetic separation and heated at 90 ℃ for 20 minutes to inactivate proteinase K.
(7) Other operating conditions were the same as those in the first round of screening of example 1 (6) — (12)
(8) The first round of screening products were gel-cut and purified using UNIQ-10 column PAGE gel DNA recovery kit:
the operational steps of the UNIQ-10 column PAGE gel DNA recovery kit are as follows:
the target DNA fragment is separated from other fragments as much as possible by PAGE electrophoresis, the gel containing the target DNA fragment is cut off by a clean scalpel blade, and the gel is placed into a 1.5ml centrifuge tube and weighed. (removal of as much as possible of PAGE gel not containing the target DNA, not more than 400 milligrams (mg) per gel piece, otherwise the result is incomplete)
Adding 200 microliter of diffusion buffer solution into 100mg of PAGE gel (if the gel mass is less than 100mg, the gel mass is supplemented to 100mg) according to the weight and concentration of the gel mass, and mashing the gel mass soaked in the solution by using a gun head.
And thirdly, placing the centrifuge tube in water bath at 55 ℃ for 2 hours, and mixing the mixture at intervals to promote the DNA in the gel to diffuse into the solution.
Centrifuging the solution for 10 minutes at 10,000 revolutions.
Transferring the supernatant to a clean 1.5ml centrifuge tube, sequentially adding 5 times of binding buffer solution II and 3 times of 100% isopropanol, and mixing well.
And sixthly, transferring all the solution into an adsorption column, standing at room temperature for 2 minutes, and centrifuging at 8,000 rpm for 30 seconds. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe. (if the total volume of the sol solution is more than 750. mu.L, 750. mu.L of sol solution is used for each time, and the sol solution is applied to the column for multiple times.)
Seventhly, adding 500 mu L of eluent into the adsorption column, and centrifuging for 1 minute at 10,000 revolutions. And (4) pouring out the liquid in the collecting pipe, and putting the adsorption column into the same collecting pipe.
Eighthly, repeating the step (seventeen) once.
And ninthly, putting the empty adsorption column and the collecting pipe into a centrifuge, and centrifuging for 2 minutes at 12,000 revolutions.
And (c) putting the adsorption column into a clean 1.5ml centrifuge tube, adding 30-50 mu L of nuclease-free water into the center of the adsorption membrane, standing at room temperature for 1-2 minutes, and centrifuging at 12,000 rpm for 1 minute. The resulting DNA solution was stored at-20 ℃ or used for subsequent experiments.
Verifying the gel cutting product: 12% denaturing PAGE, loading of 10. mu.L per loading well per gel electrophoresis: marker 1. mu.L/gel pre-ethanol precipitation product diluted 1000 times 1. mu.L/gel post-product 1. mu.L, 2 times RNA sample loading 5. mu.L, nuclease-free water 4. mu.L, other operating conditions were the same as in example 1 first round of screening (7).
2. Second round screening of homogeneous HSA aptamers based on a Cross-linking reaction
(1) Heat treatment of the starting DNA library: 0.029nmol of the first round enrichment library was added to 1X Tbb-2 to make the total volume of the solution 490. mu.L. Heating in water bath at 95 deg.c for 10 min, quenching in ice bath for 5 min, and maintaining at room temperature for 5 min.
(2) Magnetic bead activation, magnetic bead negative selection, library incubation with HSA, magnetic bead activation, and DNA elution are the same as in the first round of screening steps (2) - (6) of this example.
(3) PCR and ethanol precipitation purification of PCR products were performed in the same manner as in the first round of screening steps (6) - (8) of example 1.
(4) Cutting and purifying gel: all the products obtained by ethanol precipitation were dissolved in 100. mu.L of nuclease-free water under the same conditions as in the first screening step (5) of this example.
(5) Lambda Exo digestion, ethanol precipitation and UV quantification were performed according to the first round of screening (9) - (12) of example 1.
3. Third round of homogeneous HSA aptamers based on cross-linking reactions
The procedure was the same as the second round of screening in this example except that 0.048nmol of the second round of library enrichment was used.
4. Fourth round of SSA screening based on library fixation
The following screening steps are shown in FIG. 4:
(1) hybridization was carried out as follows: mu.L of the third round of 0.44. mu.M product, 1.3. mu.L of 169. mu.M thionin-EG 18-c-pool (Table 1), 30. mu.L of 5 Xbinding eluent (50mM Tris, 5mM EDTA, 5M NaCl), 18.7. mu.L of nuclease-free water. Carrying out heat treatment: 95 ℃ for 10 minutes, slowly cooled to room temperature.
(2) And (3) cleaning magnetic beads: the glass vial containing the magnetic beads was slowly mixed on a rotary mixer for 10 minutes. After 44. mu.L of magnetic beads and 100. mu.L of 1 Xbinding eluent were sufficiently mixed in a 1.5mL centrifuge tube, the mixture was placed on a strong magnet and allowed to stand for 3 minutes, and the supernatant was blotted and washed twice.
(3) Library immobilization magnetic beads: and (3) incubating the magnetic beads washed in the step (1) for 30 minutes, placing the magnetic beads on a strong magnet for 3 minutes after the incubation is finished, and sucking the supernatant into a 1.5mL centrifuge tube. Washing with 150. mu.L of 1 Xbinding eluent (1 mol NaCl per liter (M) -100 mM) was performed 4 times.
(4) Library immobilized magnetic beads incubated with HSA: HSA was added to the magnetic beads of (3) (in a ratio of 60nM HSA concentration to library concentration of 1:5) to give a final volume of 150. mu.L, and the mixture was mixed well and incubated at room temperature for 1 hour. Reaction system: magnetic beads, 4.5. mu.L of 2. mu.M HSA, 75. mu.L of 2X Tbb-1, 70.5. mu.L of nuclease-free water. After the incubation was completed, the mixture was placed on a strong magnet for 3 minutes, and the supernatant was aspirated into a 1.5mL centrifuge tube. Wash 4 times with 200. mu.L of 1X Tbb-1 solution.
(5) PCR, purification of PCR products by ethanol precipitation, purification of PCR products by UNIQ-10 column PAGE gel DNA recovery kit, single-strand generation by using lambda Exo, purification of lambda Exo enzyme digestion products by ethanol precipitation, and ultraviolet quantification are the same as those in the third round of screening in the embodiment.
5. Cloning and sequencing;
6. selecting representative sequences for chemical synthesis and affinity determination: essentially the same as in step 6 of example 1, only Tb was changed to HSA, and the concentration gradient of HSA-6 was 0nM, 10nM, 5nM, 10nM, 25nM, 40nM, 50nM, 100nM, 200 nM.
7. Selectivity and functionality test:
(1) hybridization was carried out as follows: 4.5 μ L of 1.23 μ M5' Cy3 modified HSA-6 (Table 2), 5 μ L of 16.9 μ Mthioin-EG 18-c-pool, 90 μ L of 5-fold bound eluent, 350.5 μ L of nuclease-free water. Carrying out heat treatment: and slowly cooling to room temperature at 95 ℃ for 10 minutes.
(2) And (4) sucking 50 mu L of magnetic beads for washing, and fixing the magnetic beads in the library, wherein the operation process is the same as the fourth screening step (2) and (3) in the embodiment.
(3) Library immobilized magnetic beads were incubated with various types of control proteins: the magnetic beads in (2) were equally divided into 5 parts, 800nM HSA, BSA, beta-casein, streptavidin, and small peptide library were added to each of the 5 parts, the final volume of the solution was 150. mu.L, and the mixture was mixed well and incubated at room temperature for 1 hour. After the incubation was completed, the mixture was placed on a strong magnet for 3 minutes, and the supernatant was aspirated into a 1.5mL centrifuge tube.
(4) Measuring fluorescence of the supernatant obtained in (3): turning on a fluorescence spectrophotometer, preheating for 30 minutes, and setting experiment parameters as follows: excitation slit width: 10 nm; emission slit width: 10 nm; excitation wavelength: 520 nm; scanning range: 540-640 nm.
The enrichment of the library from the previous three rounds of homogeneous screening was monitored in real time by RT-PCR (FIG. 5). The elution percentages of the library for the first three rounds were 0.001,0.6 and 0.018, respectively. After 1 round of screening, the library was enriched 600-fold, and the second round of enrichment, the enrichment degree of the library was significantly reduced, but still 18-fold higher than the initial library. Fourth round of SSA screening library enrichment was also monitored in real time by RT-PCR, with the number of nucleic acid sequences in the target added to the incubation being 250-fold higher than in the background incubation (fig. 6A). And the melting temperature of the nucleic acid sequence in the target incubation was 3 degrees higher than in the background incubation (fig. 6B). These results indicate that libraries with structural switching properties have been significantly enriched. The enriched library from the fourth round was then clonally sequenced (table 3) and significant enrichment of the library sequence occurred. Representative sequence HSA-6 was selected for chemical synthesis, and affinity testing. The affinity of HSA-6 was 20. + -.4 nM as determined by RT-PCR (FIG. 7). Fluorescence experiments based on a structure switch show that the nucleic acid aptamer has high selectivity (15 times) on streptavidin and a small peptide library; moderate selectivity (3-fold) for beta-casein and immunoglobulin (fig. 8A). Gel electrophoresis experiments also further demonstrated that the amount of nucleic acid in the supernatant incubated with HSA was much greater than that when incubated with other targets (fig. 8B), verifying that the screened HSA aptamers have structural switching properties and good selectivity.
TABLE 1 DNA sequences used in the methods and examples of the invention
TABLE 2 clone sequencing results of fourth round screening products in example 1
TABLE 3 clone sequencing results of fourth round screening products in example 2
The above description is only for the specific embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present invention, and all the changes or substitutions should be covered within the scope of the present invention.
SEQUENCE LISTING
<110> university of capital university
<120> a rapid screening method of aptamer based on cross-linking reaction and structure switch type nucleus obtained by screening
Acid aptamers
<130> 180205CNF03IC
<160> 28
<170> PatentIn version 3.3
<210> 1
<211> 76
<212> DNA
<213> Artificial
<220>
<223> 76
<220>
<221> misc_feature
<222> (19)..(59)
<223> n is a, c, g, or t
<400> 1
ataccagctt attcaattnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnag 60
atagtaagtg caatct 76
<210> 2
<211> 18
<212> DNA
<213> Artificial
<220>
<223> 18
<400> 2
ataccagctt attcaatt 18
<210> 3
<211> 18
<212> DNA
<213> Artificial
<220>
<223> 18
<220>
<221> misc_feature
<223> 5' -terminal phosphate group modified reverse primer
<400> 3
agattgcact tactatct 18
<210> 4
<211> 100
<212> DNA
<213> Artificial
<220>
<223> 100
<220>
<221> misc_feature
<222> (21)..(41)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (61)..(81)
<223> n is a, c, g, or t
<400> 4
ctcctctgac tgtaaccacg nnnnnnnnnn nnnnnnnnnn acgagacgag cttatgcgta 60
nnnnnnnnnn nnnnnnnnnn gcataggtag tccagaagcc 100
<210> 5
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<220>
<221> misc_feature
<223> 5' -terminal phosphate group modified reverse primer
<400> 6
<210> 7
<211> 15
<212> DNA
<213> Artificial
<220>
<223> 15
<220>
<221> misc_feature
<223> 5' end biotin and oligo-polyethylene glycol modified capture probe complementary to middle part of library
<400> 7
gcataagctc gtctc 15
<210> 8
<211> 18
<212> DNA
<213> Artificial
<220>
<223> 18
<400> 8
ataccagctt attcaatt 18
<210> 9
<211> 40
<212> DNA
<213> Artificial
<220>
<223> 40
<400> 9
aagaatcgac gaatagtcat actcaccccc accaccccgt 40
<210> 10
<211> 40
<212> DNA
<213> Artificial
<220>
<223> 40
<400> 10
gcaggaacgt atgtccggaa tccagcgcgc cacctccccc 40
<210> 11
<211> 40
<212> DNA
<213> Artificial
<220>
<223> 40
<400> 11
gcgcacacag acttgcaata gctgaacccc ccctcccccg 40
<210> 12
<211> 40
<212> DNA
<213> Artificial
<220>
<223> 40
<400> 12
cagacgactc ctccaccgaa ttgcagacaa cccctcccgt 40
<210> 13
<211> 18
<212> DNA
<213> Artificial
<220>
<223> 18
<400> 13
agatagtaag tgcaatct 18
<210> 14
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 14
<210> 15
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 15
<210> 16
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 16
<210> 17
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 17
caccgagtta actatcagtc 20
<210> 18
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 18
<210> 19
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 20
<210> 21
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 21
<210> 22
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 22
<210> 23
<211> 13
<212> DNA
<213> Artificial
<220>
<223> 13
<400> 23
tgcatgcaga cga 13
<210> 24
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 24
tcagttgctc ctcgcggttc 20
<210> 25
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 25
<210> 26
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 26
<210> 27
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 27
<210> 28
<211> 20
<212> DNA
<213> Artificial
<220>
<223> 20
<400> 28
Claims (8)
1. A method for rapidly screening aptamers based on a crosslinking reaction, which is characterized by comprising the following steps: step 1, library heat treatment; step 2, activating magnetic beads; step 3, magnetic bead negative screening; step 4, incubating the library with a target, wherein the target and the library are incubated in a homogeneous solution; step 5, capturing the nucleic acid sequence combined with the target through a cross-linking reaction, so that the nucleic acid sequence combined with the target can be separated through a magnetic separation technology; step 6, eluting the combined nucleic acid on the magnetic beads; step 7, PCR; step 8, preparing single-stranded DNA;
it is characterized in that the preparation method is characterized in that,
step 1, library heat treatment as follows: taking a proper amount of library to carry out heat treatment in a buffer solution: heating in water bath at 95 deg.c, quenching in ice bath, and setting at room temperature;
step 2, activating magnetic beads as follows: activating the magnetic beads modified by carboxyl with N-hydroxysuccinimide and 1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride to generate magnetic beads modified by NHS active ester;
and 3, magnetic bead negative screening as follows: taking part of the NHS activated magnetic beads prepared in the step 2 to incubate with the library in the step 1, carrying out magnetic separation, and using a supernatant in the step 4;
step 4, library and target incubation are as follows: mixing and incubating the library collected in the step 3 and a target according to a certain molar ratio in a screening buffer solution; step 5, capturing the nucleic acid sequence bound to the target by a cross-linking reaction as follows: incubating the NHS activated magnetic beads prepared in the step 2 with the library and target mixed solution in the step 4, carrying out magnetic separation, and cleaning the magnetic beads;
step 6, eluting the bound nucleic acid on the magnetic beads as follows: incubating a certain amount of proteinase K with the magnetic beads obtained in the step 5, or adding a buffer solution into the magnetic beads obtained in the step 5, heating, incubating, and collecting supernate;
step 7, PCR is as follows: carrying out PCR on the eluent obtained in the step 6, and purifying a PCR product by an ethanol precipitation method;
step 8, single-stranded DNA preparation as follows: preparing single strands by using lambda phage exonuclease, purifying the products of the lambda phage exonuclease digestion by an ethanol precipitation method, quantifying the products in each round by ultraviolet, wherein the obtained single strand DNA library is a secondary library, and the secondary library is subjected to the next round of screening or clone sequencing.
2. The method of claim 1, wherein the above steps 1-8 are cycled for 2-3 rounds to achieve rapid enrichment of the library.
3. The method of claim 2, further comprising the steps of:
(1) 1-8, circulating for 2-3 rounds to realize the rapid enrichment of the library to form an enriched library, and hybridizing and incubating the enriched library with a biotin-modified probe which is complementary to an intermediate fixed sequence of the library;
(2) fixing the double-stranded library formed in the step (1) on streptavidin-coated magnetic beads;
(3) incubating library immobilized magnetic beads and a target, carrying out magnetic separation after incubation is finished, and collecting supernatant;
(4) and (3) PCR: carrying out PCR on the supernatant obtained in the step (3), and purifying a PCR product by an ethanol precipitation method;
(5) cloning and sequencing;
(6) selecting a representative enrichment sequence for chemical synthesis;
(7) chemically synthesized sequences were tested for affinity, selectivity and functionality.
4. A method for rapidly screening aptamers based on a crosslinking reaction, the method comprising: a first round of screening of homogeneous Tb aptamers based on a cross-linking reaction, a second round of screening of homogeneous Tb aptamers based on a cross-linking reaction, a third round of screening of Tb aptamers based on a target immobilized magnetic bead method and a fourth round of screening of Tb aptamers based on a magnetic bead method,
wherein the first round of screening comprises the steps of:
(1) heat treatment of the starting DNA library;
(2) the library was incubated with Tb, wherein Tb and library were incubated in a homogeneous solution;
(3) activating the magnetic beads;
(4) incubating the magnetic beads and the DNA-Tb compound to generate coupling reaction;
(5) DNA elution: through the above coupling reaction, the nucleic acid sequence bound to the target can be separated by magnetic separation technology;
(6) performing small-scale PCR to obtain a gel electrophoresis result picture;
(7) selecting the optimal number of amplification rounds according to the gel electrophoresis result diagram in the step (6), and carrying out PCR amplification on all samples obtained in the step (5);
(8) after the PCR reaction is finished, mixing the obtained samples pairwise to ensure that the volume of each group of samples is 200 mu L, and carrying out ethanol precipitation;
(9) carrying out small-scale lambda Exo enzyme digestion; (10) large-scale lambda Exo enzyme digestion; (11) precipitating lambda Exo enzyme digestion products by using ethanol, wherein the operation process is the same as that of (8);
(12) the quantitative determination of the ultraviolet light is carried out,
wherein the second round of screening comprises the steps of:
(1) heat treatment of the enriched DNA library;
(2) library and Tb incubation, activated magnetic bead, magnetic bead and DNA-Tb compound incubation, DNA elution, PCR, lambda Exo enzyme digestion, ethanol precipitation and ultraviolet quantification are all screened according to the first round;
wherein the third round of screening comprises the steps of:
(1) activating the magnetic beads;
(2) coupling Tb to the surface of the magnetic beads;
(3) incubating the protein-coated magnetic beads with the enriched library;
(4) DNA elution;
(5) PCR, lambda Exo enzyme digestion, ethanol precipitation and ultraviolet quantification refer to the first round of screening,
wherein the fourth round of screening comprises the steps of:
(1) activating the magnetic beads and coupling Tb to the surfaces of the magnetic beads refer to the third screening (1) and (2);
(2) incubating the magnetic beads coated with the protein with DNA;
(3) DNA elution, PCR, lambda Exo digestion, ethanol precipitation and UV quantification were all referred to the third round of screening.
5. The method of claim 4, further comprising the steps of: clone sequencing and selecting representative sequences for chemical synthesis and affinity determination.
6. A method for rapidly screening aptamers based on a crosslinking reaction, the method comprising: a first round of screening for a homogeneous HSA aptamer based crosslinking reaction, a second round of screening for a homogeneous HSA aptamer based crosslinking reaction, a third round of screening for a homogeneous HSA aptamer based crosslinking reaction, and a fourth round of screening for a library-immobilized SSA,
wherein the first round of screening comprises the steps of:
(1) heat treatment of the starting DNA library;
(2) activating the magnetic beads;
(3) magnetic bead negative screening;
(4) incubating the library with HSA, wherein HSA and the library are incubated in a homogeneous solution;
(5) activating magnetic beads during incubation of the library and HSA, and adding the incubated homogeneous solution into the activated magnetic beads for coupling reaction;
(6) DNA elution: by the above-mentioned coupling reaction, the nucleic acid sequence bound to the target can be separated by magnetic separation technique;
（7）PCR；
(8) using a UNIQ-10 column PAGE gel DNA recovery kit to perform gel cutting purification on the first round screening product;
wherein the second round of screening comprises the steps of:
(1) heat treatment of the starting DNA library;
(2) activating the magnetic beads;
(3) magnetic bead negative screening;
(4) incubation of the library with HSA;
(5) activating the magnetic beads during incubation of the library with HSA;
(6) DNA elution;
（7）PCR；
(8) cutting and purifying;
(9) lambda Exo enzyme digestion, ethanol precipitation and ultraviolet quantification,
wherein the third round of screening comprises the steps of:
the operation steps of the second round of enrichment library are the same as those of the second round of screening except that 0.048nmol of the second round of enrichment library is input,
wherein the fourth screening comprises the steps of:
(1) hybridizing the third round of products;
(2) cleaning the magnetic beads;
(3) fixing magnetic beads on the library;
(4) incubating library immobilized magnetic beads with HSA;
(5) PCR, purifying PCR products by an ethanol precipitation method, purifying PCR products by a UNIQ-10 column PAGE gel DNA recovery kit, generating single chains by using lambda Exo, purifying lambda Exo enzyme digestion products by the ethanol precipitation method, and quantifying by ultraviolet.
7. The method of claim 6, further comprising the steps of: cloning and sequencing; representative sequences were selected for chemical synthesis and affinity determination as well as selectivity and functionality testing.
8. A structurally switched aptamer screened according to any of the preceding claims 4 to 7, wherein the structurally switched aptamer is a Tb-1: the clone sequencing result is as follows: forward primers (5 '-3'): ATACCAGCTTATTCAATT, random sequence (5 '-3'): AAGAATCGACGAATAGTCATACTCACCCCCACCACCCCGT, reverse primer complementary sequence (5 '-3'): AGATAGTAAGTGCAATCT, Tb-2: the clone sequencing result is as follows: forward primers (5 '-3'): ATACCAGCTTATTCAATT, random sequence (5 '-3'): GCAGGAACGTATGTCCGGAATCCAGCGCGCCACCTCCCCC, reverse primer complementary sequence (5 '-3'): AGATAGTAAGTGCAATCT, Tb-3: the cloning sequencing result is as follows: forward primers (5 '-3'): ATACCAGCTTATTCAATT, random sequence (5 '-3'): GCGCACACAGACTTGCAATAGCTGAACCCCCCCTCCCCCG, reverse primer complementary sequence (5 '-3'): AGATAGTAAGTGCAATCT, Tb-4: the clone sequencing result is as follows: forward primers (5 '-3'): ATACCAGCTTATTCAATT, random sequence (5 '-3'): CAGACGACTCCTCCACCGAATTGCAGACAACCCCTCCCGT, reverse primer complementary sequence (5 '-3'): AGATAGTAAGTGCAATCT, HSA-1: the clone sequencing result is as follows: forward primers (5 '-3'): CTCCTCTGACTGTAACCACG, random sequence (5 '-3'): CGTACCGGCCAGTGATTACG, intermediate fixed sequence (5 '-3'): ACGAGACGAGCTTATGCGTA, random sequence (5 '-3'): TTGATGCCTAACTATCTACA, reverse primer complementary sequence (5 '-3'): GCATAGGTAGTCCAGAAGCC, HSA-2: the clone sequencing result is as follows: forward primers (5 '-3'): CTCCTCTGACTGTAACCACG, random sequence (5 '-3'): GACTACCCTGGGAGCGAGAT, intermediate fixed sequence (5 '-3'): ACGAGACGAGCTTATGCGTA, random sequence (5 '-3'): TGCATGCAGACGA, reverse primer complementary sequence (5 '-3'): GCATAGGTAGTCCAGAAGCC, HSA-3: the clone sequencing result is as follows: forward primers (5 '-3'): CTCCTCTGACTGTAACCACG, random sequence (5 '-3'): CACCGAGTTAACTATCAGTC, intermediate fixed sequence (5 '-3'): ACGAGACGAGCTTATGCGTA, random sequence (5 '-3'): TCAGTTGCTCCTCGCGGTTC, reverse primer complementary sequence (5 '-3'): GCATAGGTAGTCCAGAAGCC, HSA-4: the clone sequencing result is as follows: forward primers (5 '-3'): CTCCTCTGACTGTAACCACG, random sequence (5 '-3'): CAAAACGCCTGATATGAGTT, intermediate fixed sequence (5 '-3'): ACGAGACGAGCTTATGCGTA, random sequence (5 '-3'): AATTGCGTGGTCTAATCTGC, reverse primer complementary sequence (5 '-3'): GCATAGGTAGTCCAGAAGCC, HSA-5: the cloning sequencing result is as follows: forward primers (5 '-3'): CTCCTCTGACTGTAACCACG, random sequence (5 '-3'): ATCAATCGCGGACAGGGAAC, intermediate fixed sequence (5 '-3'): ACGAGACGAGCTTATGCGTA, random sequence (5 '-3'): TACTACTGAGAAGCAGGTTA, reverse primer complementary sequence (5 '-3'): GCATAGGTAGTCCAGAAGCC or HSA-6: the clone sequencing result is as follows: forward primers (5 '-3'): CTCCTCTGACTGTAACCACG, random sequence (5 '-3'): GACAGACAGCCGAAATACGG, intermediate fixed sequence (5 '-3'): ACGAGACGAGCTTATGCGTA, random sequence (5 '-3'): GCCTCTAGTGATTAACGCAG, reverse primer complementary sequence (5 '-3'): GCATAGGTAGTCCAGAAGCC are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810589689.4A CN110577979B (en) | 2018-06-08 | 2018-06-08 | Rapid screening method of aptamer based on crosslinking reaction and structure switch type aptamer obtained through screening |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810589689.4A CN110577979B (en) | 2018-06-08 | 2018-06-08 | Rapid screening method of aptamer based on crosslinking reaction and structure switch type aptamer obtained through screening |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110577979A CN110577979A (en) | 2019-12-17 |
| CN110577979B true CN110577979B (en) | 2022-09-27 |
Family
ID=68809731
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810589689.4A Active CN110577979B (en) | 2018-06-08 | 2018-06-08 | Rapid screening method of aptamer based on crosslinking reaction and structure switch type aptamer obtained through screening |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110577979B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114127293B (en) * | 2020-06-30 | 2023-08-04 | 首都师范大学 | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application of method in cancer diagnosis |
| CN114107307B (en) * | 2020-08-27 | 2023-08-18 | 首都师范大学 | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application thereof |
| CN113249449B (en) * | 2021-06-28 | 2021-10-12 | 中国农业大学 | Method for determining Kd value based on real-time quantitative PCR of extension luminescent primer |
| CN116515844B (en) * | 2023-06-30 | 2023-09-08 | 四川大学华西医院 | Migration body aptamer and screening method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676656A (en) * | 2012-03-16 | 2012-09-19 | 首都师范大学 | Structure-switching aptamer based highly-sensitive unmarked fluorescent detection method |
| CN103966222A (en) * | 2013-02-01 | 2014-08-06 | 广西医科大学 | Decreasing DNA library concentration based aptamer screening method and aptamer |
| CN105018461A (en) * | 2014-04-29 | 2015-11-04 | 中国科学技术大学 | Method for rapid screening of nucleic acid aptamer |
| WO2017126646A1 (en) * | 2016-01-22 | 2017-07-27 | 国立大学法人 東京大学 | Method for screening nucleic acid aptamer |
-
2018
- 2018-06-08 CN CN201810589689.4A patent/CN110577979B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102676656A (en) * | 2012-03-16 | 2012-09-19 | 首都师范大学 | Structure-switching aptamer based highly-sensitive unmarked fluorescent detection method |
| CN103966222A (en) * | 2013-02-01 | 2014-08-06 | 广西医科大学 | Decreasing DNA library concentration based aptamer screening method and aptamer |
| CN105018461A (en) * | 2014-04-29 | 2015-11-04 | 中国科学技术大学 | Method for rapid screening of nucleic acid aptamer |
| WO2017126646A1 (en) * | 2016-01-22 | 2017-07-27 | 国立大学法人 東京大学 | Method for screening nucleic acid aptamer |
Non-Patent Citations (1)
| Title |
|---|
| 核酸适配体筛选的改良与优化策略;李世雨等;《生物技术通报》;20171231;第73-81卷(第11期);73-81 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110577979A (en) | 2019-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110577979B (en) | Rapid screening method of aptamer based on crosslinking reaction and structure switch type aptamer obtained through screening | |
| Lorenz et al. | Genomic systematic evolution of ligands by exponential enrichment (Genomic SELEX) for the identification of protein-binding RNAs independent of their expression levels | |
| CN110129415B (en) | NGS library-building molecular joint and preparation method and application thereof | |
| CN108138365A (en) | A kind of unicellular transcript profile banking process of high throughput | |
| JPH09508268A (en) | Nucleic acid sequencing | |
| US20080318244A1 (en) | Large-scale parallel nucleic acid analysis method | |
| CN114127293B (en) | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application of method in cancer diagnosis | |
| WO2020047769A1 (en) | Method for building rna library and kit | |
| Rosch et al. | A systematic evolution of ligands by exponential enrichment workflow with consolidated counterselection to efficiently isolate high‐affinity aptamers | |
| US11492655B2 (en) | Method of detecting a nucleic acid | |
| CN111560423A (en) | Method for detecting RNA m6A with high-throughput and high-sensitivity single-base resolution and application thereof | |
| CN108473985A (en) | The method and kit formed for reducing connector-dimer | |
| CN103695419B (en) | A kind of Viral nucleic acid extraction reagent | |
| CN105986020A (en) | Method and device for constructing sequencing library | |
| CN115992128A (en) | Composition, kit and purification method thereof | |
| CN113039283A (en) | Method and reagent for separating and/or enriching host source nucleic acid and pathogenic nucleic acid and preparation method thereof | |
| WO2017219511A1 (en) | Method for rapid homogenization or equal proportion of dna samples | |
| EP1762618B1 (en) | Method for the preparation of nucleic acids from whole blood and its application in the diagnosis of TSE using real-time PCR | |
| WO2019200580A1 (en) | Parallel liquid-phase hybrid capture method for simultaneously capturing positive-sense and antisense strands of genomic target region | |
| CN116162690B (en) | One-tube targeting high-throughput sequencing method | |
| CN109136347A (en) | A method of monitoring nucleic acid library complexity | |
| CN112538657B (en) | Cerebrospinal fluid gene sequencing library building and detecting method and application thereof | |
| WO2024027123A1 (en) | Method for constructing sequencing library, kit for constructing sequencing library, and gene sequencing method | |
| US20230174969A1 (en) | Barcoded transposase complex and application thereof in high-throughput sequencing | |
| CN115058492A (en) | Construction method of space transcriptome sequencing library based on equipartition combined coding microspheres |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |