CN110564764A - Targeting vector for site-specific integration of exogenous gene and application thereof - Google Patents
Targeting vector for site-specific integration of exogenous gene and application thereof Download PDFInfo
- Publication number
- CN110564764A CN110564764A CN201910727202.9A CN201910727202A CN110564764A CN 110564764 A CN110564764 A CN 110564764A CN 201910727202 A CN201910727202 A CN 201910727202A CN 110564764 A CN110564764 A CN 110564764A
- Authority
- CN
- China
- Prior art keywords
- gene
- sequence
- site
- targeting
- targeting vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 44
- 230000008685 targeting Effects 0.000 title claims abstract description 42
- 239000013598 vector Substances 0.000 title claims abstract description 42
- 230000010354 integration Effects 0.000 title claims description 23
- 101150076800 B2M gene Proteins 0.000 claims abstract description 11
- 239000013604 expression vector Substances 0.000 claims abstract description 10
- 230000009261 transgenic effect Effects 0.000 claims abstract description 8
- 108020005038 Terminator Codon Proteins 0.000 claims abstract description 7
- 108090000765 processed proteins & peptides Proteins 0.000 claims abstract description 7
- 108091026890 Coding region Proteins 0.000 claims abstract description 5
- 238000010367 cloning Methods 0.000 claims abstract description 4
- 238000010008 shearing Methods 0.000 claims abstract description 4
- 238000011144 upstream manufacturing Methods 0.000 claims abstract description 4
- 239000002773 nucleotide Substances 0.000 claims description 7
- 125000003729 nucleotide group Chemical group 0.000 claims description 7
- 108020004705 Codon Proteins 0.000 claims description 6
- 238000003776 cleavage reaction Methods 0.000 claims description 6
- 230000007017 scission Effects 0.000 claims description 6
- 108091027544 Subgenomic mRNA Proteins 0.000 claims description 3
- 239000013599 cloning vector Substances 0.000 claims description 2
- 101100111124 Sus scrofa B2M gene Proteins 0.000 abstract description 12
- 230000014509 gene expression Effects 0.000 abstract description 6
- 102000004506 Blood Proteins Human genes 0.000 abstract description 2
- 108010017384 Blood Proteins Proteins 0.000 abstract description 2
- 241000282887 Suidae Species 0.000 abstract description 2
- 238000013310 pig model Methods 0.000 abstract description 2
- 238000002360 preparation method Methods 0.000 abstract description 2
- 101150066002 GFP gene Proteins 0.000 description 13
- 108091033409 CRISPR Proteins 0.000 description 7
- 238000010354 CRISPR gene editing Methods 0.000 description 7
- 108020004414 DNA Proteins 0.000 description 7
- 230000015572 biosynthetic process Effects 0.000 description 7
- 238000003786 synthesis reaction Methods 0.000 description 7
- 101150038500 cas9 gene Proteins 0.000 description 6
- 238000010586 diagram Methods 0.000 description 6
- 241001465754 Metazoa Species 0.000 description 4
- 108091034117 Oligonucleotide Proteins 0.000 description 4
- 238000010276 construction Methods 0.000 description 4
- 238000005516 engineering process Methods 0.000 description 4
- 238000000034 method Methods 0.000 description 4
- 239000013642 negative control Substances 0.000 description 4
- 238000000684 flow cytometry Methods 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 238000003780 insertion Methods 0.000 description 2
- 230000037431 insertion Effects 0.000 description 2
- 238000001638 lipofection Methods 0.000 description 2
- 238000001890 transfection Methods 0.000 description 2
- 108010043121 Green Fluorescent Proteins Proteins 0.000 description 1
- 108010050258 Mitochondrial Uncoupling Proteins Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 101800001494 Protease 2A Proteins 0.000 description 1
- 101800001066 Protein 2A Proteins 0.000 description 1
- 101000868144 Sus scrofa Somatotropin Proteins 0.000 description 1
- 238000010459 TALEN Methods 0.000 description 1
- 108010043645 Transcription Activator-Like Effector Nucleases Proteins 0.000 description 1
- 230000002411 adverse Effects 0.000 description 1
- 102000015736 beta 2-Microglobulin Human genes 0.000 description 1
- 108010081355 beta 2-Microglobulin Proteins 0.000 description 1
- 239000006143 cell culture medium Substances 0.000 description 1
- 238000012761 co-transfection Methods 0.000 description 1
- 238000001976 enzyme digestion Methods 0.000 description 1
- 230000004049 epigenetic modification Effects 0.000 description 1
- 108091006047 fluorescent proteins Proteins 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 230000006801 homologous recombination Effects 0.000 description 1
- 238000002744 homologous recombination Methods 0.000 description 1
- 239000002609 medium Substances 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 238000011022 operating instruction Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 230000010473 stable expression Effects 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 230000001131 transforming effect Effects 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/108—Swine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Abstract
The targeting vector is formed by reversely inserting a targeting sequence into a multiple cloning site of an expression vector, the targeting sequence sequentially comprises a left homologous arm sequence, a 2A shearing peptide coding sequence, an exogenous gene and a right homologous arm sequence from left to right, the left homologous arm sequence is an upstream sequence of a termination codon of a pig B2M gene, the right homologous arm sequence is a downstream sequence of a termination codon of a pig B2M gene, and the termination codon of the pig B2M gene is positioned on a3 rd exon of the pig B2M gene. The B2M gene used by the targeting vector can generate endogenous low molecular weight serum protein in an organism, the expression level in various cells and tissues is constant, the targeting vector is not influenced by other factors, any exogenous gene sequence can be integrated to the downstream of the B2M gene of the pig at a fixed point by the constructed targeting vector, a cell line and a transgenic pig model for stably transferring the exogenous gene can be efficiently constructed, and a useful tool is provided for gene function research and preparation of transgenic pigs.
Description
Technical Field
The disclosure belongs to the field of animal genetic engineering, and particularly relates to a targeting vector for site-specific integration of exogenous genes and application thereof.
Background
In the process of constructing transgenic animals and researching the gain-of-function of genes, whether exogenous genes can be correctly, efficiently and stably expressed in animal genomes is the key to the success of the transgenic technology. Random integration of foreign genes into the genome of an animal can result in unstable expression or epigenetic modification of the gene due to location effects and dose effects. The fixed-point integration of the exogenous gene to a specific site can avoid the situation and can ensure that the exogenous gene is continuously and stably expressed in a genome. In recent years, with the advent of ZFN and TALEN technologies, particularly CRISPR/cas9 technologies, a new tool is provided for site-specific integration of foreign genes, the efficiency of site-specific integration of genes is greatly improved, and success is achieved in multiple species. However, a key factor of site-specific integration of genes is the selection of sites, and a good site should allow the exogenous genes of different sources to be expressed efficiently and stably in different tissues at different times in the target genome without adversely affecting the expression of the endogenous genes in the genome.
At present, relatively few sites for site-specific integration of exogenous genes are reported in pigs, and the exogenous gene expression can be directly driven by virtue of an endogenous gene promoter is more rarely reported, so that the provision of a new safe and friendly site is very important and beneficial.
Disclosure of Invention
The purpose of the present disclosure is to provide a targeting vector for site-specific integration of foreign genes and its application to obtain new safe and friendly site-specific.
In order to realize the purpose, the technical scheme is as follows:
The utility model provides a targeting vector of exogenous gene fixed point integration, the targeting vector is formed by expression vector's multiple cloning site reverse insertion targeting sequence, the targeting sequence from left to right is left side homology arm sequence, 2A shear peptide coding sequence, exogenous gene and right side homology arm sequence in proper order, left side homology arm sequence be the upstream sequence of pig B2M (beta-2-microglobulin ) gene stop codon, right side homology arm sequence is the downstream sequence of pig B2M gene stop codon, pig B2M gene stop codon is located pig B2M gene exon 3.
The nucleotide sequence of the left homologous arm is shown in SEQ ID NO. 1.
The 2A shearing peptide coding sequence is a nucleotide sequence for coding P2A shearing peptide and is shown as SEQ ID NO. 2.
The nucleotide sequence of the right homologous arm is shown in SEQ ID NO. 3.
The expression vector is a eukaryotic expression vector or a cloning vector, and the preferred eukaryotic expression vector is Pcdna3.1 (+).
The target sequence is inserted between HindIII and Kpn 1.
The sgRNA sequence used for targeting the termination codon of the pig B2M gene is SEQ ID No. 4.
The exogenous genes comprise pig growth hormone genes, UCP1 genes, fluorescent protein genes and the like.
The targeting vector for site-specific integration of the exogenous gene is applied to obtaining a cell line or a transgenic pig into which the exogenous gene is knocked at a fixed point.
The beneficial effects of this disclosure are: the B2M gene used by the targeting vector can generate an endogenous low molecular weight serum protein in a body, the expression level in various cells and tissues is constant, the targeting vector is not influenced by other factors, and the targeting vector is a gene with stable expression, so that the constructed targeting vector can integrate any exogenous gene sequence to the downstream of a B2M gene of a pig at a fixed point, can efficiently construct a cell line and a transgenic pig model for stably transforming the exogenous gene, and can provide a useful tool for gene function research and preparation of a transgenic pig.
Drawings
FIG. 1 is a schematic diagram of the targeting sequence using GFP as the foreign gene sequence described in example 1.
FIG. 2 is a schematic diagram of the targeting vector with GFP as the foreign gene sequence described in example 1.
FIG. 3 is a diagram of the flow cytometric analysis of the GFP gene spot knock-in cell line negative control described in example 3.
FIG. 4 is a diagram showing the flow cytometry analysis of an experimental group of GFP gene site-directed knock-in cell lines described in example 3.
Detailed Description
The following steps are only used for illustrating the technical scheme of the disclosure and are not limited; although the present disclosure has been described in detail with reference to the foregoing steps, those of ordinary skill in the art will understand that: the technical solutions recorded in the foregoing steps may still be modified, or some or all of the technical features may be equivalently replaced; and such modifications or substitutions do not depart from the scope of the respective technical solutions of the steps of the present disclosure.
Example 1 construction of GFP Gene site-directed knock-in targeting vector
A method for constructing a targeting vector for site-specific integration of a GFP gene into the downstream of a pig B2M gene comprises the following steps:
(1) Firstly, selecting a left homologous arm and a right homologous arm from a B2M gene reference sequence in NCBI, in order to prevent a GFP gene from being cut again by a CRISPR cutting vector after site-specific integration and prevent early termination of gene expression, removing a stop codon on the left homologous arm, and then sequentially connecting the left homologous arm, a P2A sequence, a GFP sequence and a right homologous arm sequence to form a key sequence of a homologous recombination site-specific insertion fragment, wherein the sequence structure diagram is shown in figure 1, and the nucleotide sequence of the GFP gene is SEQ ID NO. 5;
(2) The key fragment constructed above was inserted in reverse between the HindIII and Kpn1 sites of the cleavage site of the Pcdna3.1(+) multiple cloning site using a conventional eukaryotic expression vector Pcdna3.1(+) vector to construct a targeting vector for accomplishing the site-directed knockin of the GFP gene to the downstream of the pig B2M gene, which was named pcdna 3.1-B2M-GFP-KI-doro, and the construction of the targeting vector was accomplished, the structural diagram of which is shown in FIG. 2.
Example 2 CRISPR/cas9 cleavage vector construction
Selecting an sgRNA sequence at the upstream of a stop codon of the pig B2M gene: CATAGATCGAGACCACTAAC, named as B2M-sgR1, the oligonucleotide chain primer to be synthesized is B2M-sgR1-F/R, wherein the nucleotide sequences of B2M-sgR1-F/R are SEQ ID NO.6 and SEQ ID NO.7 respectively; specifically, the following table 1 (the underlined part is the cleavage site):
TABLE 1 synthetic oligonucleotide chains
The synthetic oligonucleotide sequences were diluted to 10uM, then 5 of each oligonucleotide sequence were mixed well and annealed on a PCR instrument, according to the following procedure: 10 minutes at 95 ℃; 30 minutes at 65 ℃. Connecting the annealed PCR product with a PX330 skeleton which is subjected to BbsI enzyme digestion, selecting a monoclonal colony for sequencing, and naming the successfully constructed vector as PX 330-B2M-sgR.
Example 3 construction of GFP Gene site-directed knock-in cell line
Experimental groups: the GFP gene site-directed knock-in targeting vector Pcdna 3.1-B2M-GFP-KI-doror and the CRISPR/cas9 cutting vector px330-B2M-sgR in the example 1 are used for co-transfecting PK15 cells by a liposome transfection method to construct a PK15 cell line stably transferring the GFP gene.
negative control: the GFP gene was directly ligated to the Pcdna3.1(+) vector, followed by co-transfection of PK15 cells with the corresponding CRISPR/cas9 cleavage vector using lipofection.
The specific operation flow is as follows:
One day before transfection, PK15 cells were seeded into 6-well plates; transfecting when the cells are confluent to about 80% on the next day; co-transfecting targeting vectors Pcdna 3.1-B2M-GFP-KI-doror and a CRISPR/cas9 cutting vector px330-B2M-sgR into PK15 cells according to the ratio of 1:1, co-transfecting a negative control GFP gene-linked Pcdna3.1(+) vector and a corresponding CRISPR/cas9 cutting vector into PK15 cells, and performing operation according to the operating instruction of lipo2000 (Invitrogen); after 48 hours of transfection, fluorescence was observed, and the cell culture medium containing 800ug/ml of G418 was replaced, and cultured in the medium containing G418 for three consecutive days, and cells containing GFP fluorescence were sorted by flow cytometry.
The GFP gene was knocked down to the downstream of B2M gene at a fixed point and then green fluorescent PK15 cells were sorted, and as shown in fig. 3 (negative control) and fig. 4 (experimental group), the flow sorting statistic data showed that the proportion of GFP positive cells could reach 1.26% or more.
SEQUENCE LISTING
<110> institute of Buddha science and technology
<120> targeting vector for site-specific integration of exogenous gene and application thereof
<130> 2019.07.31
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 900
<212> DNA
<213> Artificial Synthesis
<400> 1
gtgaaatcct ctggcgtttc atctgtcttt ccttgatgtt cctcaggtcc cccgaaggtt 60
caggtttact cacgccaccc agcggaaaac ggaaagccaa attacctgaa ctgctatgta 120
tctgggttcc atccgcccca gattgaaatt gatttgctga aaaacgggga gaagatgaac 180
gcggagcagt cagacctgtc tttcagcaag gactggtctt tctaccttct ggtccacact 240
gagttcactc ctaacgctgt ggatcagtat agctgccgcg tgaagcacgt gactctcgat 300
aagcccaaga tagttaagtg gggtgagttt tcaagttctt tccttcactg ctgccaaccg 360
aatctgagca tagccacagc agaacgctgc tctgacctaa aagcatctgc atcctgggat 420
tatcagggac tttattaaag ctccgtctag tagcaccttc tgagagacct ctgcttggca 480
cagtgcctga gacagtggtc tccctgcagt gagagcaagg agcagcagca gcagcagcag 540
cagcacttgc acaagtgcac atgcacttcc aacagttctt ccctagtggc ttctttggct 600
ttcctgacag cctcggggag agtcaggacc aaggagagtc tcagggaagc acaggccttg 660
gtctgtaagc cctgctctcc tggtgccctc caatcctgga cccctccagt tgtctggctg 720
gggtgggatc taggccacca ggcaaggttg ggtcctaaca aggcgctcat ggtcagggac 780
ggggggctct cctgccagtt gtattataac agtttcagac acttgttagt acacagtatt 840
tcaaaagtaa actttaactg ttttcctttc tccattttct tttgcataga tcgagaccac 900
<210> 2
<211> 66
<212> DNA
<213> Artificial Synthesis
<400> 2
ggaagcggag ccaccaactt cagcctgctg aagcaggccg gcgacgtgga ggagaacccc 60
ggcccc 66
<210> 3
<211> 900
<212> DNA
<213> Artificial Synthesis
<400> 3
ccggcatcac agaggtgagt ttctaacctc acagtggtct ttttaaatgt cactgtcctg 60
ggaactatta tagacagctc taaggtgctg gcactcactg tctgcaggac attaatcaag 120
gcatcagttc agcaggcaga gaagaatccc atggggtcac attccctcct cctgtggagt 180
ggcgtgagga aggcatgtgg ccctgggtgt ggcactgcca gcaccacgga ccctctaaag 240
gaaggagccg cagggctgct gtgacagggc agaggcagca tttacccaca gcactcgcaa 300
gggtttgctc tttcttctgc catttctaca ctgggcatct ctgggccttc aagagggaac 360
cgtcctttcc tttgcatggc agttgctttg ttattcagcc acaagccagg agggacctgg 420
ttctgtagac gtaccgtttc tcagcagtgt gggcactatg tttgcttctg gaggctctca 480
gtccagtaca ggagagaaat ggaaacagac tgttgtaact cagtataaag atactgcagc 540
cgatgtttcc tgcaagtagc tctaactgca tgaagcacgg aggcattcat tggacacgtc 600
ttttgtgtct tcgtttggag tttacagggg gataatccag cttttctggg aaattctact 660
ccacagggaa ccttggcact gaaaacctgt tcagatttcc tgttacatcc tgggcctggc 720
cgatcaatgt gaggaacatc agagagtttg ggtgcccttc ccagagagac acagtttcta 780
aatggtagag ccaggatcta atctctaata ccagcattct ttcctctaag gttgtgggag 840
aaccagtggg ataaactaac tgggtatgct ctctgtaagg ggtctggaag gtggcttgca 900
<210> 4
<211> 20
<212> DNA
<213> Artificial Synthesis
<400> 4
catagatcga gaccactaac 20
<210> 5
<211> 720
<212> DNA
<213> Artificial Synthesis
<400> 5
atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60
ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120
ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180
ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240
cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300
ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360
gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420
aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480
ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540
gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600
tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660
ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720
<210> 6
<211> 24
<212> DNA
<213> Artificial Synthesis
<400> 6
cacccataga tcgagaccac taac 24
<210> 7
<211> 24
<212> DNA
<213> Artificial Synthesis
<400> 7
aaacgttagt ggtctcgatc tatg 24
Claims (9)
1. the targeting vector is characterized in that a targeting sequence is reversely inserted into a multiple cloning site of an expression vector, the targeting sequence sequentially comprises a left homologous arm sequence, a 2A shearing peptide coding sequence, an exogenous gene and a right homologous arm sequence from left to right, the left homologous arm sequence is an upstream sequence of a termination codon of a porcine B2M gene, the right homologous arm sequence is a downstream sequence of a termination codon of a porcine B2M gene, and the termination codon of the porcine B2M gene is positioned on a3 rd exon of the porcine B2M gene.
2. The exogenous gene site-directed integration targeting vector according to claim 1, wherein the nucleotide sequence of the left homology arm is shown in SEQ ID No. 1.
3. The exogenous gene site-directed integration targeting vector according to claim 1, wherein the 2A cleavage peptide coding sequence is a nucleotide sequence encoding a P2A cleavage peptide as shown in SEQ ID No. 2.
4. The exogenous gene site-directed integration targeting vector according to claim 1, wherein the nucleotide sequence of the right homology arm is represented by SEQ ID No. 3.
5. The targeting vector for site-directed integration of a foreign gene according to claim 1, wherein the expression vector is a eukaryotic expression vector or a cloning vector.
6. The targeting vector for site-directed integration of a foreign gene according to claim 5, wherein said eukaryotic expression vector is Pcdna3.1 (+).
7. The targeting vector for site-directed integration of an exogenous gene according to claim 1, wherein said targeting sequence is inserted between HindIII and Kpn 1.
8. The exogenous gene site-directed integration targeting vector according to claim 1, wherein the sgRNA sequence for targeting the stop codon of the porcine B2M gene is SEQ ID No. 4.
9. Use of the targeting vector for site-specific integration of a foreign gene according to any one of claims 1 to 8 for obtaining a cell line or a transgenic pig for site-specific knock-in of a foreign gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910727202.9A CN110564764A (en) | 2019-08-07 | 2019-08-07 | Targeting vector for site-specific integration of exogenous gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910727202.9A CN110564764A (en) | 2019-08-07 | 2019-08-07 | Targeting vector for site-specific integration of exogenous gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110564764A true CN110564764A (en) | 2019-12-13 |
Family
ID=68774850
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910727202.9A Pending CN110564764A (en) | 2019-08-07 | 2019-08-07 | Targeting vector for site-specific integration of exogenous gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110564764A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278618A (en) * | 2020-06-29 | 2021-08-20 | 中国农业科学院北京畜牧兽医研究所 | gRNA for specifically recognizing porcine COL1A1 gene, and biological material, kit and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104531686A (en) * | 2014-11-27 | 2015-04-22 | 中国农业科学院北京畜牧兽医研究所 | Method for porcine H11 site-specific insertion by using site specific cleavage system |
| WO2016113733A1 (en) * | 2015-01-13 | 2016-07-21 | Yeda Research And Development Co. Ltd. | Vectors, compositions and methods for endogenous epitope tagging of target genes |
| US20180057842A1 (en) * | 2014-11-10 | 2018-03-01 | Murdoch Childrens Research Institute | Vectors and methods for targeted integration in loci comprising constitutively expressed genes |
| CN108285906A (en) * | 2017-12-29 | 2018-07-17 | 广东温氏食品集团股份有限公司 | A kind of construction method of site-directed integration exogenous DNA transgene pig |
| CN109112159A (en) * | 2018-09-06 | 2019-01-01 | 西北农林科技大学 | Based on the Cas9 site-directed integration FABP4 gene mediated and MSTN point mutation targeting vector and recombinant cell |
-
2019
- 2019-08-07 CN CN201910727202.9A patent/CN110564764A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20180057842A1 (en) * | 2014-11-10 | 2018-03-01 | Murdoch Childrens Research Institute | Vectors and methods for targeted integration in loci comprising constitutively expressed genes |
| CN104531686A (en) * | 2014-11-27 | 2015-04-22 | 中国农业科学院北京畜牧兽医研究所 | Method for porcine H11 site-specific insertion by using site specific cleavage system |
| WO2016113733A1 (en) * | 2015-01-13 | 2016-07-21 | Yeda Research And Development Co. Ltd. | Vectors, compositions and methods for endogenous epitope tagging of target genes |
| CN108285906A (en) * | 2017-12-29 | 2018-07-17 | 广东温氏食品集团股份有限公司 | A kind of construction method of site-directed integration exogenous DNA transgene pig |
| CN109112159A (en) * | 2018-09-06 | 2019-01-01 | 西北农林科技大学 | Based on the Cas9 site-directed integration FABP4 gene mediated and MSTN point mutation targeting vector and recombinant cell |
Non-Patent Citations (4)
| Title |
|---|
| JUQING ZHANG等: "Establishment of CRISPR/Cas9-Mediated Knock-in System for Porcine Cells with High Efficiency", 《APPLIED BIOCHEMISTRY AND BIOTECHNOLOGY》 * |
| SISI LAI等: "Generation of Knock-In Pigs Carrying Oct4-tdTomato Reporter through CRISPR/Cas9-Mediated Genome Engineering", 《PLOS ONE》 * |
| WANG YONG 等: "Efficient generation of B2m-null pigs via injection of zygote with TALENs", 《SCI REP》 * |
| 李戊玲 等: "利用CRISPR/Cas9技术制备B2M–细胞模型", 《中国细胞生物学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113278618A (en) * | 2020-06-29 | 2021-08-20 | 中国农业科学院北京畜牧兽医研究所 | gRNA for specifically recognizing porcine COL1A1 gene, and biological material, kit and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2022253185A1 (en) | Cas12 protein, gene editing system containing cas12 protein, and application | |
| CN109306361B (en) | Novel gene editing system for base fixed-point conversion from A/T to G/C | |
| CN113881652B (en) | Novel Cas enzymes and systems and applications | |
| KR20220110778A (en) | Novel MAD nuclease | |
| US10253321B2 (en) | Methods, compositions and kits for a one-step DNA cloning system | |
| SK285664B6 (en) | Purified and isolated hamster EF-l alpha transcriptional regulatory DNA, host cells, vectors, chimeric polynucleotides, plasmids | |
| CN107151677B (en) | Method for knocking out low transfection efficiency cell line based on CRISPR/Cas9 multiple genes | |
| CN109929839B (en) | Split type single base gene editing system and application thereof | |
| CN110358792A (en) | Fixed point integration of foreign gene is to the targeting vector construction method of ACTB downstream of gene and its application | |
| US9206433B2 (en) | Methods, compositions and kits for a one-step DNA cloning system | |
| CN110951782A (en) | Cell strain capable of stably expressing Cas9 protein and preparation method and application thereof | |
| US11332742B1 (en) | Mad nucleases | |
| CN110564764A (en) | Targeting vector for site-specific integration of exogenous gene and application thereof | |
| US20190330660A1 (en) | Fel d 1 knockouts and associated compositions and methods based on crispr-cas9 genomic editing | |
| CN106754949A (en) | Pig flesh chalone gene editing site 864 883 and its application | |
| CN110305899A (en) | Fixed point integration of foreign gene is to the targeting vector construction method of GAPDH downstream of gene and its application | |
| CN114807240A (en) | Aptamer-linked template molecule and kit thereof | |
| CN111471714A (en) | Eukaryotic transgenic cell line mediated by Minos transposon system and construction method | |
| WO2015182941A1 (en) | Novel catalase signal sequence and method for catalase expression using same | |
| CN112708605A (en) | Proteome obtained by splitting Cas9 protein and application thereof | |
| Sun et al. | Organoid Easytag: an efficient workflow for gene targeting in human organoids | |
| US20240052370A1 (en) | Modulating cellular repair mechanisms for genomic editing | |
| CN111004816B (en) | Exogenous gene site-directed knock-in method based on Cas12a technology | |
| CN113046350B (en) | Erythromycin induced promoter and application thereof | |
| US20230242922A1 (en) | Gene editing tools |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20191213 |