CN110577899B

CN110577899B - 2017-M2 strain containing mannanase gene

Info

Publication number: CN110577899B
Application number: CN201910869927.1A
Authority: CN
Inventors: 石慧; 翟淑红; 张娟; 莫晨阳; 欧炜明
Original assignee: Wuhan Institute Of Design And Sciences
Current assignee: Wuhan Institute Of Design And Sciences
Priority date: 2019-09-19
Filing date: 2019-09-19
Publication date: 2022-06-10
Anticipated expiration: 2039-09-19
Also published as: CN110577899A

Abstract

The invention belongs to the field of agricultural microorganism application, and relates to a 2017-M2 strain containing a mannanase gene. The strain can produce edible haematochrome, mannase and cellulase. Is separated from the soil. Is a strain of the genus Talaromyces atroroseus (Talaromyces atroroseus) in which the sequence of the mannanase gene is shown in SEQ ID NO: 2. The similarity with the known mannan beta-1, 4-endonuclease gene is only 71 percent, and the mannose beta-1, 4-endonuclease gene is a novel functional gene and has wide application value. The strain grows well at the temperature of 22-35 ℃, produces cellulase, mannase and amylase, does not produce protease and has no bacteriostatic action. The maximum quantity of red pigment with the light absorption value of 600nm can be obtained in the PDA culture medium. The active gene can be expressed in Escherichia coli. The optimal induction conditions were 1mM IPTG 1.5. mu.L, 3h at 37 ℃.

Description

2017-M2 strain containing mannanase gene

Technical Field

The invention belongs to the technical field of agricultural microorganism application, and particularly relates to an atropisella (Talaromyces atroroseus)2017-M2 strain containing a mannase gene and capable of producing edible red pigment, cellulase and mannase, wherein the strain is obtained by separating from soil, is atropisella (Talaromyces atroroseus), is evolved from penicillium branch, belongs to a new strain, contains a mannase gene, and the mannase expressed by the gene is beta-1, 4-endo-mannase.

Background

Talaromyces atroroseus is a new species of fungus discovered in 2013, and is classified and named as atroceros (Talaromyces atroroseus). The fungus is present in soil and fruit and was originally identified from house dust collected in south Africa. It produces a large amount of red pigment and does not contain any known mycotoxins. The bacterial strain genome contains beta-1, 4-mannase coding gene, beta-mannase (endo-1, 4-beta-mannase) belongs to endohydrolase, and can act on mannan (including isomannin) formed by mannose glycosidic bond, and its acting substrates mainly include mannan, galactomannan, galactoglucomannan and glucomannan. Hydrolysis produces monosaccharides as well as oligosaccharides such as disaccharides, trisaccharides, tetrasaccharides, etc.

The existing data show that the beta-mannase can be widely applied to the feed production and paper industry. The digestive enzyme systems of livestock, poultry and fish lack beta-mannase, and non-starch polysaccharide in feed can be degraded by adding exogenous beta-mannase, so that intestinal viscosity is reduced, and digestion and absorption of nutrient substances are promoted. In addition, researches show that the beta-mannase is also a multifunctional growth promoter, can promote the secretion of growth factor IGF-I, promote the synthesis of protein and improve the lean meat percentage; and the interference of the absorption of the beta-mannan in the feed to glucose can be eliminated, and the energy digestibility of the feed rich in the beta-mannan is improved. In addition, the degradation product of the mannanoligosaccharide can reduce the colonization of pathogenic bacteria in intestinal tracts, protect animal intestinal mucosa by promoting the massive proliferation of beneficial bacteria, improve immunity and improve the growth performance of animals. In the papermaking industry, mannase is applied to degrade mannan, so that the mannase is beneficial to the permeation of a chemical bleaching agent and the removal of lignin, the bleaching effect can be improved, the use of the chemical bleaching agent and hydrogen peroxide can be reduced, and the pollution to the environment is reduced.

The pigments are widely applied in the fields of textile, building, food, biology, medicine and health, cosmetics, daily industrial products, feed and other industries, and are divided into two categories of natural pigments and synthetic pigments according to sources. The natural pigment is extracted from natural substances, mainly from plant tissues, also comprises pigments from animals and microorganisms, has the characteristics of no toxicity, high safety, natural and bright color and the like compared with the synthetic pigment, and has high nutritional value, pharmacological function and other advantages. At present, natural pigments have become the main colorant in the industries of food, cosmetics and health care products.

The microorganism can be used for producing various natural pigments, and the natural pigments produced by the method are not limited by conditions such as environment, resources, space and the like, so the microbial pigments become research hotspots of broad students. Red, yellow and blue are used as three basic pigments, and can be matched with each other to present rich color tones. The red pigment in the natural pigment is mainly extracted from animals and plants and prepared by a microbial fermentation method. The curcumin, lutein, gardenia yellow, safflower yellow and the like are mainly produced by an extraction method, the production method mainly extracts from plants and is greatly influenced by seasons, and an organic solvent is introduced in the extraction, so that the cost is high. The microbial fermentation method for producing the haematochrome is not influenced by seasons, and has the advantages of high conversion rate, low cost and wide development prospect. However, because the strain resources are deficient, the related reports are few, and the monascus pigment produced by monascus has been publicly reported; gardenia red pigment produced by gardenia microorganisms; carotenoids produced by rhodotorula are a main way for obtaining natural haematochrome, but the variety and the quantity of the strains can not meet the requirements of various industries on the research and the development of the natural haematochrome. Therefore, screening out novel microbial strains capable of producing the red pigment in large quantity and yellow pigments with different characteristics has important scientific research and application values.

The 2017-M2 strain separated by the invention contains a beta-1, 4-mannan gene, and the highest similarity of the gene and the existing homologous gene is only 71 percent through BLAST-N comparison, so that the gene belongs to a new functional gene; in addition, the strain produces haematochrome, and the produced haematochrome is stable in the pH range of 2.0-9.0, and has good thermal stability and certain light stability. Therefore, the strain has high research value and application value.

Disclosure of Invention

The invention aims to overcome the defects of the prior art, and the variety and the number of the prior mannase strains can not meet the requirements of the industry on natural haematochrome producing strain resources. The atropis strain 2017-M2 provided by the invention has the capability of producing edible haematochrome, beta-1, 4-mannase and cellulase, and has very high research value and wide application value.

In order to achieve the purpose, the invention separates a bacterium which can generate natural haematochrome from soil, and the produced haematochrome is stable in the pH range of 2.0-9.0 and has better thermal stability and certain light stability.

The invention provides a haematochrome producing strain isolate which is determined to be atropisella (Talaromyces atroroseus) of the genus Bluey through classification and identification of microbial strains. The applicant names the strain Talaromyces atroroseus 2017-M2, and delivers the strain to China, Wuhan university China center for type culture Collection in 26 months 3 and 2019, wherein the preservation number is CCTCC NO: m2019205.

Talaromyces atroroseus2017-M2 strain morphological characteristics and physiological and biochemical characteristics:

the Talaromyces atroroseus2017-M2 strain is spotted on a PDA plate by using a toothpick, the strain is cultured for 5 days at the constant temperature of 28 ℃, the individual morphology of the strain is observed under a 10 x 40 optical microscope, the produced spores are spherical, the size of the spores is 4.0-8.0 mu M, the spores are blue-green, and a spore generator is a broomcorn conidiophore.

The growth characteristics and physiological and biochemical characteristics of the culture medium are as follows: good oxygen, good growth at 22-35 ℃, production of cellulase, mannase and amylase, no production of protease and no bacteriostatic action.

Extracting the total DNA of 2017-M2, performing PCR amplification by using PCR amplification universal primers of fungal 18s r DNA, and then sending to a commercial sequencing company for sequencing. The sequencing result was compared with the known sequences in the GenBank database by nucleic acid sequence alignment (Nucleotide BLAST), and the species having the closest relationship to the strain was determined to be Atorwas Lancetus, so the strain was named as Atorwas Lancetus (Talaromyces atroroseus)2017-M2 strain.

The fermentation of the 2017-M2 strain to produce haematochrome is tested, and the steps are as follows:

(1) a culture medium of No. 1 Gao's is selected from the 2017-M2 strain, inoculated on the surface of a solid culture medium by a plate-marking method and subjected to activated culture so as to detect the production characteristics of the strain and detect whether the strain is polluted by mixed bacteria or not.

(2) Inoculating the 2017-M2 strain culture obtained by the activation culture in the step (1) on a fermentation culture medium suitable for thallus proliferation, and performing constant-temperature shaking culture at 30 ℃ and 160rpm for 5-7 d.

(3) And (3) centrifugally collecting the fermentation liquid in the fermentation culture in the step (2), and measuring the OD value of the red pigment in the fermentation liquid at the wavelength of 600 nm.

The 2017-M2 strain adopts a glycerin tube preservation method: inoculating 2017-M2 strain on Gaoshi No. 1 culture medium, culturing at constant temperature of 30 deg.C for 5d, adding appropriate amount of sterile water to wash spores after the spores have grown to obtain spore with number of about 10⁸A spore suspension of individual spores; the spore suspension was then mixed with sterile glycerol (30% strength) at a ratio of 1: 1, shaking uniformly, and storing in a refrigerator at the temperature of-80 ℃ for 5-10 years.

The invention has the beneficial effects that:

the 2017-M2 strain provided by the invention is high in growth speed and low in culture condition requirement.

The natural haematochrome produced by the strain is mutually soluble with water, absolute ethyl alcohol, acetone, methanol and isopropanol; layering in diethyl ether and chloroform; layering n-butanol, isoamyl alcohol and ethyl acetate, and extracting the haematochrome into an organic layer; the solvent layer of ethyl acetate faded brown.

The 2017-M2 strain separated by the invention contains a beta-1, 4-mannan gene (shown in a sequence table SEQ ID NO: 2), and the highest similarity of the beta-1, 4-mannan gene and the homologous gene in the 2017-M2 strain is only 71 percent through comparison in a GenBank database, so that the method is very novel.

The invention provides a heterologous expression method of a novel beta-1, 4-mannase gene in a 2017-M2-based strain, which is characterized in that a beta-1, 4-mannase gene is artificially synthesized and is induced to efficiently express, and the method comprises the following steps:

(1) the strain Talaromyces atroroseus 2017-M2 is inoculated with a mannase identification culture medium for culture, and meanwhile, whether the strain is polluted by mixed bacteria is detected.

The mannase identification culture medium formula comprises: konjac mannan powder is 3.0 g/L; peptone 1.0 g/L; NaCl 1.0 g/L; MgSO (MgSO)₄ 0.2g/L；KH₂PO₄ 02 g/L; 20g/L of agar; supplementing distilled water to 1L; the pH of the medium was adjusted to 7.0.

(2) The Talaromyces atroroseus 2017-M2 strain is inoculated to a liquid culture medium for culture, further total DNA (namely genome DNA) of the strain is extracted, and a mannase gene fragment is obtained by PCR, wherein the nucleotide sequence of the mannase gene fragment is shown as a sequence table SEQ ID NO: 2.

(3) The novel beta-1, 4-mannase gene is expressed heterologously according to the conventional method, and the expression can be proved to produce the beta-1, 4-mannase.

The new gene is used as the full length of the strain DNA, the c DNA sequence of the mannan beta-1, 4-endonuclease gene is searched, and the construction of the plasmid is entrusted to Nanjing Kingsry company for synthesis, so as to obtain the plasmid pbEX-6P-1.

The heterologous expression method comprises the following steps: plasmid pbEX-6P-1 was ligated into DE3 starting from competent E.coli BL21(DE3) and expressed induced in IPTG at a final concentration of 1-2. mu. mol/L.

Description of the drawings:

FIG. 1: individual forms of the isolated Talaromyces atroroseus 2017-M2 strain of the present invention.

FIG. 2: colony morphology of Talaromyces atroroseus 2017-M2 strain. Description of reference numerals: FIG. 2 is a front view of a colony; FIG. 2B shows the reverse morphology of colonies.

FIG. 3: identification of mannanase from Talaromyces atroroseus 2017-M2 strain.

FIG. 4: hydrolysis loop of cellulase in Talaromyces atroroseus 2017-M2 strain.

FIG. 5: results for mannan β -1, 4-endonuclease activity gene blast X in Talaromyces atroroseus 2017-M2 strain.

FIG. 6: expression of the mannan beta-1, 4-endonuclease activity gene of the artificially synthesized Talaromyces atroroseus 2017-M2 in Escherichia coli at 37 ℃.

Detailed Description

Description of the sequence listing

SEQ ID NO 1 of the sequence Listing is the 18S r DNA sequence of Talaromyces atroroseus 2017-M2 strain isolated in the present invention.

The sequence table SEQ ID NO 2 is the Talaromyces atroroseus 2017-M2 mannan beta-1, 4-endonuclease (active) gene sequence synthesized by the invention.

The following is a further detailed description of specific embodiments of the invention, but the process of the invention is not limited to the examples described below.

All raw and auxiliary materials selected for use in the present invention, as well as the methods of culturing the selected species, are well known and used in the art, and all references to% in the present invention are by weight unless otherwise indicated.

Example 1 isolation, screening and identification of Talaromyces atroroseus 2017-M2 Strain

1. Isolation of the strain Talaromyces atroroseus 2017-M2

(1) The strain atropis (Talaromyces atroroseus)2017-M2 is isolated from soil below 5cm above the ground of Wuhan river summer district Tang-lake region in Wuhan city, Hubei province, where the Wuhan design engineering institute is located in the Hubei province. Weighing 10g of soil, diluting 10 times with 90mL of sterile water, shaking up, clarifying, and continuously diluting to 1000 times; and (3) coating 0.1mL of 1000-time diluent on a Martin Mengladesh solid plate, culturing for 3d, continuously culturing at room temperature to 7d, and observing the growth of colonies in a culture dish and the generation condition of water-soluble haematochrome in a culture medium. Selecting the blue mold colony producing red pigment. Pure cultures were streaked in solid Gauss No. 1 plates. Until no hybrid colony exists, a strain with the number of 2017-M2 is preferably selected, and the colony morphology is shown in figure 2.

(2) Inoculating the primarily screened strain to a PDA culture medium, and culturing for 5-7d under the conditions of 30 ℃ and constant temperature shaking at 160rpm, wherein the 2017-M2 strain with the largest red pigment generation and the largest growth amount can be seen.

(3) The selected 2017-M2 strain was shown to have β -1, 4-mannosan endonuclease activity in subsequent assays.

(4) The beta-1, 4-endomannanase gene of 2017-M2 strain was artificially synthesized and induced to be heterologously expressed in Escherichia coli BL21(DE 3). The induction conditions with the highest enzyme activity are as follows: 1mM IPTG 1.5. mu.L, 37 ℃ C, induction for 3 h. The enzyme activity is OD 0.496 x 2

The test result shows that:

the Talaromyces atroroseus 2017-M2 strain grows well at 22-35 ℃, and the optimal growth temperature is 30 ℃. The produced spores are spherical spores with the size of 4.0-8.0 μm, are blue-green, and the spore producer is broom-shaped conidiophore. Aerobic and without motility. When the nutrition is good, the spore production is less, the pigment production is less, and the spore production and the pigment production are more under the condition of malnutrition. More pigment is produced at the low temperature of 4-15 ℃, and less pigment is produced at the proper temperature. The colonies started to be white, pink, round, slightly raised, and regular edges. The thallus can produce cellulase and mannanase, does not produce protease, and has no bacteriostatic action, see figure 1, figure 3 and figure 4.

The taxonomic species of Talaromyces atroroseus2017-M2 strain were identified by 18S r DNA PCR:

total DNA of the Talaromyces atroroseus2017-M2 strain is extracted, and PCR amplification is carried out by adopting a general primer for PCR amplification of fungus 18S r DNA. The PCR product is purified by cutting gel and sent to a commercial sequencing company for sequencing, and the nucleotide sequence after sequencing is shown in SEQ ID NO. 1. BLAST comparison is carried out on the obtained nucleotide sequence and known sequences in a GenBank database, and the strain with the closest genetic relationship with the experimental strain is Talaromyces atroroseus strain IBT 11181, has 99 percent of the maximum homology with the experimental strain, and is a new strain discovered in 2013.

The 18S r DNA sequence of the Talaromyces atroroseus2017-M2 strain is shown as follows (SEQ ID NO:1 of the sequence identity sequence table):

AGGCTTCTTGGTGCGGACCTCGCGGGTCCACCTCCCACCCGTGTCTCTTGAATACC CTGTTGCTTTGGCGGGCCCACCGGGTCGCCCCGGTCGCCGGGGGGCACTGCGCCCCCG GGCCTGCGCCCGCCAGAGCGCTCTGTGAACCCTAATGAAGATGGGCTGTCTGAGTGTGA TTTTGAATTATCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGC AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACG CACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCA AGCGCGGCTTGTGTGTTGGGTGTGGTCCCCCCGGTGTTGGGGGGACCTGCCCGAAAGG CAGCGGCGACGTCCCGTCTAGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGGGAG GGGCCTGCGGGCGTTGGCCACCCACGATATTTTTTTACCGTTGACCTCGGATCAGGTAGG AGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA。

example 2 fermentation of Talaromyces atroroseus2017-M2 Strain for production and extraction of Red pigment

In this example, Talaromyces atroroseus2017-M2 strain was inoculated into a fermentation medium (100 mL fermentation medium was filled in a 500mL Erlenmeyer flask) which was PDA liquid medium: peeling potato 200g to 30min, taking 1000mL potato juice, adding glucose 20g, packaging, sterilizing, and pH 7.0. Shaking at 200rpm at 30 deg.C for 5d-7 d. Centrifuging the bacterial solution at 8000rpm for 10min to obtain fermentation liquid, filtering with bacterial filter for sterilization to obtain filtrate, i.e. crude extract of red pigment. And (3) putting the crude red pigment extraction liquid into a rotary evaporator at 70 ℃ for vacuum concentration until the crude red pigment extraction liquid becomes a paste, and obtaining a product, namely the crude red pigment extract.

The obtained crude extract of the haematochrome is dissolved in distilled water with the same amount as the fermentation culture medium, and scanning analysis is carried out in an ultraviolet spectrophotometer with the wavelength of 200-800nm, and the result shows that the haematochrome generated by the 2017-M2 has the maximum absorption peak at the position of 600nm, which indicates that the content of the haematochrome of the 2017-M2 can be measured by using light waves with the wavelength of 600 nm. Pigment yield and wet weight of mycelia of the 2017-M2 strain in different liquid media are shown in Table 1.

TABLE 1 pigment yield and wet weight of mycelia of 2017-M2 strain in different liquid culture media

Example 3 identification of production of cellulase by Talaromyces atroroseus 2017-M2 Strain

Picking strains, dotting the strains on a cellulose identification culture medium by using toothpicks, culturing for 5-7 days at 28 ℃, covering the culture medium with 1mg/ml Congo red solution, dyeing for 15min, pouring off the Congo red solution, washing off the Congo red solution by using 1mol/L NaCl solution for 15min, pouring off the NaCl solution, and observing a transparent ring, thereby indicating that the Talaromyces atroroseus 2017-M2 strain has the capability of producing cellulase.

Example 4 heterologous expression of the mannanase Gene from Talaromyces atroroseus 2017-M2 Strain

The artificially synthesized beta-1, 4-mannan gene (nucleotide sequence shown in SEQ ID NO:2) is inserted into pGEX-6p-1 plasmid. The method comprises the following specific steps: sterile dd H is used for 4 mu g of freeze-dried powder pure plasmid pbEX-6P-1 ₂O dissolved to 100 ng/. mu.L. Taking a competent cell (stored at-80 deg.C) containing 50-200 μ L of BL21(DE3), and thawing on ice for 20-30 min; transferring 2-3 μ L of the dissolved plasmid into thawed competent cells, and standing on ice for 30 min; placing the 2/3 in a water bath at 42 deg.C, and heating for 90 s; immediately taking out from the water bath, and putting back on ice for 5 min; adding it to 800 μ L LB medium, and culturing in a shaking incubator (200rpm) at 37 ℃ for 45min-1 h; partially or totally transformed into LB agar plate containing 10. mu.g/mL ampicillin (Amp); the plates were inverted and incubated overnight at 37 ℃. If colonies grow on Amp resistant plates, the transformation is successful. The transformation results are shown in FIG. 5.

Inoculating overnight-inoculated recombinant colony culture solution containing benzyl-resistant bacteria into 10ml of fresh LB liquid culture medium containing Amp < + > with the inoculation amount of 2% (namely 200 mul), and performing shake culture at 37 ℃ and 200rpm until the OD value is 0.8 at the wavelength of 600 nm;

adding IPTG with the concentration of 1mmol/L into each group in the culture solution, performing induced expression at different temperatures, performing shake culture at 150rpm, and performing subsequent detection after culturing for a certain time.

Taking out each culture solution, centrifuging at 4000rpm for 10min, collecting bacterial liquid, simultaneously making supernatant and uninduced bacteria control, and storing in a refrigerator at-20 deg.C. In each medium, different volumes of 1mmol/L IPTG were added to each group, and the induction of expression was carried out at different times, and the results are shown in FIG. 6.

The nucleotide sequence of the mannanase gene (i.e., the mannan β -1, 4-endonuclease activity gene) of the Talaromyces atroroseus 2017-M2 strain is shown below:

GGATCCATGGCGGTGCACATGCGTAAGGCGGTTTTCGCGCTGAGCCTGATCAGCGG TGTGCTGGCGGCGCCGTACAAACGTCTGGAGAACCCGCTGGGTGTTCAGTATGGCATTG ACGCGAGCAGCATGATCAGCTACGATAGCATTTATTTTGGCTGGGCGCCGAACTACAAG CCGAGCGTGACCCTGGCGAGCCTGAACCAGGCGACCGGTCAAAAAGGCGCGACCTACA ACGTGTATAGCCAGATCACCAGCAGCAACGTTGACAGCGGTAGCTACGATGGCAACTAC CAATATAACCTGACCATTCCGACCAGCGTGAACTACGACGAGTATAAGACCGCGTGGAA AACCATGTATAACGCGGTTAGCAGCAACGATAAGATCTTCATGTTTTGGAGCCCGAACG ACGATACCAGCAGCGAACCGGTTGCGCCGTGGTGGCCGGGCGAGGAATACGTGGACAT TGTTGGCATGGATTACTATCCGAACGCGGACGAGGGTCTGCCGGATTTCGAAAGCGCGT ACGGCGCGTTTTACGACACCTATAGCGCGGGTTATGGCATCCCGTTCGCGATTGGCGAGA CCGGCACCCAGCTGAGCAACGGTGATAGCGCGAGCACCGAACAAAAAGAGGAGTGGC TGAAAGCGGTGATCAACCCGCTGAGCGGTTTCGGCGACTACAGCGAGTACTATTTCAGC TGCACCTGGTTTGAATATGGTCCGCCGACCAACGACATCAACTTCTACATCGTTTACGAA CAAGATAGCAGCGTGGTTACCGAGACCATTAGCAACACCGAAAGCGGCACCGCGTAAC TCGAG。

the analysis result shows that the cloned mannase gene is a newly discovered functional gene.

Sequence listing

<110> Wuhan design engineering college

<120> 2017-M2 strain containing mannanase gene

<141> 2019-09-15

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 569

<212> DNA

<213> beta-mannanase (beta-mannase)

<220>

<221> gene

<222> (1)..(569)

<400> 1

aggcttcttg gtgcggacct cgcgggtcca cctcccaccc gtgtctcttg aataccctgt 60

tgctttggcg ggcccaccgg gtcgccccgg tcgccggggg gcactgcgcc cccgggcctg 120

cgcccgccag agcgctctgt gaaccctaat gaagatgggc tgtctgagtg tgattttgaa 180

ttatcaaaac tttcaacaat ggatctcttg gttccggcat cgatgaagaa cgcagcgaaa 240

tgcgataagt aatgtgaatt gcagaattcc gtgaatcatc gaatctttga acgcacattg 300

cgccccctgg cattccgggg ggcatgcctg tccgagcgtc atttctgccc tcaagcgcgg 360

cttgtgtgtt gggtgtggtc cccccggtgt tggggggacc tgcccgaaag gcagcggcga 420

cgtcccgtct aggtcctcga gcgtatgggg ctttgtcacc cgctcgggag gggcctgcgg 480

gcgttggcca cccacgatat ttttttaccg ttgacctcgg atcaggtagg agttacccgc 540

tgaacttaag catatcaata agcggagga 569

<210> 2

<211> 825

<212> DNA

<213> Atoromyces (Talaromyces atroroseus)

<220>

<221> gene

<222> (1)..(825)

<400> 2

ggatccatgg cggtgcacat gcgtaaggcg gttttcgcgc tgagcctgat cagcggtgtg 60

ctggcggcgc cgtacaaacg tctggagaac ccgctgggtg ttcagtatgg cattgacgcg 120

agcagcatga tcagctacga tagcatttat tttggctggg cgccgaacta caagccgagc 180

gtgaccctgg cgagcctgaa ccaggcgacc ggtcaaaaag gcgcgaccta caacgtgtat 240

agccagatca ccagcagcaa cgttgacagc ggtagctacg atggcaacta ccaatataac 300

ctgaccattc cgaccagcgt gaactacgac gagtataaga ccgcgtggaa aaccatgtat 360

aacgcggtta gcagcaacga taagatcttc atgttttgga gcccgaacga cgataccagc 420

agcgaaccgg ttgcgccgtg gtggccgggc gaggaatacg tggacattgt tggcatggat 480

tactatccga acgcggacga gggtctgccg gatttcgaaa gcgcgtacgg cgcgttttac 540

gacacctata gcgcgggtta tggcatcccg ttcgcgattg gcgagaccgg cacccagctg 600

agcaacggtg atagcgcgag caccgaacaa aaagaggagt ggctgaaagc ggtgatcaac 660

ccgctgagcg gtttcggcga ctacagcgag tactatttca gctgcacctg gtttgaatat 720

ggtccgccga ccaacgacat caacttctac atcgtttacg aacaagatag cagcgtggtt 780

accgagacca ttagcaacac cgaaagcggc accgcgtaac tcgag 825

Claims

1. Atrox bacterium (containing mannanase gene and capable of producing haematochrome and cellulase) separatedTalaromyces atroroseus) 2017-M2 strain, which is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2019205; the nucleotide sequence of the mannanase gene is shown as a sequence table SEQ ID NO. 2.

2. The bacterium atrox of claim 1 (a)Talaromyces. atroroseus) Application of 2017-M2 strain in preparing haematochrome and cellulase.