CN110564856A - Digital PCR kit for detecting human EGFR gene mutation - Google Patents

Abstract

The invention provides a digital PCR kit for detecting human EGFR gene mutation, which comprises a plurality of Ex19Del mutations and L858R mutations which are simultaneously detected in the same reaction tube digital PCR reaction system, wherein the Ex19Del locus uses a plurality of ARMS primers to identify the mutation type, and the L858R locus uses a TaqMan fluorescent probe to identify the wild type and the mutation type; after PCR amplification, the Ex19Del mutant, L858R mutant and L858R wild type were detected by the position and intensity of the fluorescence signal and directly and absolutely quantified. The kit has high flux and low cost, realizes the combination of the Ex19Del25 locus and the L858R locus into one tube for detection, improves the detection flux and reduces the cost of reagent consumables.

Description

Digital PCR kit for detecting human EGFR gene mutation

Technical Field

The invention relates to the technical field of digital PCR, in particular to a digital PCR kit for detecting human EGFR gene mutation.

Background

In the precise medical practice of NSCLC, monitoring the type of gene mutations associated with targeted drug administration in patients can be used to assess efficacy.

The Epidermal Growth Factor Receptor (EGFR) is an important action target of targeted therapy, and a tyrosine kinase functional region of the EGFR is coded by exons 18-24 and plays an important role in regulating cell proliferation and differentiation. The EGFR gene mutation is a somatic mutation. It is known that human EGFR gene mutations are predominantly located in exons 18-21; more than 80% of the mutations in EGFR in NSCLC patients are deletion mutation of exon L9 (Ex19Del) and L858R mutation of exon 21. Of these, the exon 19 deletion mutation accounted for about 46%, while the L858R mutation accounted for about 42%. The EGFR-TKI drug has obvious effect on patients with EGFR L858R and EGFR exon 19 deletion mutation.

Tumor tissue or cytological markers are common test materials for detecting human EGFR gene mutation, but tissue drawing causes trauma to patients and sometimes can not be drawn due to physical reasons of the patients. In recent years, plasma free DNA (cfDNA) has been considered as a sample that can be used to detect mutations in the human EGFR gene instead of tumor tissue, and the cfDNA has advantages for tumor mutation detection in that: the operation is non-invasive; can be obtained in any process of the disease; real-time monitoring and dynamic detection can be realized; overcoming the specificity of tumor tissues.

The plasma cfDNA content is very low, and cfDNA fragments are very short, and the methods for detecting the plasma EGFR mainly comprise qPCR, NGS and digital PCR. The NGS experiment is complex in operation, high in cost and long in detection period; qPCR is simple and fast to operate, but the sensitivity is relatively low; the digital PCR is not only fast and convenient, but also has high sensitivity, and has great advantages in the detection of the plasma EGFR.

The digital PCR flux on the current market is lower, the fluorescent channel is less, if the EGFR gene multi-site simultaneous detection can be carried out, the reagent and consumable cost can be reduced, low-content cfDNA does not need to be distributed to different detection systems, and the detection sensitivity is improved. Although there are patents describing that multi-site detection can be performed by using concentration differences of probes on the basis of dual detection channels, the complexity of clinical samples may cause signals to appear not in the form of "signal piles" but in the form of "signal bands", thereby causing partial overlapping of the "signal bands" and making the results difficult to interpret.

The most major mutations of EGFR are Ex19Del, L858R, which account for nearly 90% of human EGFR gene mutations. The EGFR Ex19Del deletion mutant has a large number of deletion mutants, an ARMS detection primer is designed for each mutation mutant in a qPCR (quantitative polymerase chain reaction) common method, the ARMS method has the common problem of non-specific amplification of a wild-type template, and the ARMS method has more serious non-specific amplification problem on a digital PCR platform because the amplification signals (including non-specific amplification signals) can be enriched in a micro-droplet or a micro-reaction chamber by digital PCR.

at present, 2 common methods for detecting EGFR Ex19Del deletion mutation by using digital PCR (polymerase chain reaction) are available:

The method comprises the following steps of 1, relatively fixing Ex19Del deletion mutation positions, designing a detection probe or a Block blocking probe at the deletion positions, designing a universal probe outside the deletion positions, designing a peripheral universal primer, and distinguishing wild type and mutant type according to the combination of the deletion position detection probe or the Block blocking probe. The method can only indirectly judge whether the deletion region has a sequence inconsistent with the wild type, and when the deletion region has SNP or other types of base changes, the method can generate false positive.

2. the method not only increases the cost, but also causes the over-high total concentration of the probes in the detection system to cause the over-high fluorescence background value and influence the detection.

The invention aims to provide a method and a kit for double detection of EGFR Ex19Del and L858R mutation by droplet digital PCR, which can be used for detecting 10 Ex19Del deletion mutation sites (ARMS method) and L858R sites with high throughput, have strong specificity and high sensitivity, and can calculate mutation rate of each site.

Disclosure of Invention

in order to solve the above problems, the present invention provides a digital PCR kit for detecting human EGFR gene mutation, characterized in that the digital PCR kit comprises a plurality of Ex19Del mutations and L858R mutations simultaneously detected in the same reaction tube digital PCR reaction system, wherein the Ex19Del site recognizes the mutant type using a plurality of ARMS primers, and the L858R site recognizes the wild type and the mutant type using a TaqMan fluorescent probe; after PCR amplification, the Ex19Del mutant, L858R mutant and L858R wild type were detected by the position and intensity of the fluorescence signal and directly and absolutely quantified.

In one embodiment, the mutation rate of L858R was calculated directly using digital PCR quantification results, i.e., the mutation rate of L858R was L858R mutant/(L858R mutant + L858R wild type); and the Ex19Del mutation rate is calculated according to the L858R quantitative result, namely the Ex19Del mutation rate is Ex19Del mutant/(L858R mutant + L858R wild type).

In one embodiment, the primer probe combinations used to detect multiple Ex19Del mutations are as follows:

primers or probes	sequence of	Base change
			The upstream primer SEQ ID NO: 1	AAATTCCCGTCGCTATCAAAAC	2235_2249del15
The upstream primer SEQ ID NO: 2	TTCCCGTCGCTATCAAGACATC	2236_2250del15
			the upstream primer SEQ ID NO: 3	CCGTCGCTATCAAGGCATCTC	2237_2251del15
The upstream primer SEQ ID NO: 4	CGTCGCTATCAAGGTTCCG	2237_2255>T
			The upstream primer SEQ ID NO: 5	CCGTCGCTATCAAGGAACCG	2239_2256del18
The upstream primer SEQ ID NO: 6	GTCGCTATCAAGGAATCTCCG	2238_2252del15
			The upstream primer SEQ ID NO: 7	CGTCGCTATCAAGGAATCGAA	2240_2257del18
The upstream primer SEQ ID NO: 8	CGTCGCTATCAAGGAACCATC	2239_2251>C
			The upstream primer SEQ ID NO: 9	GTCGCTATCAAGGAACCAACAT	2239_2248>C
The upstream primer SEQ ID NO: 10	CGTCGCTATCAAGGAAGCAAC	2239_2247del9
			Downstream primer SEQ ID NO: 11	GAGCCATGGACCCCCAC
Universal probe SEQ ID NO: 12	FAM-CGATGTGAGTTTCTG-MGB

。

In one embodiment, the primer probe combination used to detect multiple Ex19Del mutations further comprises a long blocking probe spanning the deletion region, which is fully complementary to the wild type and covers the ARMS primer region, and the 3' end of the probe is labeled with a phosphate group to prevent downward extension of the probe.

in one embodiment, the blocking probe is SEQ ID NO: 13: CGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAA are provided.

In one embodiment, the L858R mutation detection probes were labeled with two different fluorophores, respectively, and the Ex19Del mutation detection probe was labeled with one of the fluorophores; and the proportion of two different fluorescence labeled probes in the L858R mutation detection probe is adjusted, so that the L858R mutant signal can be distinguished from the Ex19Del mutant signal.

In one embodiment, primers and probes for L858R mutation detection are as follows:

In one embodiment, the mutant probe is SEQ ID NO: 17 and mutant probe SEQ ID NO: 18 are in a 2:1 numerical ratio.

In one embodiment, the L858R quantification results are used to control the concentration and quality of template DNA.

10. The digital PCR kit for detecting human EGFR gene mutation according to any one of claims 1 to 9, which is further applied to the detection of the following 15 Ex19Del mutations:

Serial number	Amino acid changes	Base change
			1	E746_S752>A	2237_2254del18
2	E746_S752>D	2238_2255del18
			3	L747_P753>Q	2239_2258>CA
4	K745_E749del	2233_2247del15
			5	E746_E749del	2235_2246del12
6	L747_T751>S	2240_2251del12
			7	L747_A750>P	2238_2248>GC
8	S752_I759del	2253_2276del24
			9	E746_P753>VS	2237_2257>TCT
10	E746_T751>V	2237_2252>T
			11	L747_S752>QH	2239_2256>CAA
12	E746_T751>I	2235_2252>AAT
			13	L747_T751>Q	2238_2252>GCA
14	E746_T751>IP	2235_2251>AATTC
			15	E746_A750>IP	2235_2248>AATTC

。

the kit has the following advantages:

1) High flux, low cost: the Ex19Del25 locus and the L858R locus are combined into one tube for detection, the detection flux is improved, and the cost of reagent consumables is reduced.

2) The sensitivity is high: under a complex detection background, the detection sensitivity of the kit can still reach 0.1%, and compared with the 1% sensitivity of the conventional ARMS method, the kit has more advantages;

3) The specificity is strong: the kit designs specific primers and probes aiming at multiple mutations of EGFR gene, and specially designs a closed probe, the combination of the primers and the probes has strong specificity in PCR amplification reaction, and no non-specific signal exists in the background of 200ng wild type genome;

4) the method is simple and rapid to operate, and compared with NGS, the method has the advantages of few operation steps, short period, low cost and flexible reaction flux.

Drawings

To better show the specificity and accuracy of the PCR identification system of the present invention, the drawings used in the examples will be briefly described.

FIG. 1 is a diagram of the results of digital PCR amplification of a wild-type template detected without adding a blocking probe in the ARMS detection system of Ex19Del according to the present invention;

FIG. 2 is a diagram of the digital PCR amplification result of detecting a wild-type template by adding a closed probe to the ARMS detection system of Ex19Del according to the present invention;

FIG. 3 is a diagram of the results of detecting the mutant template digital PCR amplification by adding a blocking probe to the ARMS detection system of Ex19Del according to the present invention;

FIG. 4 is a graph showing the results of simultaneous detection of Ex19Del and L858R digital PCR amplification in a one-tube digital PCR system according to the present invention, wherein the mutation detection probes of the two are each labeled with a fluorescent label;

FIG. 5 is a graph showing the results of the simultaneous detection of Ex19Del and L858R digital PCR amplification in a single-tube digital PCR system according to the present invention, wherein two fluorescently labeled probes are used for the L858R mutation detection probe, and one fluorescently labeled probe is used for the Ex19Del mutation detection probe;

FIG. 6 is a graph showing the results of detecting Ex19Del mutant using the reaction body assay of FIG. 5;

FIG. 7 is a graph showing the results of detecting the L858R mutant form using the reagent assay of FIG. 5; and

FIG. 8 is a graph showing the results of L858R detection of wild type using the reaction body assay of FIG. 5.

Detailed Description

in order to make those skilled in the art better understand the technical solutions in the present application, the present invention will be further described below with reference to the following embodiments, and it is obvious that the described embodiments are only a part of the embodiments of the present application, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application. The present invention will be further described with reference to the following examples.

EXAMPLE I construction of the kit of the invention

An example of microdroplet digital PCR reaction conditions for detecting primer probe performance is as follows: firstly, extracting nucleic acid of a clinical sample by a nucleic acid extraction kit, and then preparing a PCR amplification system, wherein a PCR amplification reaction mixture comprises: 2 XMasterMix premix (Bio-Rad), primers 200-1000nM each, template DNA 10-200ng, water to 20ul, mix reagents. The preparation of the microdroplets was carried out using a microdroplet generator (Bio-Rad) according to the instructions. Then the 8-linked discharge tube containing the micro-droplets is placed on a PCR instrument for amplification, and the amplification conditions are set as follows:

After PCR amplification, droplet detection and data analysis were performed using a QX200 reader (Bio-Rad) according to the instructions for the instrument. The Ex19Del mutant, L858R mutant and L858R wild type were detected by the position and intensity of the fluorescence signal and directly and absolutely quantified. The Ex19Del, L858R mutation rate was calculated.

First, ARMS primer detection system design of Ex19Del

10 upstream ARMS primers, 1 downstream universal primer and 1 universal probe are designed aiming at 10 deletion mutants of Ex19Del, and the universal probe is marked by FAM fluorescent group.

primers or probes	Sequence of	Amino acid changes	Base change
				The upstream primer SEQ ID NO: 1	AAATTCCCGTCGCTATCAAAAC	E746_A750del	2235_2249del15
the upstream primer SEQ ID NO: 2	TTCCCGTCGCTATCAAGACATC	E746_A750del	2236_2250del15
				The upstream primer SEQ ID NO: 3	CCGTCGCTATCAAGGCATCTC	E746_T751>A	2237_2251del15
The upstream primer SEQ ID NO: 4	CGTCGCTATCAAGGTTCCG	E746_S752>V	2237_2255>T
				The upstream primer SEQ ID NO: 5	CCGTCGCTATCAAGGAACCG	L747_T751del	2239_2256del18
The upstream primer SEQ ID NO: 6	GTCGCTATCAAGGAATCTCCG	L747_P753>S	2238_2252del15
				The upstream primer SEQ ID NO: 7	CGTCGCTATCAAGGAATCGAA	L747_E749del	2240_2257del18
The upstream primer SEQ ID NO: 8	CGTCGCTATCAAGGAACCATC	L747_S752del	2239_2251>C
				The upstream primer SEQ ID NO: 9	GTCGCTATCAAGGAACCAACAT	L747_T751>P	2239_2248>C
The upstream primer SEQ ID NO: 10	CGTCGCTATCAAGGAAGCAAC	L747_A750>P	2239_2247del9
				Downstream primer SEQ ID NO: 11	GAGCCATGGACCCCCAC
Universal probe SEQ ID NO: 12	FAM-CGATGTGAGTTTCTG-MGB

the system described above, without the addition of blocking probe, showed severe non-specific amplification when detecting wild-type template, as shown in FIG. 1. In FIG. 1, the ordinate represents the fluorescence value of FAM, the abscissa represents the fluorescence value of VIC, the blue dots represent the mutant signal dots, and the black dots represent the negative signal dots without amplification

In order to solve the serious non-specific problem generated by overlapping Ex19Del 10 ARMS primers, a long blocking probe spanning a deletion region is designed, the long blocking probe is completely complementary with a wild type and covers an ARMS primer region, and the 3' end of the probe is marked by a phosphate group to avoid downward extension of the probe. Because the deletion mutant template is obviously different from the wild template, the blocking probe is only combined with the wild template, the Tm value of the blocking probe reaches 80 ℃, and the blocking probe is preferentially combined with the wild template in the PCR annealing process, so that the combination of the ARMS primer and the wild template is prevented, and the problem of non-specific amplification is solved.

The blocking probe sequence is as follows:

Blocking probe SEQ ID NO: 13

CGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAA

After addition of blocking probe to Ex19Del base system, 200ng of wild-type genome was detected with no non-specific signal spots at all, as shown in FIG. 2, while the mutant was still normally detectable, as shown in FIG. 3. In FIGS. 2 and 3, the ordinate represents the FAM fluorescence value, the abscissa represents the VIC fluorescence value, the blue dots represent the mutant signal dots, and the black dots represent the negative signal dots without amplification.

ARMS primers amplify only the mutant template and not the wild type template. Thus, when a wild-type template is added, theoretically there should be no amplification signal, so that only black non-amplification negative signal spots appear as in FIG. 2; in the presence of non-specific amplification, blue FAM-positive signal spots appear, as in FIG. 1.

design of TaqMan probe detection system of II, L858R

Primer probes were designed as follows:

The results of the clinical samples detected by the system are shown in fig. 4, and it can be seen from the figure that the L858R FAM positive signal and the Ex19Del FAM positive signal have partial overlap (the included angles between the connecting lines of the mutant signal of the Ex19Del, the mutant signal of the L858R and the negative signal and the ordinate are all 0 °). Ideally, the differences in the concentrations of the Ex19Del and L858R FAM probes are adjusted to achieve the differentiation effect by the differences in the intensities of the Ex19Del and L858R mutant signals, but due to the complexity of the clinical samples, the detection signals of the clinical samples L858R are usually distributed in a band shape (see fig. 4, blue dots). Similarly, the Ex19Del detection signal may be in a band-like distribution, which may cause the mutant signal of Ex19Del and the mutant signal of L858R to be partially overlapped and indistinguishable, so that the Ex19Del and L858R systems cannot be directly combined into one tube. In FIG. 4, the ordinate represents the FAM fluorescence value, the abscissa represents the VIC fluorescence value, the blue dots represent the mutant signal dots, the green dots represent the wild-type signal dots, and the orange dots represent the mutant/wild-type double positives.

In order to distinguish the mutant signal of L858R from the mutant signal of Ex19Del, the mutant detection probe of L858R was labeled with two fluorophores, FAM and VIC, respectively, and the ratio of the two was adjusted to distinguish the mutant signal from the mutant signal of Ex19Del, and the detection results are shown in FIG. 5. In FIG. 5, the L858R mutation detection probe is labeled with two fluorophores, FAM and VIC, respectively, and the ratio of the two is adjusted (2:1) so that the connecting line of the L858R mutation signal (blue point) and the negative signal forms an angle with the ordinate, as shown in FIG. 5, about 45 degrees; and the included angle between the connecting line of the Ex19Del mutant signal and the negative signal and the ordinate is 0 degrees, thereby achieving the distinguishing effect.

Therefore, the L858R optimization system is as follows:

third, the ARMS primer detection system of Ex19Del and the TaqMan probe detection system of L858R are combined for use

After the Ex19Del and L858R systems are optimized respectively, the two systems are combined into a dual system as shown in the following table:

the result of detecting the Ex19Del mutant type by the dual system is shown in FIG. 6, wherein the ordinate represents the FAM fluorescence value, the abscissa represents the VIC fluorescence value, the blue dot represents the Ex19Del mutant type signal dot, the green dot represents the L858R wild type signal dot, the orange dot represents the Ex19Del mutant type/L858R wild type double positive signal dot, and the black dot represents the negative signal dot without amplification in FIG. 6.

The results of the above dual system detection of L858R are shown in FIG. 7, wherein the ordinate represents the FAM fluorescence value, the abscissa represents the VIC fluorescence value, the blue dot represents the L858R mutant signal point, the green dot represents the L858R wild-type signal point, the orange dot represents the L858R mutant/L858R wild-type double-positive signal point, and the black dot represents the negative signal point without amplification in FIG. 7.

The results of the above-mentioned double system detection of L858R wild type are shown in FIG. 8, the ordinate represents the FAM fluorescence value, the abscissa represents the VIC fluorescence value, the green dots represent the L858R wild type signal dots, and the black dots represent the negative signal dots without amplification.

Fourthly, the detection system of the invention detects other sites of EGFR

The double system can also detect 15 deletion mutants in the table below by ARMS primer cross-recognition, so that the double system can detect 25 Ex19Del deletion mutants and 1L 858R mutant, and 26 mutations in total.

serial number	Amino acid changes	Base change
			1	E746_S752>A	2237_2254del18
2	E746_S752>D	2238_2255del18
			3	L747_P753>Q	2239_2258>CA
4	K745_E749del	2233_2247del15
			5	E746_E749del	2235_2246del12
6	L747_T751>S	2240_2251del12
			7	L747_A750>P	2238_2248>GC
8	S752_I759del	2253_2276del24
			9	E746_P753>VS	2237_2257>TCT
10	E746_T751>V	2237_2252>T
			11	L747_S752>QH	2239_2256>CAA
12	E746_T751>I	2235_2252>AAT
			13	L747_T751>Q	2238_2252>GCA
14	E746_T751>IP	2235_2251>AATTC
			15	E746_A750>IP	2235_2248>AATTC

Fifthly, calculating mutation rate and controlling quality in the dual system

The dual system can quantitatively detect the Ex19Del mutant, the L858R mutant and the L858R wild type, and the mutation rate of L858R can be calculated by L858R mutant/(L858R mutant + L858R wild type); since Ex19Del and L858R are located at 19 and 21 exons of EGFR gene, respectively, these 2 exons are essential for EGFR gene function, and the copy number of EGFR 19 exon must be equal to the copy number of 21 exon in the absence of 19 and 21 exon amplification of EGFR gene, the mutation rate of Ex19Del can be calculated by Ex19Del mutant/(L858R mutant + L858R wild type).

The L858R quantitative result (L858R mutant + L858R wild type) is used for controlling the concentration and quality of template DNA, thus the system is more complete.

Example II application of the kit of the invention

1. The positive and negative reference are used to test the accuracy and specificity of the detection of the kit.

The positive reference substance covers each mutation type, wherein the number of the strong positive reference substance is 11, and the number of the weak positive reference substance is 11, and the total number of the weak positive reference substance is 22. And quantifying mutation proportion of 7 enterprise references by using digital PCR.

The negative reference substance comprises 11 parts of 5 parts of human EGFR gene mutation negative national reference substances, 5 parts of EGFR other mutation positive national reference substances outside the detection range of the kit and 1 part of non-human genome DNA (enterprise reference substance).

The amount of the DNA template was 10ng, and the positive and negative reference samples are shown in the following table:

And (3) using the finished product kits to respectively detect 22 positive reference products, wherein the detection result is positive and the type is accurate.

And (3) respectively detecting 11 negative reference products by using the finished product kits, wherein the detection results are negative.

2. minimum detection limit detection of the kit of the present application

The detection limit reference covers each mutation type, and comprises 8 parts of national reference (prepared by diluting a positive reference with a mutation rate of 2.5 percent by 25 times), 3 parts of enterprise reference (prepared by mixing a plasmid of the mutation type with DNA of a human EGFR wild type cell line), and 12 parts in total. The 3 enterprise references were quantified for mutation ratio by digital PCR.

The sample with a DNA template amount of 50ng and a mutation ratio of 0.1% was used as the lowest detection limit reference in this example, which is specifically shown in the following table:

the test was repeated 20 times, and the test results are shown in the following table:

3. Repeatability detection of the kit of the present application

All the repeatability references are enterprise references, including strong positive repeatability references, weak positive repeatability references and negative repeatability references. The strong positive repetitive reference covers 2 common mutation types (prepared by mixing plasmid/cell line DNA of the mutation type with human EGFR wild type cell line DNA), and the total amount is 2; the weakly positive repetitive reference covers 2 common mutation types (prepared by mixing a plasmid of the mutation type with human EGFR wild-type cell line DNA), and the number of the mutation types is 2; negative repetitive reference 1 (human EGFR wild type cell line DNA). Wherein, the mutation proportion of the strong positive and weak positive repeatability reference products is 50 percent and 5 percent respectively, the amount of the DNA template is 10ng, and all the repeatability reference products are verified by digital PCR. The repetitive reference samples are specified in the following table:

The test was repeated 10 times, and the test results obtained are shown in the following table

From the above description, it can be seen that the above-described embodiments of the present invention achieve the following technical effects:

1) High flux, low cost: the Ex19Del25 locus and the L858R locus are combined into one tube for detection, the detection flux is improved, and the cost of reagent consumables is reduced.

2) The sensitivity is high: under a complex detection background, the detection sensitivity of the kit can still reach 0.1%, and compared with the 1% sensitivity of an ARMS method, the kit has more advantages;

3) the specificity is strong: the kit designs specific primers and probes aiming at multiple mutations of EGFR gene, and specially designs a closed probe, the combination of the primers and the probes has strong specificity in PCR amplification reaction, and no non-specific signal exists in the background of 200ng wild type genome;

4) The method is simple and rapid to operate, and compared with NGS, the method has the advantages of few operation steps, short period, low cost and flexible reaction flux.

It is to be understood that the invention disclosed is not limited to the particular methodology, protocols, and materials described, as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Sequence listing

<110> Xinyi manufacturing technology (Beijing) Ltd

<120> a digital PCR kit for detecting human EGFR gene mutation

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaattcccgt cgctatcaaa ac 22

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ttcccgtcgc tatcaagaca tc 22

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccgtcgctat caaggcatct c 21

<210> 4

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgtcgctatc aaggttccg 19

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccgtcgctat caaggaaccg 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gtcgctatca aggaatctcc g 21

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cgtcgctatc aaggaatcga a 21

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgtcgctatc aaggaaccat c 21

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gtcgctatca aggaaccaac at 22

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgtcgctatc aaggaagcaa c 21

<210> 11

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gagccatgga cccccac 17

<210> 12

<211> 15

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgatgtgagt ttctg 15

<210> 13

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cgtcgctatc aaggaattaa gagaagcaac atctccgaa 39

<210> 14

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcagcatgtc aagatcacag att 23

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cctccttctg catggtattc tttct 25

<210> 16

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

agtttggcca gcccaa 16

<210> 17

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

agtttggccc gcccaa 16

<210> 18

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

agtttggccc gcccaa 16

Claims (10)

1. A digital PCR kit for detecting human EGFR gene mutation is characterized in that the digital PCR kit comprises a plurality of Ex19Del mutations and L858R mutations which are simultaneously detected in the same reaction tube digital PCR reaction system, wherein the Ex19Del locus uses a plurality of ARMS primers to identify a mutant type, and the L858R locus uses a TaqMan fluorescent probe to identify a wild type and the mutant type; after PCR amplification, the Ex19Del mutant, L858R mutant and L858R wild type were detected by the position and intensity of the fluorescence signal and directly and absolutely quantified.

2. The digital PCR kit for detecting human EGFR gene mutation according to claim 1, wherein the mutation rate of L858R is directly calculated using the quantitative results of digital PCR, that is, the mutation rate of L858R is L858R mutant/(L858R mutant + L858R wild type); and the Ex19Del mutation rate is calculated according to the L858R quantitative result, namely the Ex19Del mutation rate is Ex19Del mutant/(L858R mutant + L858R wild type).

3. the digital PCR kit for detecting human EGFR gene mutation according to claim 1, wherein the primer probe combinations for detecting a plurality of Ex19Del mutations are as follows:

Primers or probes Sequence of Base change The upstream primer SEQ ID NO: 1 AAATTCCCGTCGCTATCAAAAC 2235_2249del15 The upstream primer SEQ ID NO: 2 TTCCCGTCGCTATCAAGACATC 2236_2250del15 The upstream primer SEQ ID NO: 3 CCGTCGCTATCAAGGCATCTC 2237_2251del15 The upstream primer SEQ ID NO: 4 CGTCGCTATCAAGGTTCCG 2237_2255>T The upstream primer SEQ ID NO: 5 CCGTCGCTATCAAGGAACCG 2239_2256del18 The upstream primer SEQ ID NO: 6 GTCGCTATCAAGGAATCTCCG 2238_2252del15 The upstream primer SEQ ID NO: 7 CGTCGCTATCAAGGAATCGAA 2240_2257del18 The upstream primer SEQ ID NO: 8 CGTCGCTATCAAGGAACCATC 2239_2251>C The upstream primer SEQ ID NO: 9 GTCGCTATCAAGGAACCAACAT 2239_2248>C The upstream primer SEQ ID NO: 10 CGTCGCTATCAAGGAAGCAAC 2239_2247del9 Downstream primer SEQ ID NO: 11 GAGCCATGGACCCCCAC universal probe SEQ ID NO: 12 FAM-CGATGTGAGTTTCTG-MGB

。

4. the digital PCR kit for detecting human EGFR gene mutation according to claim 3, wherein the primer probe combination used for detecting a plurality of Ex19Del mutations further comprises a long blocking probe spanning the deletion region, the long blocking probe is completely complementary to the wild type and covers the ARMS primer region, and the 3' end of the probe is labeled with a phosphate group to avoid downward extension of the probe.

5. The digital PCR kit for detecting human EGFR gene mutation according to claim 4, wherein the blocking probe is SEQ ID NO: 13: CGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCCGAA are provided.

6. The digital PCR kit for detecting human EGFR gene mutation according to claim 1, wherein the L858R mutation detection probe is labeled with two different fluorophores, respectively, and the Ex19Del mutation detection probe is labeled with one of the fluorophores; and the proportion of two different fluorescence labeled probes in the L858R mutation detection probe is adjusted, so that the L858R mutant signal can be distinguished from the Ex19Del mutant signal.

7. The digital PCR kit for detecting human EGFR gene mutation according to claim 1, wherein primers and probes for L858R mutation detection are as follows:

8. the digital PCR kit for detecting human EGFR gene mutation according to claim 1, wherein the mutation type probe is SEQ ID NO: 17 and mutant probe SEQ ID NO: 18 are in a 2:1 numerical ratio.

9. The digital PCR kit for detecting human EGFR gene mutation according to claim 1, wherein the L858R quantitative result is used for controlling the concentration and quality of the template DNA.

10. The digital PCR kit for detecting human EGFR gene mutation according to any one of claims 1 to 9, which is further applied to the detection of the following 15 Ex19Del mutations:

Serial number Amino acid changes Base change 1 E746_S752>A 2237_2254del18 2 E746_S752>D 2238_2255del18 3 L747_P753>Q 2239_2258>CA 4 K745_E749del 2233_2247del15 5 E746_E749del 2235_2246del12 6 L747_T751>S 2240_2251del12 7 L747_A750>P 2238_2248>GC 8 S752_I759del 2253_2276del24 9 E746_P753>VS 2237_2257>TCT 10 E746_T751>V 2237_2252>T 11 L747_S752>QH 2239_2256>CAA 12 E746_T751>I 2235_2252>AAT 13 L747_T751>Q 2238_2252>GCA 14 E746_T751>IP 2235_2251>AATTC 15 E746_A750>IP 2235_2248>AATTC

。