CN110563815A

CN110563815A - Pseudomonas aeruginosa bacteriophage K8 putative protein GP075, and mutant strain, mutant protein and application thereof

Info

Publication number: CN110563815A
Application number: CN201910720978.8A
Authority: CN
Inventors: 杨洪江; 孙利; 张志强; 李东航; 尤甲甲
Original assignee: Tianjin University of Science and Technology
Current assignee: Tianjin University of Science and Technology
Priority date: 2019-08-06
Filing date: 2019-08-06
Publication date: 2019-12-13
Anticipated expiration: 2039-08-06
Also published as: CN110563815B

Abstract

The invention relates to a pseudomonas aeruginosa bacteriophage K8 hypothetical protein GP075, the nucleotide sequence of which is SEQ No.1, and the amino acid sequence of which is SEQ No. 10. The protein GP075 is supposed to be mutated, the mutated protein has the function of structural protein, the phage mutant strain is additionally provided with additional receptor recognition protein on the basis of original recognition of lipopolysaccharide, can recognize lipopolysaccharide O-antigen defective host cells or host cells only containing core oligosaccharide structures (core oligosaccharides), and has wider host range and stronger capability of cracking and adsorbing the host cells, so that the phage mutant strain is expected to be applied to phage preparations and can prevent and treat various infections caused by pseudomonas aeruginosa.

Description

Pseudomonas aeruginosa bacteriophage K8 putative protein GP075, and mutant strain, mutant protein and application thereof

Technical Field

The invention belongs to the technical field of biological engineering, and particularly relates to a pseudomonas aeruginosa bacteriophage K8 hypothetical protein GP075, and a mutant strain, a mutant protein and application thereof.

Background

Pseudomonas aeruginosa is a pathogenic bacterium, and is easy to infect patients with low immune function, weak body and cystic fibrosis, which causes higher morbidity and mortality of the patients with the cystic fibrosis. The bacteriophage, as a natural killer of bacteria, can specifically kill bacteria, study the interaction between the bacteriophage and a host, and contribute to the development of a bacteriophage preparation for treating bacterial infection. In recent years, researches on pseudomonas aeruginosa and phages thereof are increasing, various phage infection mechanisms of the pseudomonas aeruginosa become clearer, most of the isolated pseudomonas aeruginosa phages recognize receptors as lipopolysaccharide O-antigens, and the researches are mostly related genes for LPS synthesis, mainly including wbPL, wbPR, wbPO, algC, wbPV, galU, wbPT, wzy, wapH, migA, ssg, wbPS and the like. Meanwhile, most of the phages recognize cell receptors by utilizing the tail part, under the proper condition, the interaction of the tail part and the receptors induces the tail part to generate structural rearrangement, and finally the tail part is conducted to a head-tail joint to initiate the opening of the tail part, so that the phage DNA is finally released to finish the phage infection process. On the basis of the existing research, the receptor binding protein of the pseudomonas aeruginosa bacteriophage is fiber protein, and the research on the hypothetical protein with unknown function as the receptor binding protein is very little.

In recent years, with the abuse of antibiotics, the number of antibiotic-resistant bacteria is increasing, and various infectious diseases caused by the antibiotic-resistant bacteria are in urgent need to be solved. For example, pseudomonas aeruginosa is a conditioned pathogen causing nosocomial infection, and as is known, phages can infect host bacteria, have strong host specificity and do not affect normal cells of other non-hosts, so that the study of phage therapy is particularly important as a substitute for antibiotics. The most studied cocktail therapy, namely mixed phage therapy (which refers to a treatment method for killing various bacteria by mixing various phages), has been started by the european union as early as 2014, so that the "cocktail therapy" has a good effect on various clinically common infections caused by pseudomonas aeruginosa, escherichia coli, proteus, klebsiella and staphylococcus, and the safety of the cocktail therapy is evaluated. On the other hand, when the bacteriophage preparation is used for treating bacterial infection, the bacteriophage preparation and the antibiotic are also considered to be used together to achieve the treatment effect.

In the in-vivo and in-vitro sterilization experiments of the phage, the same phage has different sterilization efficiency aiming at different host bacteria, which is related to the influence of the expression level of host bacteria genes on the process of infecting the host bacteria by the phage, and the host is cracked by the phage depending on the mechanism of the host bacteria, thereby increasing the complexity of cracking the host bacteria by the phage. Understanding more host genes associated with phage infection will benefit the therapeutic efficacy of phage and will provide a treatment for a variety of clinical infections in the future.

Through searching, no patent publication related to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a pseudomonas aeruginosa bacteriophage K8 hypothetical protein GP075, a mutant strain thereof, a mutant protein and application thereof, wherein the hypothetical protein GP075 is mutated, the mutated protein has the function of a structural protein, and the bacteriophage mutant strain is added with an additional receptor recognition protein on the basis of original recognition of lipopolysaccharide, can recognize lipopolysaccharide O-antigen defective host cells or host cells only containing core oligosaccharide structures (core oligosaccharides), has wider host range and stronger capacities of cracking and adsorbing the host cells, and is expected to be applied to a bacteriophage preparation to prevent and treat various infections caused by pseudomonas aeruginosa.

The technical scheme adopted by the invention for solving the technical problems is as follows:

The pseudomonas aeruginosa bacteriophage K8 putative protein GP075 has a nucleotide sequence of SEQ No.1 and an amino acid sequence of SEQ No. 10.

A pseudomonas aeruginosa bacteriophage K8 mutant K8-D7, said mutant K8-D7 being capable of infecting lipopolysaccharide O-antigen deficient host cells with an insertion of 1 and 106 to 112 complete repeats of the amino acid sequence between amino acids 105, 106 of the putative protein GP075 as described above; the nucleotide sequence of the mutant strain K8-D7 is SEQ No.2, and the amino acid sequence thereof is SEQ No. 11.

A mutein GP075-14 comprising the hypothetical protein GP075 as described above, the sequence of which is an amino acid sequence that is completely repeated from 106 to 112 inserted between the amino acids 105, 106 of the GP075, the nucleotide sequence of the mutein GP075-14 is SEQ No.3 and the amino acid sequence of SEQ No. 12.

A mutein GP075-21 comprising the hypothetical protein GP075 according to claim 1, having the sequence of 3 amino acids completely repeated from 106 to 102 inserted between the amino acids 105, 106 of GP075, said mutein GP075-21 having the nucleotide sequence of SEQ No.4 and the amino acid sequence of SEQ No. 13.

A Pseudomonas aeruginosa bacteriophage K8 mutant K8-E126K, wherein the mutant K8-E126K can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is E126K with the presumed protein GP075, the nucleotide sequence of the mutant K8-E126K is SEQ No.5, and the amino acid sequence of the mutant is SEQ No. 14.

A pseudomonas aeruginosa bacteriophage K8 mutant K8-S142L, wherein the mutant K8-S142L can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is S142L with mutation of the hypothetical protein GP075, the nucleotide sequence of the mutant K8-S142L is SEQ No.6, and the amino acid sequence of the mutant is SEQ No. 15.

A pseudomonas aeruginosa bacteriophage K8 mutant K8-L189R is capable of infecting lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant K8-L189R is L189R of the putative protein GP075 mutation, the nucleotide sequence of the mutant K8-L189R is SEQ No.7, and the amino acid sequence of the mutant is SEQ No. 16.

A pseudomonas aeruginosa bacteriophage K8 mutant K8-P197L, wherein the mutant K8-P197L can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is P197L with the mutation of the putative protein GP075, the nucleotide sequence of the mutant K8-P197L is SEQ No.8, and the amino acid sequence of the mutant is SEQ No. 17.

A pseudomonas aeruginosa bacteriophage K8 mutant K8-T239A, wherein the mutant K8-T239A can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is T239A with mutation of the hypothetical protein GP075, the nucleotide sequence of the mutant K8-T239A is SEQ No.9, and the amino acid sequence of the mutant is SEQ No. 18.

a pseudomonas aeruginosa bacteriophage K8 mutant K8-X, wherein the mutant K8-X can infect lipopolysaccharide O-antigen deficient host cells, and GP075 is not mutated.

Use of the Pseudomonas aeruginosa bacteriophage K8 mutant strain K8-X as described above for the inhibition of growth of O-antigen deficient strains of Pseudomonas aeruginosa or for the inhibition of spontaneous mutation of Pseudomonas aeruginosa.

The invention has the advantages and positive effects that:

1. In the research process of the invention, a phage K8 mutant population contains a plurality of GP075 mutant phages, and the separated phage K8 mutant strains mainly comprise K8-D7, K8-E126K, K8-S142L, K8-L189R, K8-P197L and K8-T239A, and in addition, two kinds of mutant proteins GP075-14 and GP075-21 with higher proportions are also found in the process of researching the diversity of GP075 mutations. The protein GP075 is supposed to be mutated in the bacteriophage, the mutated protein has the function of structural protein, and the bacteriophage mutant strain is added with additional receptor recognition protein on the basis of original recognition of lipopolysaccharide, can recognize lipopolysaccharide O-antigen defective host cells or host cells only containing core oligosaccharide structures (core oligosaccharides), and has wider host range and stronger capacities of cracking and adsorbing the host cells, thereby being expected to be applied to bacteriophage preparations and preventing and treating various infections caused by pseudomonas aeruginosa.

2. The K8 mutant strain obtained by separation in the invention can identify new receptor core oligosaccharide on host cells, simultaneously retains the original identification of original receptor O-antigen, has the identification capability of double receptors, greatly improves the sterilization capability of pseudomonas aeruginosa, has the inhibition capability of spontaneous mutation of pseudomonas aeruginosa, can be applied to the development and application fields of phage preparations, and solves the infection problem caused by tolerant pseudomonas aeruginosa.

3. the invention excavates new functions of the putative protein GP075 mutant of the phage K8, and the functions of the protein mutant are redefined through the research and play an important role in the process of infecting host cells by the phage. The phage containing the GP075 mutant has strong bactericidal activity, can be used as a phage preparation of pseudomonas aeruginosa to guide clinical application of pseudomonas aeruginosa infection, and achieves the effect of treating pseudomonas aeruginosa infection.

4. The starting phage K8 has clear genetic background, and the novel mutant phage capable of recognizing O-antigen defects is sought on the basis, so that the subsequent research is more scientific. The phage K8 mutant strain is separated by using the O-antigen defective host cell as an indicator bacterium, and the research is more purposeful.

5. The invention provides a putative protein GP075 mutant function related to phage infection, which is an important structural protein for recognizing host cell core oligosaccharide by phage; the invention provides a plurality of strains of a broad-spectrum pseudomonas aeruginosa bacteriophage for infecting host cells deficient in lipopolysaccharide O-antigen or containing only core oligosaccharides.

6. The significance of the invention lies in that: in recent years, pseudomonas aeruginosa has become the main pathogenic strain of nosocomial infectious diseases, but gradually becomes resistant to antibiotics and develops multidrug resistance during treatment with antibiotics. In order to better treat the infection caused by pseudomonas aeruginosa, scientists are actively developing novel antibiotics and continuously searching for antibiotic substitutes. The bacteriophage, as a gram of bacteria, can recognize and kill bacteria and has good therapeutic effect on infection caused by bacteria. Virulence factors are not found in all proteins with known functions in the whole genome of the phage K8 and the phage mutant strain thereof, so that a good foundation is laid for the subsequent phage therapy, and safety guarantee is provided in the using process of a future phage preparation.

7. according to the invention, the pseudomonas aeruginosa bacteriophage K8 is used as a starting bacteriophage, early-stage research proves that the wild pseudomonas aeruginosa bacteriophage K8 recognition receptor is lipopolysaccharide O-antigen, the bacteriophage K8 cannot infect the host cell under the condition of host cell O-antigen deletion, and no research is carried out on the function of GP075 at the existing stage. The method has the greatest common characteristic that a plurality of K8 spontaneous mutant strains can be obtained through separation, lipopolysaccharide O-antigen-deficient host cells can be infected, the whole genome of the phage K8-T239A is sequenced, analysis shows that only the 239 th site of the protein GP075 in the phage is mutated from threonine T to alanine A, and simultaneously, the GP075 of other phage is sequenced, so that different mutations occur in the gene. Based on the characteristics, the invention researches the new function of GP075 and the application of the GP075 in the growth inhibition of pseudomonas aeruginosa.

Drawings

FIG. 1 is a diagram showing the analysis of the essential properties of the interaction between the phage K8 mutant strain and the host cell according to the present invention; wherein, A is a host range diagram of bacteriophage K8 and mutant K8-T239A, B is a diagram of PAK and mutant adsorption rate, and C is a structure diagram of host bacteria LPS;

FIG. 2 is a diagram showing the identification of mutant genes of a bacteriophage K8 mutant strain according to the present invention;

FIG. 3 is a diagram of the functional protein analysis of the particles of the K8 phage mutant strain by LC-MS detection in accordance with the present invention;

FIG. 4 is a graph showing the application of the bacteriostatic and bactericidal abilities of the bacteriophage K8 mutant strain in the present invention; the PAK growth inhibition curve diagram is shown in the specification, wherein A is a curve diagram of inhibition of PAK growth by bacteriophage K8 and mutant strain K8-T239A, B is a curve diagram of inhibition of SK75 growth by bacteriophage K8 and mutant strain K8-T239A, C is a screening diagram of PAK-tolerant bacteriophage K8 and mutant strain K8-T239A, D is a screening diagram of SK 75-tolerant bacteriophage K8-T239A, and E is a spontaneous mutation rate diagram of host strain-tolerant bacteriophage K8 and mutant strain K8-T239A.

Detailed Description

The following detailed description of the embodiments of the present invention is provided for the purpose of illustration and not limitation, and should not be construed as limiting the scope of the invention.

The raw materials used in the invention are conventional commercial products unless otherwise specified; the methods used in the present invention are conventional in the art unless otherwise specified.

The pseudomonas aeruginosa bacteriophage K8 assumed protein GP075 and wild type GP075 protein have the nucleotide sequence of SEQ No.1 and the amino acid sequence of SEQ No. 10.

The invention mainly separates a plurality of pseudomonas aeruginosa bacteriophage K8 mutant strains, determines the host range of the bacteriophage, identifies the specific mutation sites of the mutant bacteriophage through whole genome sequencing and GP075 in-vitro amplicon sequencing, and evaluates the practical application value, namely the bacteriostatic and bactericidal capacity of the bacteriophage.

The specific steps for separating and identifying the pseudomonas aeruginosa bacteriophage K8 mutant strain can be as follows:

(1) Constructing a pseudomonas aeruginosa phage K8 spontaneous mutation library;

(2) Separating by lipopolysaccharide O-antigen defective host cells to obtain phage K8 mutant strains;

(3) Extracting a phage genome, and amplifying a GP075 gene in vitro;

(4) Phage whole genome sequencing and GP075 amplicon sequencing identification;

(5) The phage K8 mutant strain acts on O-antigen deficient host cells;

(6) Inhibition of spontaneous mutation of host cells by the bacteriophage K8 mutant strain.

Specifically, the steps of the related materials of the invention are as follows:

First, experimental material

the strains and phages used in the experiment are shown in Table 1.

TABLE 1 strains and phages used according to the invention

Second, isolation of phage K8 mutant strains

The mutant strain subgroups of the phage K8 use receptor-deficient Pseudomonas aeruginosa SK2(wbPV), SK15(wbPO) and SK45(wbPR) as indicator bacteria 200 muL (OD)₆₀₀0.6) against 100. mu.LK 8 phage (10)⁹) Sub-population, using a double-layer plate method, mutant phages capable of infecting O-antigen deficient strains were isolated. And (3) performing static culture on the double-layer plate at 37 ℃ for 4h until clear plaques appear, wherein the plaques appearing at the moment are formed by the mutant phage, picking single plaques, purifying for three times in a fresh LB culture solution to obtain the mutant phage with uniform size and the same transparency degree, and the phage is the K8 mutant strain.

Third, analysis of host range of phage mutant strains

Aspirate 200. mu.L of log phase indicator (OD)₆₀₀0.6) and 3mL of melted soft agar (0.5% in mass concentration m/v), quickly pouring the upper layer of solidified LB solid (1.5% in mass concentration m/v) culture medium, standing at room temperature for about 15min, and after the soft agar is dried in the air, diluting 1. mu.L of 100 times phage lysate (10 times in volume)⁸pfu/mL), vertically spotted on the soft agar layer of the double-layer plate, standing and culturing for 4h at 37 ℃, and observing whether a transparent phagocyte is formed.

Fourth, phage K8 mutant strain whole genome sequencing

Extracting phage K8-T239A genome DNA, analyzing the purity and concentration of the phage DNA by a nucleic acid analyzer, wherein the purity and concentration of the phage DNA meet three indexes, namely the concentration of a DNA sample is not lower than 10ng/uL, and the total amount is not lower than 5 ug; OD260/OD280 should be between 1.8 and 2.0; OD260/OD230 were greater than 1.8. Samples meeting the criteria were sent to the sequencing company.

Phage whole gene DNA sequencing used the sequencing platform Illumina Hiseq 2500. And (3) performing image recognition (Base calling) on the sequencing result, performing primary quality analysis, removing low quality and linker sequences and the like by using second-generation sequencing data quality filtering software trimmatic (v0.30), and assembling and splicing the preprocessed read mapping (reads mapping) by using software Velvet _ v1.2.10. Using online software NCBI: (https://www.ncbi.nlm.nih.gov/) And selecting Align two sequences in BLAST to be aligned with the whole genome sequence of the phage K8, and searching the mutation generated by the phage mutant strain.

Fifth, sequencing of Gene gp075 amplicon

Respectively taking the extracted phage mutant strain as a template, and using primers GP 075-F: 5'-ATATCACCGT AACTACGGT-3', GP 075-R: 5'-GTTGACTGTAATCAGCCATT-3', amplifying gene gp075 segment in vitro, carrying out sanger sequencing, observing the reliability of the sequencing result (no peak nesting and the like) by using software Chromas version2.4, translating the base sequence into an amino acid sequence by using translation protein in software Primer Premier 5.exe of the sequence with reliable sequencing result, and using online software NCBI (online software) ((NCBI))https:// www.ncbi.nlm.nih.gov/) Align two sequences in Protein BLAST were aligned to the Protein GP075 amino acid sequence, respectively, for analysis of changes in the hypothetical Protein GP075 in a single mutant phage.

Sixth, adsorption rate

The overnight cultured host strain was inoculated in 5mL of liquid LB medium at 3% transfer amount and cultured to logarithmic phase (OD)₆₀₀0.6), sucking 650. mu.L of host bacteria and 650. mu.L (MOI 0.001) of phage, mixing well, standing for 1min, sucking 100. mu.L immediately, counting the total number of phage infection centers, 13000rpm later, centrifuging for 30s, discarding supernatant, adding 1200. mu.L of liquid LB, mixing well, sucking 100. mu.L again, at this timeThe number of phage infection centers after 1 st wash was counted, and washed once per minute for 6 times in parallel three times according to the above washing method, and the number of remaining phage-adsorbed infection centers after each wash was measured by the double-plate method. The calculation formula of the phage adsorption rate is as follows:

A-adsorption (%) of phage;

S-titer of phage in supernatant after centrifugation (pfu/mL);

C-titer of phage in control group without added bacteria (pfu/mL);

Seventhly, extraction of LPS (Lipopolysaccharides) strain

Reference experimental procedures (Merino S, Gonzalez V, Tom a S J M. the Polymerization of Aeromonas hydrophylla AH-3O-Antigen LPS: concertedAction of WecP and Wzy [ J ]. Plos One, 2015, 10 (7): e0131905.) were performed as follows:

(1) Culturing the strain: and respectively picking purified single colonies, inoculating the single colonies into 5mL of LB liquid culture medium under an aseptic environment, culturing overnight at 37 ℃ at 220rpm, transferring 3% of transfer amount to 100mL of LB liquid culture medium the next day, culturing until logarithmic phase (OD600 is 0.6), culturing at 4 ℃ at 7000rpm, centrifuging for 10min, discarding supernatant, collecting thalli, re-suspending the thalli by using 5mL of distilled water, and uniformly mixing for later use.

(2) Hot phenol water process: adding equal volume of water saturated phenol into the resuspended bacterial liquid, shaking in water bath at 68 deg.C and 120rpm for 30min, performing ice bath at 4 deg.C and 7000rpm for 10min, collecting water phase, and repeating the above steps twice.

(3) And (3) dialysis: sucking the collected water phase into a dialysis bag, stirring distilled water for dialysis, changing distilled water every 4h, and dialyzing for 20h until the water saturated phenol is completely removed by dialysis.

(4) Concentrating the water phase: the aqueous phase in the dialysis bag was concentrated with 30% PEG8000 for about 30-60min to a concentrate volume of about 1 mL.

(5) Ethanol sedimentation: sucking out the concentrated solution, adding 2 times volume of anhydrous ethanol and 1/10 volume of sodium acetate solution, and settling at-20 deg.C overnight.

(6) Washing of LPS: and after sedimentation, 12000rpm, centrifuging for 10min, and removing supernatant to obtain the LPS. Washing with 75% ethanol twice, removing supernatant, sucking off excessive liquid, standing at room temperature for 30min, air drying LPS sample, adding appropriate amount of sterile water, and storing at-20 deg.C.

eighth, LC-MS detects phage protein particle

referring to the description of the experimental method (Yang H, Liang L, Lin S, & Jia S (2010) Isolation and characterization of a viral bacterial phase AB1 of Acinetobacterbaumannii. BMC microbiology 10:131.), the phage particle proteins were separated by SDS-PAGE to obtain separated phage particle protein gels, the proteins were cut into small fragments by specific enzymatic methods, the relative molecular masses of the peptides of each product were then detected by mass spectrometry, the mass numbers of the resulting proteolytic peptide fragments were retrieved in the corresponding databases, and the protein fragments matching therewith were searched.

The SDS-PAGE after separation was subjected to structural protein detection by the following mass spectrometric detection method (Hellman J. polyacrylamide amplification enabled mass spectrometry stabilized and in-gel diagnostic of protein isolated by imaging IEF [ J ]. Proteomics, 2007, 7 (19): 3441-4.), and each proteome sample was subjected to intracollagenic digestion, approximately as follows: protein 1: 40, carrying out enzymolysis;

Each 1D gel lane was divided into 4 fractions, which were cleaved separately.

LC-MS detection assay

(1) Liquid phase conditions phase A: water (0.1% formic acid), phase B: acetonitrile (0.1% formic acid) flow 300 nL/min; gradient of 0-5min, 2% B; 5-80min, 2% -25% B; 85-100min, 25% -35% B; 35-95% for 100-105 min; 105-120min, 95% B; c18 column.

(2) Mass spectrum conditions: the voltage is 2.2kv, the MS scanning range is 350-1550m/z, and the detector orbitrap; MS2 was fragmented using HCD and detected using ion trap.

LC-MS data analysis

(3) Protein identification was performed by searching the database provided using mascot v2.5 software (Matrixscience, Boston, USA), and comparative analysis was performed using MaxQuant software.

(4) Information on the high resolution mass spectrometer for liquid chromatography mass spectrometry (LC-MS) used: the Obitrap Fusion (Thermofisiher, San Jose, USA).

data screening principle:

(1) More credible pep _ expect value less than or equal to 0.01

(2) The identified protein requires more than 2 independent characteristic fragments

(3) Other data are used as reference.

Ninth, bacteriophage bacteriostatic experiment application

the experimental method of the bacteriophage bacteriostatic curve comprises the following steps: host bacteria cultured overnight were inoculated in 96-well bacterial culture dishes at 3% transfer amount, and diluted phages (MOI ═ 0.001) were added to the culture, and phages were not added to the control group (MOI ═ 0), and each group was performed in triplicate. Culturing at 37 deg.C and 160rpm, and measuring OD every 0.5h with multifunctional enzyme labeling instrument₆₀₀And 5.5h, determining the growth rate of the host bacteria in the presence or absence of the phage.

1. Pseudomonas aeruginosa tolerant phage spontaneous mutation assay

The method is characterized in that a turbidimetric method is adopted to determine the spontaneous mutation frequency (Zhang bin, Geum, Jinxialin, and the like) of the wild pseudomonas aeruginosa strains tolerant phage under the action of phage, the separation and identification of the pseudomonas aeruginosa phage and the determination of the mutation frequency of the tolerant phage [ J]Microbiological notification, 2002, 29 (1): 40-45.). The host bacteria PAK and RO2-15 cultured overnight are diluted to 10 degrees in gradient^-10. At 10^-6、10^-7、10^-8100. mu.L of each sample was taken from the dilution tube, and the number of bacteria/mL was determined by colony counting. At the same time, phage stock (10) was added to each dilution tube¹⁰pfu/mL) of the strain, uniformly mixing the strain and carrying out shaking culture at 37 ℃, wherein after 4-6 h, the strain gradually begins to become clear, which indicates that bacteria are cracked, and the strain is continuously cultured for 20h, and the strain can gradually turn turbid from a high-concentration strain liquid tube until no new turbidity returning tube appears on the next day. The interpretation result at this time is: bacteria contained in the tube of lowest concentration capable of returning turbiditythe reciprocal of the number is the frequency of tolerant mutations. Each set of experiments was done in 10 replicates.

2. Results and discussion

in the invention, a plurality of phage K8 mutant strains are separated from O-antigen defective host cells, and K8-T239A is taken as a typical representative strain for the following research.

(1) Isolation and basic property determination of phage K8 mutant strain

In the invention, a plurality of phage K8 mutant strains are separated from O-antigen defective host cells, and K8-T239A is taken as a typical representative strain for the following research. Pseudomonas aeruginosa PAK transposon Tn5G inserted mutant strain SK98(ssg), SK75(wzy), SK2(wbpV), M21(galU), SK15(wbpO), P2-25(wapH), SK45(wbpR), spottingassay all tolerated K8, wherein SK75, SK2, SK15, SK45 were sensitive to phage K8-T239A to form a plaque clearing circle, SK98, M21, P2-25 were tolerated to phage K8-T239A (FIG. 1A). The adsorption capacity of the inserted mutants of PAK and 7 strains and phages K8 and K8-T239A is found to be remarkably different from that of K8 and K8-T239A in the adsorption capacity results of PAK, SK75, SK2, SK15 and SK45, namely that the adsorption capacity of K8-T239A is stronger than that of K8, but the adsorption capacity of all mutants is lower than that of PAK (figure 1B).

Phenotypic analysis of mutant genes of the strains shows that wild-type PAK simultaneously has LPS OSA and Core oligosaccharide, mutant strains SK75, SK2, SK15 and SK45 with deletion genes of wzy, wbpV, wbpO and wbpR respectively, the genotypes of the three strains are presumed to be LPS OSA deletion, and LPS of the three strains is completely deleted (figure 1C) presumed by SK98, M21 and P2-25 insertion deletion genes of ssg, galU and wapH respectively. The lipopolysaccharide components of the insertion mutants of PAK and 7 strains were analyzed by Tricine-SDS-PAGE, and LPSCore oligosaccharide was found in all of the strains PAK, SK75, SK2, SK15 and SK45 sensitive to the phage K8-T239A, and the lipopolysaccharide components of the strains SK98, M21 and P2-25 resistant to the phage K8-T239A were completely deleted (FIG. 1C). The Tricine-SDS-PAGE result is completely consistent with the previous genotype speculation, and in combination with the spotting assay result, K8-T239A is not difficult to speculate that the new receptor is LPS Core oligosaccharide, but the recognition of the original receptor LPSOSA is retained.

(2) Phage whole genome sequencing and amplicon sequencing analysis

The whole genome sequencing discovers that only one point mutation occurs in the whole genome sequence of the phage K8-T239A compared with K8, and further analysis shows that the point mutation occurs in the gene gp075, wherein the 715 th site is A → G (adenine is mutated into guanine), the 239 th site is T → A (threonine is mutated into alanine), and the protein is annotated as a hypothetical protein; simultaneously, carrying out amplicon sequencing on the gene GP075 of other separated phage mutants, wherein 25 strains of GP075 generate SVN (Single nucleotide mutation), the mutation occurs at four different positions on the gene GP075, the amino acid level analysis is carried out, the 126 th position of E126K is mutated from E glutamic acid to K lysine (such as a sequence 14), the 142 th position of S142L is mutated from S serine to L leucine (such as a sequence 15), the 189 th position of L189R is mutated from L leucine to R arginine (such as a sequence 16), and the 197 th position of P197L is mutated from P proline to L leucine (such as a sequence 17); there were 11 GP075 with no mutations, presumably in other putative or structural proteins; in addition, there is an insertion repeat CGGTGCTCCATGGTACTCGGT located between positions 314 and 315 of gene GP075, the 21bp repeat is identical to the sequence of the original sequence 315 to 335 of gene GP075, and more interestingly, the beginning and the end of the repeat and the adjacent 4 base sequences are CGGT (e.g. SEQ ID NO: 2), and due to the characteristics of the original sequence, the insertion site is located between 314 and 315, but the encoded amino acids are not subjected to any frame shift mutation, and the repeat sequence of 7 amino acids from 106 th to 112 th of GP075, i.e. GAPWY S V (e.g. SEQ ID NO: 11), (FIG. 2).

(3) LC-MS (liquid chromatography-mass spectrometry) detection of particle protein of phage mutant strain

The structural proteins in the phage K8 and K8-T239A particles were separated by SDS-PAGE, and the structural proteins separated on the gel were further identified by LC-MS. Analysis of identification results shows that 13 proteins exist in K8-T239A, only 12 proteins exist in phage K8 particles, and after comparison, the phage K8 particles are less than phage K8-T239A in the presence of the hypothetical protein GP075, and the other 12 identified proteins are consistent and comprise 8 functional proteins, namely GP035, GP057, GP062, GP063, GP068, GP074, GP076 and GP078, and the corresponding protein functions are respectively DNA ligase (DNA ligase), major capsid protein (major capsid protein), hypothetical structural protein (hypothetical structural protein), hypothetical tape protein (hypothetical tape measure protein), hypothetical substrate protein (hypothetical substrate related protein), hypothetical tail silk protein (hypothetical tail silk protein) and hypothetical tail silk protein (hypothetical tail silk protein); the 4 putative proteins were encoded by GP053, GP056, GP071, GP110, respectively (figure 3). This result indicates that the GP075 protein mutant has a novel function and can function as a structural protein with no annotated function.

(4) Bacteriophage bacteriostatic application

One of the essential properties of a bacteriophage is to infect a host cell, lyse the host cell, and co-culture the bacteriophage with the host cell, which can inhibit the growth of the host cell. In the growth curve of wild pseudomonas aeruginosa PAK, a phage control group is not added, the culture is carried out for 5.5h, the OD600 reaches 0.7, the culture is respectively co-cultured with phage K8 and K8-T239A, the PAK almost stops growing after 2.0h, and the phage K8 and K8-T239A have strong inhibition effect on the growth of the PAK (fig. 4A). The same amount of K8 and K8-T239A and PAK with different dilutions (10 times of gradient dilution) are co-cultured, the turbidity condition of bacterial liquid of each dilution is observed, the spontaneous mutation rate of PAK resistant phage can be calculated by the minimum turbidity concentration of PAK, and the result shows that PAK and K8 are co-cultured, and the concentration of PAK in the bacterial liquid is 7.0 multiplied by 10⁵clarification appeared in only one tube at cfu/ml, but in the bacterial concentration of 7.0X 10⁴At cfu/ml, the coculture solution was clear, indicating that the mean minimum turbid concentration of PAK was 7.0X 10⁵cfu/ml, calculation of the mean spontaneous mutation frequency of PAK-resistant K8 as 2.91X 10^-6(ii) a K8-T239A was co-cultured with PAK at a minimum haze concentration of 7.0X 10⁸cfu/ml, the mean spontaneous mutation frequency of PAK-tolerant K8-T239A was calculated to be 2.83X 10^-9The spontaneous mutation frequency of PAK-tolerant K8-T239A was much lower than that of K8, and there were significant differences (fig. 4B, 4E).

The SK75 growth curve, the SK75 growth status without phage as control, cultured for 5.5h, OD600 reached 0.7, after adding phage K8, the SK75 growth status was not inhibited, OD600 reached 0.69; phage K8-TT239A and SK75 were added for co-culture, and after 3.0h, the growth of SK75 was sufferedInhibition followed by almost no growth, so it can be seen that K8-T239A had an inhibitory effect on the growth of SK75 (FIG. 4C). SK75 and K8-T239A were co-cultured, the bacterial concentration of SK75 was 1.04 × 10²Two tubes of turbid liquid still exist at cfu/ml, the coculture liquid is completely clear at the bacterial concentration of 1.04 multiplied by 10cfu/ml, which shows that the minimum turbid concentration of SK75 is mainly concentrated at 1.04 multiplied by 10³cfu/ml, the spontaneous mutation frequency mean of SK75 tolerant K8-T239A is calculated to be 9.93 multiplied by 10^-4(FIG. 4D, FIG. 4E). The phage K8 and K8-T239A effectively inhibit the growth of PAK, and the spontaneous mutation rate of PAK tolerant K8-T239A is far 1000 times lower than that of K8 during co-culture; meanwhile, K8-T239A inhibits the growth of SK75, and the K8-T239A can inhibit spontaneous mutation of SK75 to a certain extent, and the mutation frequency is 10 times higher than that of PAK tolerant K8-T239A⁶The results further prove that K8-T239A can identify double receptors and has good application value.

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the disclosure of the embodiments and the accompanying drawings.

Sequence listing

sequence 1 pseudomonas aeruginosa bacteriophage K8 gene gp075 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 2 Pseudomonas aeruginosa bacteriophage K8-D7 gene gp075 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 3 protein GP075-14 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 4 protein GP075-21 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 5 Pseudomonas aeruginosa bacteriophage K8-E126K gene gp075 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAAAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 6 Pseudomonas aeruginosa bacteriophage K8-S142L gene gp075 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTTAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 7 Pseudomonas aeruginosa bacteriophage K8-L142R gene gp075 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCGAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 8 Pseudomonas aeruginosa bacteriophage K8-P142L gene gp075 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCTTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGACCAACCTAGTGACATAA

Sequence 9 Pseudomonas aeruginosa bacteriophage K8-T239A gene gp075 nucleic acid sequence

ATGGCTGTCAACCAATTTGACAGAGAAGATTATCTGGAGGTGGCCCGGGAACGGGTCACTGAACAGTTTAAAGAGAAGCCGATCTTTGATCGCTTCCTGCAAGTGCTATTGTCTGGTAAGTTTGATATCCAGAATGCACTGGAAGACCTCCAGACTCTCCGGTCTCTGGACACAGCCACCGGGAAGCAACTGGACATTATCGGAGACATTGTAGGGCGACCACGCGGTCTAGTGTACCAAGATATTTTCAACTATTTTGGATTCGCTGGAACGGAGCGTGCAGGTTCTTTCGGAAGCCTGTCGGACCCTACGGTCGGTGCTCCATGGTACTCGGTCGGTGCTCCAACTGGTAACGCCAGAGAGCCGAGCGACGAAGAGTATCGGATGATCCTGAAAGCAAAGATCATCAAGAACAGAACAAACTCAACCCCAGAGCAAGTTATCGAAGCTTATAAATTTGTATTCGGGGTTCCTGAAGTATTCCTAGAGGAGTACGCTCCCGCTGCTGTCCGTATCGGCATCGGTAAGATTCTAACGAACGTAGAGCGTAGTCTTCTATTCGACCTAGGTGGTGCAGGTGCATTGCTTCCTAAGACTATCGGGGTTAACTACACATACACTGAGTTCCAAGCTGGCCGGGTATTTGCTACAGAAGGCTTCCCCGGAGGACAAGGCGTTGGAGACCTAAATGATCCCACTGTTGGTGGAATTCTGGCCAACCTAGTGACATAA

sequence 10 GP075 amino acid sequence

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

Sequence 11 GP075-7 amino acid sequence

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

Sequence 12 GP075-14 amino acid sequence

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPWYSVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

sequence 13 GP075-21 amino acid sequence

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPWYSVGAPWYSVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

Amino acid sequence of sequence 14 GP075-E126K

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPTGNAREPSDEKYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

Amino acid sequence of sequence 15 GP075-S142L

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNLTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

Amino acid sequence of sequence 16 GP075-L189R

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDRGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

Amino acid sequence of sequence 17 GP075-P197L

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLLKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILTNLVT

Amino acid sequence of sequence 18 GP075-T239A

MAVNQFDREDYLEVARERVTEQFKEKPIFDRFLQVLLSGKFDIQNALEDLQTLRSLDTATGKQLDIIGDIVGRPRGLVYQDIFNYFGFAGTERAGSFGSLSDPTVGAPWYSVGAPTGNAREPSDEEYRMILKAKIIKNRTNSTPEQVIEAYKFVFGVPEVFLEEYAPAAVRIGIGKILTNVERSLLFDLGGAGALLPKTIGVNYTYTEFQAGRVFATEGFPGGQGVGDLNDPTVGGILANLVT。

sequence listing

<110> Tianjin science and technology university

<120> pseudomonas aeruginosa bacteriophage K8 putative protein GP075, mutant strain, mutant protein and application thereof

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 732

<212> DNA

<213> nucleotide sequence of hypothetical protein GP075 (Unknown)

<400> 1

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccaactgg taacgccaga 360

gagccgagcg acgaagagta tcggatgatc ctgaaagcaa agatcatcaa gaacagaaca 420

aactcaaccc cagagcaagt tatcgaagct tataaatttg tattcggggt tcctgaagta 480

ttcctagagg agtacgctcc cgctgctgtc cgtatcggca tcggtaagat tctaacgaac 540

gtagagcgta gtcttctatt cgacctaggt ggtgcaggtg cattgcttcc taagactatc 600

ggggttaact acacatacac tgagttccaa gctggccggg tatttgctac agaaggcttc 660

cccggaggac aaggcgttgg agacctaaat gatcccactg ttggtggaat tctgaccaac 720

ctagtgacat aa 732

<210> 2

<211> 753

<212> DNA

<213> nucleotide sequence of K8-D7 (Unknown)

<400> 2

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccatggta ctcggtcggt 360

gctccaactg gtaacgccag agagccgagc gacgaagagt atcggatgat cctgaaagca 420

aagatcatca agaacagaac aaactcaacc ccagagcaag ttatcgaagc ttataaattt 480

gtattcgggg ttcctgaagt attcctagag gagtacgctc ccgctgctgt ccgtatcggc 540

atcggtaaga ttctaacgaa cgtagagcgt agtcttctat tcgacctagg tggtgcaggt 600

gcattgcttc ctaagactat cggggttaac tacacataca ctgagttcca agctggccgg 660

gtatttgcta cagaaggctt ccccggagga caaggcgttg gagacctaaa tgatcccact 720

gttggtggaa ttctgaccaa cctagtgaca taa 753

<210> 3

<211> 774

<212> DNA

<213> nucleotide sequence of GP075-14 (Unknown)

<400> 3

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccatggta ctcggtcggt 360

gctccatggt actcggtcgg tgctccaact ggtaacgcca gagagccgag cgacgaagag 420

tatcggatga tcctgaaagc aaagatcatc aagaacagaa caaactcaac cccagagcaa 480

gttatcgaag cttataaatt tgtattcggg gttcctgaag tattcctaga ggagtacgct 540

cccgctgctg tccgtatcgg catcggtaag attctaacga acgtagagcg tagtcttcta 600

ttcgacctag gtggtgcagg tgcattgctt cctaagacta tcggggttaa ctacacatac 660

actgagttcc aagctggccg ggtatttgct acagaaggct tccccggagg acaaggcgtt 720

ggagacctaa atgatcccac tgttggtgga attctgacca acctagtgac ataa 774

<210> 4

<211> 795

<212> DNA

<213> nucleotide sequence of GP075-21 (Unknown)

<400> 4

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccatggta ctcggtcggt 360

gctccatggt actcggtcgg tgctccatgg tactcggtcg gtgctccaac tggtaacgcc 420

agagagccga gcgacgaaga gtatcggatg atcctgaaag caaagatcat caagaacaga 480

acaaactcaa ccccagagca agttatcgaa gcttataaat ttgtattcgg ggttcctgaa 540

gtattcctag aggagtacgc tcccgctgct gtccgtatcg gcatcggtaa gattctaacg 600

aacgtagagc gtagtcttct attcgaccta ggtggtgcag gtgcattgct tcctaagact 660

atcggggtta actacacata cactgagttc caagctggcc gggtatttgc tacagaaggc 720

ttccccggag gacaaggcgt tggagaccta aatgatccca ctgttggtgg aattctgacc 780

aacctagtga cataa 795

<210> 5

<211> 732

<212> DNA

<213> nucleotide sequence of K8-E126K (Unknown)

<400> 5

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccaactgg taacgccaga 360

gagccgagcg acgaaaagta tcggatgatc ctgaaagcaa agatcatcaa gaacagaaca 420

aactcaaccc cagagcaagt tatcgaagct tataaatttg tattcggggt tcctgaagta 480

ttcctagagg agtacgctcc cgctgctgtc cgtatcggca tcggtaagat tctaacgaac 540

gtagagcgta gtcttctatt cgacctaggt ggtgcaggtg cattgcttcc taagactatc 600

ggggttaact acacatacac tgagttccaa gctggccggg tatttgctac agaaggcttc 660

cccggaggac aaggcgttgg agacctaaat gatcccactg ttggtggaat tctgaccaac 720

ctagtgacat aa 732

<210> 6

<211> 732

<212> DNA

<213> nucleotide sequence of K8-S142L (Unknown)

<400> 6

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccaactgg taacgccaga 360

gagccgagcg acgaagagta tcggatgatc ctgaaagcaa agatcatcaa gaacagaaca 420

aacttaaccc cagagcaagt tatcgaagct tataaatttg tattcggggt tcctgaagta 480

ttcctagagg agtacgctcc cgctgctgtc cgtatcggca tcggtaagat tctaacgaac 540

gtagagcgta gtcttctatt cgacctaggt ggtgcaggtg cattgcttcc taagactatc 600

ggggttaact acacatacac tgagttccaa gctggccggg tatttgctac agaaggcttc 660

cccggaggac aaggcgttgg agacctaaat gatcccactg ttggtggaat tctgaccaac 720

ctagtgacat aa 732

<210> 7

<211> 732

<212> DNA

<213> nucleotide sequence of K8-L189R (Unknown)

<400> 7

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccaactgg taacgccaga 360

gagccgagcg acgaagagta tcggatgatc ctgaaagcaa agatcatcaa gaacagaaca 420

aactcaaccc cagagcaagt tatcgaagct tataaatttg tattcggggt tcctgaagta 480

ttcctagagg agtacgctcc cgctgctgtc cgtatcggca tcggtaagat tctaacgaac 540

gtagagcgta gtcttctatt cgaccgaggt ggtgcaggtg cattgcttcc taagactatc 600

ggggttaact acacatacac tgagttccaa gctggccggg tatttgctac agaaggcttc 660

cccggaggac aaggcgttgg agacctaaat gatcccactg ttggtggaat tctgaccaac 720

ctagtgacat aa 732

<210> 8

<211> 732

<212> DNA

<213> nucleotide sequence of K8-P197L (Unknown)

<400> 8

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccaactgg taacgccaga 360

gagccgagcg acgaagagta tcggatgatc ctgaaagcaa agatcatcaa gaacagaaca 420

aactcaaccc cagagcaagt tatcgaagct tataaatttg tattcggggt tcctgaagta 480

ttcctagagg agtacgctcc cgctgctgtc cgtatcggca tcggtaagat tctaacgaac 540

gtagagcgta gtcttctatt cgacctaggt ggtgcaggtg cattgcttct taagactatc 600

ggggttaact acacatacac tgagttccaa gctggccggg tatttgctac agaaggcttc 660

cccggaggac aaggcgttgg agacctaaat gatcccactg ttggtggaat tctgaccaac 720

ctagtgacat aa 732

<210> 9

<211> 732

<212> DNA

<213> nucleotide sequence of K8-T239A (Unknown)

<400> 9

atggctgtca accaatttga cagagaagat tatctggagg tggcccggga acgggtcact 60

gaacagttta aagagaagcc gatctttgat cgcttcctgc aagtgctatt gtctggtaag 120

tttgatatcc agaatgcact ggaagacctc cagactctcc ggtctctgga cacagccacc 180

gggaagcaac tggacattat cggagacatt gtagggcgac cacgcggtct agtgtaccaa 240

gatattttca actattttgg attcgctgga acggagcgtg caggttcttt cggaagcctg 300

tcggacccta cggtcggtgc tccatggtac tcggtcggtg ctccaactgg taacgccaga 360

gagccgagcg acgaagagta tcggatgatc ctgaaagcaa agatcatcaa gaacagaaca 420

aactcaaccc cagagcaagt tatcgaagct tataaatttg tattcggggt tcctgaagta 480

ttcctagagg agtacgctcc cgctgctgtc cgtatcggca tcggtaagat tctaacgaac 540

gtagagcgta gtcttctatt cgacctaggt ggtgcaggtg cattgcttcc taagactatc 600

ggggttaact acacatacac tgagttccaa gctggccggg tatttgctac agaaggcttc 660

cccggaggac aaggcgttgg agacctaaat gatcccactg ttggtggaat tctggccaac 720

ctagtgacat aa 732

<210> 10

<211> 243

<212> PRT

<213> amino acid sequence of GP075 (Unknown)

<400> 10

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Thr Gly Asn Ala Arg Glu Pro Ser Asp Glu Glu Tyr Arg

115 120 125

Met Ile Leu Lys Ala Lys Ile Ile Lys Asn Arg Thr Asn Ser Thr Pro

130 135 140

Glu Gln Val Ile Glu Ala Tyr Lys Phe Val Phe Gly Val Pro Glu Val

145 150 155 160

Phe Leu Glu Glu Tyr Ala Pro Ala Ala Val Arg Ile Gly Ile Gly Lys

165 170 175

Ile Leu Thr Asn Val Glu Arg Ser Leu Leu Phe Asp Leu Gly Gly Ala

180 185 190

Gly Ala Leu Leu Pro Lys Thr Ile Gly Val Asn Tyr Thr Tyr Thr Glu

195 200 205

Phe Gln Ala Gly Arg Val Phe Ala Thr Glu Gly Phe Pro Gly Gly Gln

210 215 220

Gly Val Gly Asp Leu Asn Asp Pro Thr Val Gly Gly Ile Leu Thr Asn

225 230 235 240

Leu Val Thr

<210> 11

<211> 250

<212> PRT

<213> amino acid sequence of K8-D7 (Unknown)

<400> 11

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Trp Tyr Ser Val Gly Ala Pro Thr Gly Asn Ala Arg Glu

115 120 125

Pro Ser Asp Glu Glu Tyr Arg Met Ile Leu Lys Ala Lys Ile Ile Lys

130 135 140

Asn Arg Thr Asn Ser Thr Pro Glu Gln Val Ile Glu Ala Tyr Lys Phe

145 150 155 160

Val Phe Gly Val Pro Glu Val Phe Leu Glu Glu Tyr Ala Pro Ala Ala

165 170 175

Val Arg Ile Gly Ile Gly Lys Ile Leu Thr Asn Val Glu Arg Ser Leu

180 185 190

Leu Phe Asp Leu Gly Gly Ala Gly Ala Leu Leu Pro Lys Thr Ile Gly

195 200 205

Val Asn Tyr Thr Tyr Thr Glu Phe Gln Ala Gly Arg Val Phe Ala Thr

210 215 220

Glu Gly Phe Pro Gly Gly Gln Gly Val Gly Asp Leu Asn Asp Pro Thr

225 230 235 240

Val Gly Gly Ile Leu Thr Asn Leu Val Thr

245 250

<210> 12

<211> 257

<212> PRT

<213> amino acid sequence of GP075-14 (Unknown)

<400> 12

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Trp Tyr Ser Val Gly Ala Pro Trp Tyr Ser Val Gly Ala

115 120 125

Pro Thr Gly Asn Ala Arg Glu Pro Ser Asp Glu Glu Tyr Arg Met Ile

130 135 140

Leu Lys Ala Lys Ile Ile Lys Asn Arg Thr Asn Ser Thr Pro Glu Gln

145 150 155 160

Val Ile Glu Ala Tyr Lys Phe Val Phe Gly Val Pro Glu Val Phe Leu

165 170 175

Glu Glu Tyr Ala Pro Ala Ala Val Arg Ile Gly Ile Gly Lys Ile Leu

180 185 190

Thr Asn Val Glu Arg Ser Leu Leu Phe Asp Leu Gly Gly Ala Gly Ala

195 200 205

Leu Leu Pro Lys Thr Ile Gly Val Asn Tyr Thr Tyr Thr Glu Phe Gln

210 215 220

Ala Gly Arg Val Phe Ala Thr Glu Gly Phe Pro Gly Gly Gln Gly Val

225 230 235 240

Gly Asp Leu Asn Asp Pro Thr Val Gly Gly Ile Leu Thr Asn Leu Val

245 250 255

Thr

<210> 13

<211> 264

<212> PRT

<213> amino acid sequence of GP075-21 (Unknown)

<400> 13

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Trp Tyr Ser Val Gly Ala Pro Trp Tyr Ser Val Gly Ala

115 120 125

Pro Trp Tyr Ser Val Gly Ala Pro Thr Gly Asn Ala Arg Glu Pro Ser

130 135 140

Asp Glu Glu Tyr Arg Met Ile Leu Lys Ala Lys Ile Ile Lys Asn Arg

145 150 155 160

Thr Asn Ser Thr Pro Glu Gln Val Ile Glu Ala Tyr Lys Phe Val Phe

165 170 175

Gly Val Pro Glu Val Phe Leu Glu Glu Tyr Ala Pro Ala Ala Val Arg

180 185 190

Ile Gly Ile Gly Lys Ile Leu Thr Asn Val Glu Arg Ser Leu Leu Phe

195 200 205

Asp Leu Gly Gly Ala Gly Ala Leu Leu Pro Lys Thr Ile Gly Val Asn

210 215 220

Tyr Thr Tyr Thr Glu Phe Gln Ala Gly Arg Val Phe Ala Thr Glu Gly

225 230 235 240

Phe Pro Gly Gly Gln Gly Val Gly Asp Leu Asn Asp Pro Thr Val Gly

245 250 255

Gly Ile Leu Thr Asn Leu Val Thr

260

<210> 14

<211> 243

<212> PRT

<213> amino acid sequence of K8-E126K (Unknown)

<400> 14

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Thr Gly Asn Ala Arg Glu Pro Ser Asp Glu Lys Tyr Arg

115 120 125

Met Ile Leu Lys Ala Lys Ile Ile Lys Asn Arg Thr Asn Ser Thr Pro

130 135 140

Glu Gln Val Ile Glu Ala Tyr Lys Phe Val Phe Gly Val Pro Glu Val

145 150 155 160

Phe Leu Glu Glu Tyr Ala Pro Ala Ala Val Arg Ile Gly Ile Gly Lys

165 170 175

Ile Leu Thr Asn Val Glu Arg Ser Leu Leu Phe Asp Leu Gly Gly Ala

180 185 190

Gly Ala Leu Leu Pro Lys Thr Ile Gly Val Asn Tyr Thr Tyr Thr Glu

195 200 205

Phe Gln Ala Gly Arg Val Phe Ala Thr Glu Gly Phe Pro Gly Gly Gln

210 215 220

Gly Val Gly Asp Leu Asn Asp Pro Thr Val Gly Gly Ile Leu Thr Asn

225 230 235 240

Leu Val Thr

<210> 15

<211> 243

<212> PRT

<213> amino acid sequence of K8-S142L (Unknown)

<400> 15

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Thr Gly Asn Ala Arg Glu Pro Ser Asp Glu Glu Tyr Arg

115 120 125

Met Ile Leu Lys Ala Lys Ile Ile Lys Asn Arg Thr Asn Leu Thr Pro

130 135 140

Glu Gln Val Ile Glu Ala Tyr Lys Phe Val Phe Gly Val Pro Glu Val

145 150 155 160

Phe Leu Glu Glu Tyr Ala Pro Ala Ala Val Arg Ile Gly Ile Gly Lys

165 170 175

Ile Leu Thr Asn Val Glu Arg Ser Leu Leu Phe Asp Leu Gly Gly Ala

180 185 190

Gly Ala Leu Leu Pro Lys Thr Ile Gly Val Asn Tyr Thr Tyr Thr Glu

195 200 205

Phe Gln Ala Gly Arg Val Phe Ala Thr Glu Gly Phe Pro Gly Gly Gln

210 215 220

Gly Val Gly Asp Leu Asn Asp Pro Thr Val Gly Gly Ile Leu Thr Asn

225 230 235 240

Leu Val Thr

<210> 16

<211> 243

<212> PRT

<213> amino acid sequence of K8-L189R (Unknown)

<400> 16

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Thr Gly Asn Ala Arg Glu Pro Ser Asp Glu Glu Tyr Arg

115 120 125

Met Ile Leu Lys Ala Lys Ile Ile Lys Asn Arg Thr Asn Ser Thr Pro

130 135 140

Glu Gln Val Ile Glu Ala Tyr Lys Phe Val Phe Gly Val Pro Glu Val

145 150 155 160

Phe Leu Glu Glu Tyr Ala Pro Ala Ala Val Arg Ile Gly Ile Gly Lys

165 170 175

Ile Leu Thr Asn Val Glu Arg Ser Leu Leu Phe Asp Arg Gly Gly Ala

180 185 190

Gly Ala Leu Leu Pro Lys Thr Ile Gly Val Asn Tyr Thr Tyr Thr Glu

195 200 205

Phe Gln Ala Gly Arg Val Phe Ala Thr Glu Gly Phe Pro Gly Gly Gln

210 215 220

Gly Val Gly Asp Leu Asn Asp Pro Thr Val Gly Gly Ile Leu Thr Asn

225 230 235 240

Leu Val Thr

<210> 17

<211> 243

<212> PRT

<213> amino acid sequence of K8-P197L (Unknown)

<400> 17

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Thr Gly Asn Ala Arg Glu Pro Ser Asp Glu Glu Tyr Arg

115 120 125

Met Ile Leu Lys Ala Lys Ile Ile Lys Asn Arg Thr Asn Ser Thr Pro

130 135 140

Glu Gln Val Ile Glu Ala Tyr Lys Phe Val Phe Gly Val Pro Glu Val

145 150 155 160

Phe Leu Glu Glu Tyr Ala Pro Ala Ala Val Arg Ile Gly Ile Gly Lys

165 170 175

Ile Leu Thr Asn Val Glu Arg Ser Leu Leu Phe Asp Leu Gly Gly Ala

180 185 190

Gly Ala Leu Leu Leu Lys Thr Ile Gly Val Asn Tyr Thr Tyr Thr Glu

195 200 205

Phe Gln Ala Gly Arg Val Phe Ala Thr Glu Gly Phe Pro Gly Gly Gln

210 215 220

Gly Val Gly Asp Leu Asn Asp Pro Thr Val Gly Gly Ile Leu Thr Asn

225 230 235 240

Leu Val Thr

<210> 18

<211> 243

<212> PRT

<213> amino acid sequence of K8-T239A (Unknown)

<400> 18

Met Ala Val Asn Gln Phe Asp Arg Glu Asp Tyr Leu Glu Val Ala Arg

1 5 10 15

Glu Arg Val Thr Glu Gln Phe Lys Glu Lys Pro Ile Phe Asp Arg Phe

20 25 30

Leu Gln Val Leu Leu Ser Gly Lys Phe Asp Ile Gln Asn Ala Leu Glu

35 40 45

Asp Leu Gln Thr Leu Arg Ser Leu Asp Thr Ala Thr Gly Lys Gln Leu

50 55 60

Asp Ile Ile Gly Asp Ile Val Gly Arg Pro Arg Gly Leu Val Tyr Gln

65 70 75 80

Asp Ile Phe Asn Tyr Phe Gly Phe Ala Gly Thr Glu Arg Ala Gly Ser

85 90 95

Phe Gly Ser Leu Ser Asp Pro Thr Val Gly Ala Pro Trp Tyr Ser Val

100 105 110

Gly Ala Pro Thr Gly Asn Ala Arg Glu Pro Ser Asp Glu Glu Tyr Arg

115 120 125

Met Ile Leu Lys Ala Lys Ile Ile Lys Asn Arg Thr Asn Ser Thr Pro

130 135 140

Glu Gln Val Ile Glu Ala Tyr Lys Phe Val Phe Gly Val Pro Glu Val

145 150 155 160

Phe Leu Glu Glu Tyr Ala Pro Ala Ala Val Arg Ile Gly Ile Gly Lys

165 170 175

Ile Leu Thr Asn Val Glu Arg Ser Leu Leu Phe Asp Leu Gly Gly Ala

180 185 190

Gly Ala Leu Leu Pro Lys Thr Ile Gly Val Asn Tyr Thr Tyr Thr Glu

195 200 205

Phe Gln Ala Gly Arg Val Phe Ala Thr Glu Gly Phe Pro Gly Gly Gln

210 215 220

Gly Val Gly Asp Leu Asn Asp Pro Thr Val Gly Gly Ile Leu Ala Asn

225 230 235 240

Leu Val Thr

Claims

1. Pseudomonas aeruginosa bacteriophage K8 putative protein GP075, characterized in that: the nucleotide sequence is SEQ No.1, and the amino acid sequence is SEQ No. 10.

2. A pseudomonas aeruginosa bacteriophage K8 mutant K8-D7 is characterized in that: the mutant K8-D7 is capable of infecting a lipopolysaccharide O-antigen deficient host cell with a sequence of 1 and 106 to 112 complete repeats inserted between amino acids 105, 106 of the hypothetical protein GP075 as defined in claim 1; the nucleotide sequence of the mutant strain K8-D7 is SEQ No.2, and the amino acid sequence thereof is SEQ No. 11.

3. A mutein GP075-14 comprising the hypothetical protein GP075 according to claim 1, characterized in that: the sequence is that 2 amino acid sequences which are completely repeated from 106 to 112 are inserted between the amino acids 105 and 106 of the GP075, the nucleotide sequence of the mutein GP075-14 is SEQ No.3, and the amino acid sequence thereof is SEQ No. 12.

4. A mutein GP075-21 comprising the hypothetical protein GP075 according to claim 1, characterized in that: the sequence is an amino acid sequence which is completely repeated from 106 to 102 by inserting 3 amino acids between amino acids 105 and 106 of GP075, the nucleotide sequence of the mutein GP075-21 is SEQ No.4, and the amino acid sequence thereof is SEQ No. 13.

5. A pseudomonas aeruginosa bacteriophage K8 mutant strain K8-E126K is characterized in that: the mutant K8-E126K can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is E126K mutated in the hypothetical protein GP075 as claimed in claim 1, the nucleotide sequence of the mutant K8-E126K is SEQ No.5, and the amino acid sequence thereof is SEQ No. 14.

6. A pseudomonas aeruginosa bacteriophage K8 mutant K8-S142L is characterized in that: the mutant K8-S142L can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is S142L with the putative protein GP075 as set forth in claim 1, the nucleotide sequence of the mutant K8-S142L is SEQ No.6, and the amino acid sequence thereof is SEQ No. 15.

7. A pseudomonas aeruginosa bacteriophage K8 mutant K8-L189R is characterized in that: the mutant K8-L189R can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is L189R when the hypothetical protein GP075 as claimed in claim 1 occurs, the nucleotide sequence of the mutant K8-L189R is SEQ No.7, and the amino acid sequence of the mutant is SEQ No. 16.

8. A pseudomonas aeruginosa bacteriophage K8 mutant K8-P197L is characterized in that: the mutant K8-P197L can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is P197L generated by the putative protein GP075 as described in claim 1, the nucleotide sequence of the mutant K8-P197L is SEQ No.8, and the amino acid sequence of the mutant is SEQ No. 17.

9. A pseudomonas aeruginosa bacteriophage K8 mutant K8-T239A is characterized in that: the mutant K8-T239A can infect lipopolysaccharide O-antigen deficient host cells, the sequence of the mutant is T239A when the hypothetical protein GP075 occurs as described in claim 1, the nucleotide sequence of the mutant K8-T239A is SEQ No.9, and the amino acid sequence of the mutant K8-T239A is SEQ No. 18.

10. A pseudomonas aeruginosa bacteriophage K8 mutant K8-X is characterized in that: the mutant strain K8-X can infect lipopolysaccharide O-antigen deficient host cells, and is applied to the inhibition of spontaneous mutation of pseudomonas aeruginosa, and the protein GP075 is assumed to be not mutated.