CN110559430A

CN110559430A - Anti-lymphoma CAR-T medicine and application thereof

Info

Publication number: CN110559430A
Application number: CN201910999862.2A
Authority: CN
Inventors: 冯继锋; 吴建中; 马蓉; 吴旸; 陈丹; 董书辰; 陆雅; 王卓; 张圆; 张君莹; 沙欢欢; 曹海霞; 井昶雯
Original assignee: Jiangsu Cancer Hospital
Current assignee: Jiangsu Cancer Hospital
Priority date: 2019-10-21
Filing date: 2019-10-21
Publication date: 2019-12-13
Anticipated expiration: 2039-10-21
Also published as: CN110559430B

Abstract

The invention discloses an anti-lymphoma CAR-T drug and application thereof, wherein the anti-lymphoma CAR-T drug is a CD30CAR-T drug, and the CD30CAR-T drug can express a human CD30 antibody. The CD30CAR-T drug prepared by the invention can effectively inhibit tumor growth and has higher tumor regression effect, and the CD30CAR-T drug administration obviously prolongs the survival rate of peripheral T cell lymphoma patients and improves the levels of TNF-alpha, INF-gamma and G-CSF of the lymphoma patients.

Description

Anti-lymphoma CAR-T medicine and application thereof

Technical Field

the invention belongs to the technical field of CAR-T therapy, and particularly relates to a lymphoma-resistant CAR-T drug and application thereof.

background

chimeric Antigen Receptor T-Cell Immunotherapy (CAR-T), a novel precise targeted Cell therapy for treating tumors, is a promising novel tumor Cell Immunotherapy method that can be precise, rapid, efficient, and potentially cure cancers. T lymphocytes, one of the human leukocytes, are derived from bone marrow hematopoietic stem cells, mature in the thymus, and then distribute to human blood, lymph and peripheral tissues and organs to exert immune function.

The first CAR-T treatment for cancer was approved by the FDA in 2017, namely treatment of tisagenlecucel for relapsed and drug resistant ALL patients in children and young adults. Axicbtagene ciloleucel is a CAR T cell therapy approved by the FDA in the united states for a specific class of non-hodgkin lymphomas in adults, including diffuse large B-cell lymphoma, primary mediastinal B-cell lymphoma, transformed follicular lymphoma.

chimeric Antigen Receptors (CARs) of CAR-T cells consist of an extracellular antigen binding region, a transmembrane region, and an intracellular signaling region. The chimeric antigen receptor is directed against tumor-associated antigen, so that it has high specificity, and is not limited by Major Histocompatibility Complex (MHC), so that the tumor antigen is not limited by its kind, besides the protein polypeptide, also includes ganglioside and organic carbohydrate antigen.

Current CAR-T drugs are mainly directed against B cell lymphomas, while CAR-T drugs directed against T cell lymphomas are rarely studied. The treatment of the peripheral T cell lymphoma which is difficult to cure is still a difficult problem to overcome, so the development of a therapeutic drug for the peripheral T cell lymphoma which is difficult to cure is a technical problem to be solved.

Disclosure of Invention

This section is for the purpose of summarizing some aspects of embodiments of the invention and to briefly introduce some preferred embodiments. In this section, as well as in the abstract and the title of the invention of this application, simplifications or omissions may be made to avoid obscuring the purpose of the section, the abstract and the title, and such simplifications or omissions are not intended to limit the scope of the invention.

The present invention has been made in view of the above-mentioned technical drawbacks.

thus, as one aspect of the invention, the invention provides a CAR-T drug against lymphoma.

An anti-lymphoma CAR-T drug, wherein: the anti-lymphoma CAR-T drug is a CD30CAR-T drug, and the CD30CAR-T drug is capable of expressing a human CD30 antibody.

as a preferred embodiment of the anti-lymphoma CAR-T drug of the present invention: the CD30 antibody is a CD30 monoclonal antibody, the CD30 monoclonal antibody is derived from a hybridoma cell, and the preservation number of the CD30 monoclonal antibody is CCTCC NO: C201861.

As a preferred embodiment of the anti-lymphoma CAR-T drug of the present invention: the anti-lymphoma CAR-T drug is obtained by infecting T cells with CD30CAR lentiviral expression vector.

as a preferred embodiment of the anti-lymphoma CAR-T drug of the present invention: the CD30CAR lentiviral expression vector comprises a CD30 scFv gene fragment formed by connecting a heavy chain and a light chain of a CD30 antibody with a single-chain variable fragment scFv, wherein the sequence of the CD30 scFv gene fragment is shown as SEQ ID NO: 1 is shown in the specification; connecting the CD30 scFv gene fragment with a CD8aSP, a 4-1BB intracellular signal region and a CD3 zeta gene sequence in series to obtain a CD30CAR gene sequence; and (2) connecting the CD30CAR gene sequence with a pCDH-CMV-SMC-EF1a-GFP vector to obtain the CD30CAR lentiviral expression vector, wherein the CD30CAR lentiviral expression vector gene sequence is shown as SEQ ID NO: 2, respectively.

As a preferred embodiment of the anti-lymphoma CAR-T drug of the present invention: also included is a CD30CAR lentivirus packaged by adding 3. mu.g pMD2G, 6. mu.g psPAX and 7.5. mu.g of the CD30CAR lentivirus expression vector to 150. mu.L of OPTI-MEM, mixing well, adding to 500. mu.L of OPTI-MEM containing 25. mu.L Lipo 2000, standing at room temperature for 15min, adding to a petri dish, standing at 37 ℃ with 5% CO₂After 12h of culture in the incubator, 293T cells are transfected and amplified, and lentiviruses are collected to obtain lentivirus Lenti-2G.CAR-CD 30.

as a preferred embodiment of the anti-lymphoma CAR-T drug of the present invention: the preparation method of the anti-lymphoma CAR-T drug comprises the steps of mixing the lentivirus Lenti-2G.CAR-CD30 with T cells, adding 8 mug/mL polybrene, and incubating for 0.5-2 hours at 37 ℃ in an incubator with 5% CO 2; t cell culture solution was prepared by adding 50. mu.g/mL human serum albumin, 1000U/mL IL-2, 100U/mL OKT3 and CD28 to GT-T551H3 culture solution, adding to the incubated cells, and culturing at 37 ℃ in a 5% CO2 incubator for 14 days.

As a preferred embodiment of the anti-lymphoma CAR-T drug of the present invention: the amount of CD30CAR lentivirus required to infect T cells was calculated according to an MOI of 5.

as another aspect of the invention, the invention provides the use of the anti-lymphoma CAR-T medicament, wherein: the anti-lymphoma CAR-T drug can inhibit the growth of lymphoma cells, has the effects of inhibiting tumors and prolonging the survival rate.

As a preferred scheme for the application of the anti-lymphoma CAR-T medicament of the invention: the lymphoma includes human anaplastic large cell lymphoma and peripheral T cell lymphoma.

The invention has the beneficial effects that: the CD30CAR-T drug prepared by the invention can effectively inhibit tumor growth and has higher tumor regression effect, and the CD30CAR-T drug administration obviously prolongs the survival rate of peripheral T cell lymphoma patients and improves the levels of TNF-alpha, INF-gamma and G-CSF of the lymphoma patients.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the description of the embodiments will be briefly introduced below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise. Wherein:

Figure 1 is a schematic representation of the structure of a CD30CAR lentiviral expression vector.

FIG. 2 is the enzyme digestion identification diagram of CD30CAR lentiviral expression vector.

FIG. 3 is a graph of CD30 CAR-T/T cell proliferation and cell surface molecule expression following lentivirus infection.

FIG. 4 is a graph of flow cytometry to detect CD30 expression on the surface of T cells after lentiviral infection.

FIG. 5 is a graph of the LDH release assay detecting the killing rate of three CD30CAR-T cells.

FIG. 6 is a diagram of an RTCA method for detecting the killing ability of CD30CAR-T cells in vitro.

FIG. 7 is a graph of the inhibitory effect of CD30CAR-T on peripheral T cell lymphoma in vivo and the effect of CD30CAR-T on TNF- α, INF- γ and GM-CSF levels in vivo.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below.

In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention, but the present invention may be practiced in other ways than those specifically described and will be readily apparent to those of ordinary skill in the art without departing from the spirit of the present invention, and therefore the present invention is not limited to the specific embodiments disclosed below.

Furthermore, reference herein to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one implementation of the invention. The appearances of the phrase "in one embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or alternative embodiments mutually exclusive of other embodiments.

Example 1:

Acquisition of anti-CD 30 single-chain antibody scFv sequence and construction and expression of CD30CAR lentiviral expression vector:

Experimental materials:

experimental cell lines: hybridoma cells (preservation number CCTCC NO: C201861, a published cell strain).

Tool cell 293T cell (laboratory preservation)

Coli: coli DH5 alpha (laboratory preservation)

Carrier: pMD18-T Vector (purchased from Nanjing PPL company)

Solution preparation:

preparation of lentivirus transfection reagents:

preparation of 0.25M CaCl₂Solution: 1.47g of CaCl₂dissolving the powder in deionized water, fixing the volume to 40mL, and sterilizing;

Preparation of 5M NaCl solution: dissolving 14.61g of NaCl powder in deionized water, and fixing the volume to 50 mL;

Preparing a 1M BES solution;

Preparation of 1M Na₂HPO₄a solution;

preparation of 2 × BBS solution: 5.6mL of 5M NaCl solution, 5.0mL of 1M BES solution, and 150. mu.L of 1M Na₂HPO₄The solution was added to 80mL of water, adjusted to pH 6.95. + -. 0.02 with NaOH, and the volume of deionized water was adjusted to 100mL, filtered and sterilized.

The experimental method comprises the following steps:

1. Extraction of hybridoma cell RNA:

Using QIAGEN RNeasy Mini Kit:

Adding hybridoma cell (CCTCC NO: C201861) into PBS solution, centrifuging at 300g for 10 min;

discarding the supernatant, and adding 700. mu.L RLT to obtain cell lysate;

sucking 350 microliter of suspension from the cell lysate, and shaking;

Adding 350 μ L70% ethanol, and mixing;

centrifuging the column for 15s at 300g, and discarding the waste liquid;

Add 700. mu.L of Buffer RW1 to the column and centrifuge at 300g for 15 s;

Add 500. mu.L of Buffer RPE to the column and centrifuge at 300g for 15 s;

then 500. mu.L of Buffer RPE was added to the column and centrifuged at 300g for 2 min;

Idling at 300g for 1 min; 50 μ L of DEPC was added to dissolve the RNA.

2. And (3) cDNA synthesis:

The cDNA was extracted using the Transcriptor First Strand cDNA Synthesis Kit of Roche.

(1) reaction system:

denaturation at 65 ℃ for 10min

reaction system:

components	volume of
		Total RNA of cells	5μL
oligodT	1μL
		dNTPs Mix	1μL
DEPC water	make up to 10. mu.L

(2) preparing a mixed solution:

The component system of the mixed solution is as follows:

Components	Volume of
		10×RT buffer	2μL
0.1M DTT	2μL
		RNaseOUT(40U/μL)	1μL
25mM MgCl₂	4μL
		SuperScriptⅢ	1μL

Heating in water bath at 50 deg.C for 50 min;

Heating in water bath at 85 deg.C for 5 min;

Stored in an ice bath at-20 ℃.

3. PCR amplification of the heavy chain (V) of monoclonal antibody CD30_H) And light chain (V)_L)：

(1) Mu.g of the cDNA prepared above was used as a templateamplification of the heavy chain (V) of monoclonal antibody CD30_H) And light chain (V)_L)：

PCR amplification System:

Heavy chain amplification primers:

MVH-F:GGCCAGTGGATAGTCAGATG

MVH-R:GAGGTGCAGCTGAAGGAGTC

Light chain amplification primers:

MVK-F:GGATACAGTTGGTGCAGCATC

MVK-R:GATGTTTTGATGACCCAAACT

And (3) PCR reaction conditions:

The PCR product was detected by 1% agarose gel electrophoresis and recovered by tapping (QIAGEN gel recovery kit).

(2) heavy chain (V) of the cloned antibody CD30_H) And light chain (V)_L) Cloning and sequencing of (a):

heavy chain (V) of cloned antibody CD30 recovered from gel cutting_H) And light chain (V)_L) The DNA is respectively connected with a cloning Vector pMD18-T Vector and reacted for 5min at room temperature; the reaction system is as follows:

Connecting a reaction system:

Components	Volume of
		V_L/V_H	4μL
pMD18-T Vector	1μL
		SolutionⅠ	5μL

Respectively transforming the ligation products into competent cells DH5 alpha, selecting a monoclonal colony on the next day and sequencing;

And after the sequencing result is correct, cloning and extracting the plasmid.

(3) Heavy chain (V) of the cloned antibody CD30_H) And light chain (V)_L) Ligation and amplification of the Gene fragment (Using a mouse antibody ScFv Gene amplification kit from PPL Co.):

The reaction system is as follows:

Reaction system:

The PCR reaction conditions were as follows:

And (4) performing agarose gel electrophoresis, tapping and recovering a band with the size of about 330 bp.

(4) heavy chain (V) of CD30_H) And light chain (V)_L) Ligation was performed to construct the CD30 scFv fragment:

The reaction system (50. mu.L system) was prepared as follows

Connecting a reaction system:

Components	Volume of
		scFv Mix (scFv ligation amplification System)	45μL
DNA Polymerase	0.3μL
		V_H	1μL
V_L	1μL
		ddH₂O	2.7μL

The PCR reaction conditions were as follows:

after the PCR product passes through 2% agar, recovering a band with the size of about 700bp, and after tapping recovery, cloning; the target strip is cloned to a pMD18-TVector vector after being recovered;

the reaction system was configured as follows:

Target strip and carrier attachment system:

Components	Volume of
		V_LOr V_Hgene fragment	4μL
pMD18-T Vector	1μL
		SolutionⅠ	5μL

preparing a connecting system for each PCR recovered fragment according to the volume, and reacting for 5min at room temperature; transforming DH5 alpha cells; plates with ampicillin resistance were plated and the next day the bacteria were picked and monocloned for sequencing.

design and construction of Lenti-2G.CAR-CD 30:

structural design and construction of CD30CAR gene sequence:

The CD30 scFv was concatenated with the CD8a hinge region-transmembrane region, CD8aSP (Signal peptide), 4-1BB intracellular Signal region and CD3 zeta gene sequence in Genebank (NCBI).

Ligation of the CD30CAR gene sequence with the vector pCDH-CMV-SMC-EF1 a-GFP:

Cloning the constructed CD30CAR gene sequence into a pCDH-CMV-SMC-EF1a-GFP lentiviral expression vector by XbaI and BamHI endonucleases to obtain the CD30CAR lentiviral expression vector; the CD30CAR lentiviral expression vector map is shown in FIG. 1;

Mu.g of pMD2G, 6. mu.g of psPAX and 7.5. mu.g of the CD30CAR lentiviral expression vector were added to 150. mu.L of OPTI-MEM, mixed well, then added to 500. mu.L of OPTI-MEM containing 25. mu.L of Lipo 2000, left to stand at room temperature for 15min, added to a petri dish, cultured at 37 ℃ in an incubator with 5% CO2 for 12h, and then transfected 293T cells were expanded and lentiviruses were collected, and the resulting lentiviruses were named Lenti-2G.CAR-CD 30.

(1) plasmid pCDH-CMV-SMC-EF1a-GFP was double digested with XbaI and BamHI at 37 ℃ overnight in the following reaction scheme:

Plasmid digestion system:

Name (R)	Volume of
		10×Buffer M	2μL
XbaI	1μL
		BamHI	1μL
pCDH-CMV-SMC-EF1a-GFP	1μL
		ddH₂O	make up to 20. mu.L

(2) Adding 5 mu L of 10 XLoading Buffer and 1% agarose gel for electrophoresis identification, and recovering a target band in the gel;

(3) Double digestion of the synthetic pMD18-T Vector containing the CD30CAR gene sequence with XbaI and BamHI;

(4) connecting the pCDH-CMV-SMC-EF1a-GFP fragment after enzyme digestion recovery with a CD30CAR gene sequence enzyme digestion product, wherein the specific connection reaction system is as follows:

Connecting a reaction system:

Components	volume of
		10×Buffer	1μL
digested fragment of pCDH-CMV-SMC-EF1a-GFP	1μL
		CD30CAR gene sequence	6.4μL
t4 ligase	6.4μL
		PEG₄₀₀₀	1μL

reaction conditions are as follows: after gentle mixing, 16 ℃ overnight.

And (3) identification:

(5) conversion of ligation products

The overnight ligated mixture was directly transformed into Stbl3 competent cells. The transformed Stbl3 competent cells were added to LB liquid medium, shaken, smeared on an LB plate, and cultured in an inverted incubator at 37 ℃ overnight.

(6) Amplification and extraction of recombinant plasmids

after 16h of transformation, 3 single bacterial colonies were selected and inoculated into 5mL LB ampicillin resistance medium, respectively, with final concentration of ampicillin in the medium of 100. mu.g/mL, and were shake-cultured overnight at 37 ℃ for the next day to extract plasmids.

(7) DNA sequencing identification

The extracted plasmid was assigned to Nanjing plasmid and protein consensus library (PPL) for DNA sequencing. Identified as satisfactory, the lentivirus expression vector containing the gene segment of CD30CAR is obtained.

the experimental results are as follows:

Amplification and characterization of CD30CAR lentiviral expression vector:

The lentivirus expression vector of the invention is subjected to double enzyme digestion verification through XbaI and BamHI double enzyme digestion sites, and the result shows that: the fragment size of the CD30CAR sequence, including the scFv segment, was consistent with the expectation, approximately 1000bp (FIG. 2).

CD30 heavy chain (V)_H) Light chain (V)_L) Sequencing of the bands:

the research of the invention discovers that the content of the hybridoma cell strain CCTCC NO: among the CD30 antibodies secreted by C201861, multiple different heavy chains of CD30 antibody were identified (V30 antibody)_H) And light chain (V)_L)：

v of CD30 antibody_HThe sequence analysis results were as follows:

V_H(heavy chain) specific sequence

	CDR1	CDR2	CDR3
				V_H-1	GFSLTSHG	IWSDGSTA	AREPPTTYVCL
V_H-2	GFSLTSYG	IWSDGSTA	AREPPTTYVCL
				V_H-3	GYTFTNYD	IYPGDGTA	ARGDGFDY
V_H-4	GFSLSRYS	IWGGGIT	ARKYGLDYDGAMDY

v of CD30 antibody_LSequence analysis:

V_L(light chain) specific sequence

	CDR1	CDR2	CDR3
				V_L-1	KSVSTSGYSY	LVS	QHIRELTR
V_L-2	KSVSTSGYSY	LVS	QHIRELTL
				V_L-3	DNVHTY	GAS	GQSYRYPPT
V_L-4	DNVHTY	GAS	GQSYRYPLT

CD30CAR gene sequence:

the Lenti-2G.CAR-CD30 was constructed as a combination of different heavy and light chains of the CD30 antibody:

Making the heavy chain V_H-4, the light chain is V_L-3 combined CD30 antibody named 9C11-1 with heavy chain as V_H-4, the light chain is V_LThe CD30 antibody of-4 combination was named 9C11-2, and the heavy chain was V_H-4, the light chain is V_LThe CD30 antibody of the-1 combination was named 9C 11-3. The heavy and light chain combinations of the remaining CD30 antibodies were excluded due to the lower antibody titers that were experimentally demonstrated.

The sequences in the lentiviral expression vectors of the present invention are as follows:

(1)Signal peptide(SP)：

atggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccg

(2)CD8αTM

accacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttactgc

(3)41BB

aaacggggcagaaagaaactcctgtatatattcaaacaaccatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaagaagaagaaggaggatgtgaactg

(4)CD3ζ

agagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgc

(5)CD30 scFv(9C11-1)

gaggtgaaactgcagcagtctggacctggcctggtggcaccctcacagagcctgtccatcacatgcactgtctctgggttctcattatccagatatagtgtacactgggttcgccagcctccaggaaagggtctggagtggctgggaatgatatggggtggtggaatcacagactataattcagctctcaaatccagactgagcatcaacaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatatactactgtgccagaaagtatgggttggattacgacggtgctatggactactggggccaagggaccacggtcaccgtctcctcaggtggtggtggttctggtggtggtggttctggcggcggcggctccgacatccagatgacccagtctcccaaatccatgtccatgtcagtaggagagagggtcaccttgagctgcaaggccactgacaatgtgcatacttatgtatcctggtatcaacaaaaaccagagcagtctcctaaactgctgatatacggggcatccaaccggtacactggggtccccgatcgcttcacaggcagtggatctgaaacagatttcactctgaccatcagcagtgtgcaggctgaagaccttgcagattatcactgtggacagagttacaggtatccgcccacgttcggtgctgggaccaagctggagctgaaa

(6) CD30 scFv (9C11-2) (i.e., SEQ ID NO: 1)

gaggtgaaactgcagcagtctggacctggcctggtggcaccctcacagagcctgtccatcacatgcactgtctctgggttctcattatccagatatagtgtacactgggttcgccagcctccaggaaagggtctggagtggctgggaatgatatggggtggtggaatcacagactataattcagctctcaaatccagactgagcatcaacaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatatactactgtgccagaaagtatgggttggattacgacggtgctatggactactggggccaagggaccacggtcaccgtctcctcaggtggtggtggttctggtggtggtggttctggcggcggcggctccgacatccagatgacccagtctcccaaatccatgtccatgtcagtaggagagagggtcaccttgagctgcaaggccactgacaatgtgcatacttatgtatcctggtatcaacaaaaaccagagcagtctcctaaactgctgatatacggggcatccaaccggtacactggggtccccgatcgcttcacaggcagtggatctgaaacagatttcactctgaccatcagcagtgtgcaggctgaagaccttgcagattatcactgtggacagagttacaggtatccgctcacgttcggtgctgggaccaagctggagctgaaa

(7)CD30 scFv(9C11-3)

gaggtgaaactgcagcagtctggacctggcctggtggcaccctcacagagcctgtccatcacatgcactgtctctgggttctcattatccagatatagtgtacactgggttcgccagcctccaggaaagggtctggagtggctgggaatgatatggggtggtggaatcacagactataattcagctctcaaatccagactgagcatcaacaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatatactactgtgccagaaagtatgggttggattacgacggtgctatggactactggggccaagggaccacggtcaccgtctcctcaggtggtggtggttctggtggtggtggttctggcggcggcggctccgaaattgtgttgacgcagtctcctgcttccttagctgtatctctggggcagagggccaccatctcatacagggccagcaaaagtgtcagtacatctggctatagttatatgcactggaaccaacagaaaccaggacagccacccagactcctcatctatcttgtatccaacctagaatctggggtccctgccaggttcagtggcagtgggtctgggacagacttcaccctcaacatccatcctgtggaggaggaggatgctgcaacctattactgtcagcacattagggagcttacacgttcggaggggggaccaagctggaaatcaaa

(8) the gene sequence (namely SEQ ID NO: 2) of the lentivirus expression vector (9C11-2) of the invention:

acgcgtgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacaataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacctgaaagcgaaagggaaaccagagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccactgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcctcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagattggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggttaacttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttatcgatactagtattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagattctagagccaccatggccttaccagtgaccgccttgctcctgccgctggccttgctgctccacgccgccaggccggaggtgaaactgcagcagtctggacctggcctggtggcaccctcacagagcctgtccatcacatgcactgtctctgggttctcattatccagatatagtgtacactgggttcgccagcctccaggaaagggtctggagtggctgggaatgatatggggtggtggaatcacagactataattcagctctcaaatccagactgagcatcaacaaggacaactccaagagccaagttttcttaaaaatgaacagtctgcaaactgatgacacagccatatactactgtgccagaaagtatgggttggattacgacggtgctatggactactggggccaagggaccacggtcaccgtctcctcaggtggtggtggttctggtggtggtggttctggcggcggcggctccgacatccagatgacccagtctcccaaatccatgtccatgtcagtaggagagagggtcaccttgagctgcaaggccactgacaatgtgcatacttatgtatcctggtatcaacaaaaaccagagcagtctcctaaactgctgatatacggggcatccaaccggtacactggggtccccgatcgcttcacaggcagtggatctgaaacagatttcactctgaccatcagcagtgtgcaggctgaagaccttgcagattatcactgtggacagagttacaggtatccgctcacgttcggtgctgggaccaagctggagctgaaactcgagaccacgacgccagcgccgcgaccaccaacaccggcgcccaccatcgcgtcgcagcccctgtccctgcgcccagaggcgtgccggccagcggcggggggcgcagtgcacacgagggggctggacttcgcctgtgatatctacatctgggcgcccttggccgggacttgtggggtccttctcctgtcactggttatcaccctttactgcaaacggggcagaaagaaactcctgtatatattcaaacaaccatttatgagaccagtacaaactactcaagaggaagatggctgtagctgccgatttccagaagaagaagaaggaggatgtgaactgagagtgaagttcagcaggagcgcagacgcccccgcgtacaagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgctaaggatccgcggccgcgaaggatctgcgatcgctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcgcatctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttacagatccaagctgtgaccggcgcctacgctagacgccaccatggagagcgacgagagcggcctgcccgccatggagatcgagtgccgcatcaccggcaccctgaacggcgtggagttcgagctggtgggcggcggagagggcacccccaagcagggccgcatgaccaacaagatgaagagcaccaaaggcgccctgaccttcagcccctacctgctgagccacgtgatgggctacggcttctaccacttcggcacctaccccagcggctacgagaaccccttcctgcacgccatcaacaacggcggctacaccaacacccgcatcgagaagtacgaggacggcggcgtgctgcacgtgagcttcagctaccgctacgaggccggccgcgtgatcggcgacttcaaggtggtgggcaccggcttccccgaggacagcgtgatcttcaccgacaagatcatccgcagcaacgccaccgtggagcacctgcaccccatgggcgataacgtgctggtgggcagcttcgcccgcaccttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacatgcacttcaagagcgccatccaccccagcatcctgcagaacgggggccccatgttcgccttccgccgcgtggaggagctgcacagcaacaccgagctgggcatcgtggagtaccagcacgccttcaagacccccatcgccttcgccagatcccgcgctcagtcgtccaattctgccgtggacggcaccgccggacccggctccaccggatctcgctaagtcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaaaataagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagacttttgcagagacggcccaaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagctg

CD30CAR-T cell preparation:

Activation of T lymphocytes and CD30CAR T cell acquisition;

culturing and activating human T lymphocytes: adjusting human peripheral blood mononuclear cell density to 5 × 10⁶Adding human serum albumin at a concentration of 50 μ g/mL per cell/mLAnd the cytokines IL-2 at 1000U/mL, Anti-CD3(OKT3) and CD28 antibody at 100U/mL at 37 ℃ with 5% CO₂culturing for 48 hours in the incubator;

Lenti-2G.CAR-CD30 lentivirus infects T lymphocytes: dividing the T cells into a CD30CAR group and a T cell blank group; calculating the amount of virus required for infection according to an MOI of 5;

Calculating the formula: MOI ═ (viral titer × volume of viral fluid)/number of T cells

adding the virus solution into 500 μ L GT-T551H3 culture medium containing a certain amount of T cells, adding 8 μ g/mL polybrene, mixing well, adding into 24-well plate, 37 deg.C, 5% CO₂incubating for 1 hour in the incubator; the above medium was added to 9mL of GT-T551H3 medium containing 50. mu.g/mL human serum albumin, 1000U/mL IL-2, 100U/mL OKT3 and CD28 at 37 ℃ with 5% CO₂The culture was carried out for 14 days. Cytometers and flow cytometry examined the proliferation and CD30 expression of CD30CAR T cells.

The killing effect of CD30CAR-T cells on peripheral T cell lymphoma cell strains (Karpas299) is detected by an LDH lactate dehydrogenase kit.

and (3) calculating the killing rate:

The killing rate is (experimental well OD value-target cell natural release pore OD value)/(target cell maximum release tube OD value-target cell natural release tube OD value) × 100%.

Detecting the in vitro killing capacity of the CD30CAR-T cells by using a real-time label-free cell assay (RTCA);

detecting the expression condition of the cell factors in the supernatant by adopting a Luminex liquid phase chip technology;

Cell membrane staining solution PKH26 and 7-AAD were combined to detect the killing effect of CD30CAR-T cells.

The experimental results are as follows:

detecting the expression conditions of CD3, CD4, CD8 and CD30 on the surface of the T cells after the lentivirus infection by a flow cytometer:

The proportion of CD30CAR T cells was determined by examining the expression rate of the CAR-expressing F a' b fragment and T cell GFP, CD3, CD4, CD8 molecules after lentivirus transfection of T cells, and the results of the experiment are shown in FIG. 4The expression of CD3, CD4 and CD8 molecules is increased with time on day 1, day 3, day 5, day 7, day 9, day 11 and day 13 after extraction, and at day 13, CD3 and CD3⁺T cell, CD4⁺t cell, CD8⁺The proportion of T cells in the total cells is 88.9 percent, 52.9 percent and 38.4 percent respectively, and the positive expression rate of CD30 reaches 53.3 percent.

Proliferation of CD30CAR-T cells in vitro:

after in vitro culture of extracted human peripheral blood T lymphocytes, irrelevant sequence NC CAR-T cells were counted against CD30CAR-T cells on day 0 and day 13, respectively, and proliferation of cells before and after lentiviral transfection was recorded, with the result that CD30CAR-T cells were expanded about 10-fold at day 13 compared to day 0, as shown in fig. 4.

the LDH lactate dehydrogenase kit detects the killing effect of CD30CAR-T cells:

The results are shown in fig. 5, 3 different CD30CAR-T cells had killing effect on CD30 positive peripheral T cells Karpas299, when the effective target ratio was 40: the killing effect of 9C11-2 cells is strongest at 1, 1.8 times of 9C11-3 and 1.98 times of 9C 11-1. 9C11-2 CD30CAR-T (hereinafter CD30 CAR-T) cells were selected for subsequent study as follows.

with increasing effective target ratio, it can be found that at 40: 1, compared with T cells, the killing effect of CD30CAR-T cells infected with lentivirus on target cells is obviously improved, the killing rate of CD30CAR-T cells is 88.04 +/-1.41, and the difference has statistical significance (P is less than 0.01). LDH lactate dehydrogenase release experiments show that the CD30CAR-T cells have obvious killing effect on target cells Karpas299, and the killing effect is improved along with the effective target ratio within a certain effective target ratio range.

RTCA cell proliferation assay to detect killing ability of CD30CAR-T cells in vitro:

After 14 days of in vitro expansion of T cells, the ratio of effective target was 20: 1 and 10: 1, co-culturing the target cells Karpas299 and CD30CAR-T cells, and observing that the killing effect of the T cells and the CD30CAR-T cells on the target cells is not changed under two effective target ratios. The results are shown in fig. 6, where the effective target ratio is 20: 1 and 10: 1, the killing effect of the CD30CAR-T cells is obviously higher than that of NC CAR-T cells (P <0.01), and the killing effect is increased along with the increase of the effective-target ratio within a certain range.

Detecting the expression conditions of cell factors TNF-alpha, IL-2 and INF-r in supernatant by adopting a Luminex liquid phase chip technology:

the killing effect of CD30CAR-T cells on target cells is shown by detecting the content of cytokines TNF-alpha, IL-2 and INF-r in T supernatant, and the effective target ratio is set to be 40: 1,20: 1,10: 1, effective target ratio 40: 1 and 20: 1, the contents of the cytokines TNF-alpha, IL-2 and INF-r in the supernatant are approximately the same, and the effective target ratio is 10: 1, and the release amount of the cytokine is gradually increased within a certain range along with the increase of the effective target ratio.

PKH26 dye and 7-AAD were combined to detect killing of CD30CAR-T cells:

Target cells Karpas299 were stained with PKH26 dye, and after 24 hours of co-culture with CD30CAR-T cells, the killing effect of CD30CAR-T cells was observed upon labeling of apoptotic target cells by 7-AAD flow antibodies at 40: 1,20: 1,10: 1, the killing effect of the CD30CAR-T cells is higher than that of NC CAR-T cells, and the killing rates are respectively 78.3%, 43.7% and 22.6% which have statistical significance (P < 0.01). Wherein, 40: the effect of the experimental group 1 is most obvious, and meanwhile, the effect is consistent with the previous experimental result, and within a certain range, the higher the effective target ratio is, the more obvious the killing effect is.

in conclusion, through LDH lactate dehydrogenase release experiments, RTCA proliferation curves, a Luminex liquid phase chip technology for detecting the expression quantity of TNF-alpha, IL-2 and INF-r in supernatant, and a PKH26 and 7-AAD combined method, the four experimental methods show that the killing effect of CD30CAR-T cells on target cells is obviously improved compared with that of T cells.

inhibition of peripheral T cell lymphoma in vivo by CD30 CAR-T:

To investigate the in vivo inhibitory effect of CD30CAR-T cells on CD30 positive lymphomas, 2X 10 cells were taken⁶Karpas299 cells in 100. mu.L PBS, mixed with 100. mu.L matrix gel (Life sciences, USA), injected in NOD-Prkdc^em26Cd52Il2rg^em26Cd22Construction of mouse xenograft model on right dorsal part of/Nju mouse (NCG, GemPhamatoech) when tumor size reaches 50mm³When the mice are injected intravenously, 1X 10⁷CD30CAR-T cells, or 1X 10⁷NC CAR-T cells or saline. Tumor size was monitored with calipers and tumor volume was calculated as: tumor major diameter x tumor broad diameter²/2. After 30 days, mice were sacrificed for tumor tissue analysis. Immunohistochemistry was used to determine the levels of TNF- α, INF γ and G-CSF in tumor tissues.

CD30CAR-T cells were effective in inhibiting tumor growth and had high tumor suppression (figure 7). The TNF-a, INF- γ and G-CSF levels of the CD30CAR-T group were significantly higher than those of the NC CAR T group and the saline group, and we also analyzed the survival rate of the CD30CAR T, NC CAR T, saline group mice, and the results showed that the survival rate was significantly prolonged for the CD30CAR-T group mice.

It should be noted that the above-mentioned embodiments are only for illustrating the technical solutions of the present invention and not for limiting, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, which should be covered by the claims of the present invention.

Sequence listing

<110> tumor hospital in Jiangsu province

<120> anti-lymphoma CAR-T drug and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 726

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gaggtgaaac tgcagcagtc tggacctggc ctggtggcac cctcacagag cctgtccatc 60

acatgcactg tctctgggtt ctcattatcc agatatagtg tacactgggt tcgccagcct 120

ccaggaaagg gtctggagtg gctgggaatg atatggggtg gtggaatcac agactataat 180

tcagctctca aatccagact gagcatcaac aaggacaact ccaagagcca agttttctta 240

aaaatgaaca gtctgcaaac tgatgacaca gccatatact actgtgccag aaagtatggg 300

ttggattacg acggtgctat ggactactgg ggccaaggga ccacggtcac cgtctcctca 360

ggtggtggtg gttctggtgg tggtggttct ggcggcggcg gctccgacat ccagatgacc 420

cagtctccca aatccatgtc catgtcagta ggagagaggg tcaccttgag ctgcaaggcc 480

actgacaatg tgcatactta tgtatcctgg tatcaacaaa aaccagagca gtctcctaaa 540

ctgctgatat acggggcatc caaccggtac actggggtcc ccgatcgctt cacaggcagt 600

ggatctgaaa cagatttcac tctgaccatc agcagtgtgc aggctgaaga ccttgcagat 660

tatcactgtg gacagagtta caggtatccg ctcacgttcg gtgctgggac caagctggag 720

ctgaaa 726

<210> 2

<211> 8996

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggttaacttt 1800

taaaagaaaa ggggggattg gggggtacag tgcaggggaa agaatagtag acataatagc 1860

aacagacata caaactaaag aattacaaaa acaaattaca aaaattcaaa attttatcga 1920

tactagtatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac 1980

gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga 2040

tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg 2100

ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg 2160

caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac 2220

cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag attctagagc 2280

caccatggcc ttaccagtga ccgccttgct cctgccgctg gccttgctgc tccacgccgc 2340

caggccggag gtgaaactgc agcagtctgg acctggcctg gtggcaccct cacagagcct 2400

gtccatcaca tgcactgtct ctgggttctc attatccaga tatagtgtac actgggttcg 2460

ccagcctcca ggaaagggtc tggagtggct gggaatgata tggggtggtg gaatcacaga 2520

ctataattca gctctcaaat ccagactgag catcaacaag gacaactcca agagccaagt 2580

tttcttaaaa atgaacagtc tgcaaactga tgacacagcc atatactact gtgccagaaa 2640

gtatgggttg gattacgacg gtgctatgga ctactggggc caagggacca cggtcaccgt 2700

ctcctcaggt ggtggtggtt ctggtggtgg tggttctggc ggcggcggct ccgacatcca 2760

gatgacccag tctcccaaat ccatgtccat gtcagtagga gagagggtca ccttgagctg 2820

caaggccact gacaatgtgc atacttatgt atcctggtat caacaaaaac cagagcagtc 2880

tcctaaactg ctgatatacg gggcatccaa ccggtacact ggggtccccg atcgcttcac 2940

aggcagtgga tctgaaacag atttcactct gaccatcagc agtgtgcagg ctgaagacct 3000

tgcagattat cactgtggac agagttacag gtatccgctc acgttcggtg ctgggaccaa 3060

gctggagctg aaactcgaga ccacgacgcc agcgccgcga ccaccaacac cggcgcccac 3120

catcgcgtcg cagcccctgt ccctgcgccc agaggcgtgc cggccagcgg cggggggcgc 3180

agtgcacacg agggggctgg acttcgcctg tgatatctac atctgggcgc ccttggccgg 3240

gacttgtggg gtccttctcc tgtcactggt tatcaccctt tactgcaaac ggggcagaaa 3300

gaaactcctg tatatattca aacaaccatt tatgagacca gtacaaacta ctcaagagga 3360

agatggctgt agctgccgat ttccagaaga agaagaagga ggatgtgaac tgagagtgaa 3420

gttcagcagg agcgcagacg cccccgcgta caagcagggc cagaaccagc tctataacga 3480

gctcaatcta ggacgaagag aggagtacga tgttttggac aagagacgtg gccgggaccc 3540

tgagatgggg ggaaagccga gaaggaagaa ccctcaggaa ggcctgtaca atgaactgca 3600

gaaagataag atggcggagg cctacagtga gattgggatg aaaggcgagc gccggagggg 3660

caaggggcac gatggccttt accagggtct cagtacagcc accaaggaca cctacgacgc 3720

ccttcacatg caggccctgc cccctcgcta aggatccgcg gccgcgaagg atctgcgatc 3780

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 3840

gaggggtcgg caattgaacg ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 3900

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 3960

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag ctgaagcttc 4020

gaggggctcg catctctcct tcacgcgccc gccgccctac ctgaggccgc catccacgcc 4080

ggttgagtcg cgttctgccg cctcccgcct gtggtgcctc ctgaactgcg tccgccgtct 4140

aggtaagttt aaagctcagg tcgagaccgg gcctttgtcc ggcgctccct tggagcctac 4200

ctagactcag ccggctctcc acgctttgcc tgaccctgct tgctcaactc tacgtctttg 4260

tttcgttttc tgttctgcgc cgttacagat ccaagctgtg accggcgcct acgctagacg 4320

ccaccatgga gagcgacgag agcggcctgc ccgccatgga gatcgagtgc cgcatcaccg 4380

gcaccctgaa cggcgtggag ttcgagctgg tgggcggcgg agagggcacc cccaagcagg 4440

gccgcatgac caacaagatg aagagcacca aaggcgccct gaccttcagc ccctacctgc 4500

tgagccacgt gatgggctac ggcttctacc acttcggcac ctaccccagc ggctacgaga 4560

accccttcct gcacgccatc aacaacggcg gctacaccaa cacccgcatc gagaagtacg 4620

aggacggcgg cgtgctgcac gtgagcttca gctaccgcta cgaggccggc cgcgtgatcg 4680

gcgacttcaa ggtggtgggc accggcttcc ccgaggacag cgtgatcttc accgacaaga 4740

tcatccgcag caacgccacc gtggagcacc tgcaccccat gggcgataac gtgctggtgg 4800

gcagcttcgc ccgcaccttc agcctgcgcg acggcggcta ctacagcttc gtggtggaca 4860

gccacatgca cttcaagagc gccatccacc ccagcatcct gcagaacggg ggccccatgt 4920

tcgccttccg ccgcgtggag gagctgcaca gcaacaccga gctgggcatc gtggagtacc 4980

agcacgcctt caagaccccc atcgccttcg ccagatcccg cgctcagtcg tccaattctg 5040

ccgtggacgg caccgccgga cccggctcca ccggatctcg ctaagtcgac aatcaacctc 5100

tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct ccttttacgc 5160

tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt atggctttca 5220

ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg tggcccgttg 5280

tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact ggttggggca 5340

ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct attgccacgg 5400

cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg ttgggcactg 5460

acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc gcctgtgttg 5520

ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc aatccagcgg 5580

accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt cgccttcgcc 5640

ctcagacgag tcggatctcc ctttgggccg cctccccgcc tggtaccttt aagaccaatg 5700

acttacaagg cagctgtaga tcttagccac tttttaaaag aaaagggggg actggaaggg 5760

ctaattcact cccaacgaaa ataagatctg ctttttgctt gtactgggtc tctctggtta 5820

gaccagatct gagcctggga gctctctggc taactaggga acccactgct taagcctcaa 5880

taaagcttgc cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac 5940

tagagatccc tcagaccctt ttagtcagtg tggaaaatct ctagcagtag tagttcatgt 6000

catcttatta ttcagtattt ataacttgca aagaaatgaa tatcagagag tgagaggaac 6060

ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 6120

aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 6180

catgtctggc tctagctatc ccgcccctaa ctccgcccag ttccgcccat tctccgcccc 6240

atggctgact aatttttttt atttatgcag aggccgaggc cgcctcggcc tctgagctat 6300

tccagaagta gtgaggaggc ttttttggag gcctagactt ttgcagagac ggcccaaatt 6360

cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca 6420

acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca 6480

cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc 6540

attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt 6600

cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 6660

caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 6720

caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 6780

ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 6840

cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 6900

ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 6960

tttctcatag ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 7020

gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 7080

ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 7140

ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 7200

gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 7260

aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 7320

tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 7380

ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat 7440

tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct 7500

aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta 7560

tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa 7620

ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac 7680

gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc gagcgcagaa 7740

gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag 7800

taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg 7860

tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag 7920

ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg 7980

tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc 8040

ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat 8100

tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata 8160

ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa 8220

aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca 8280

actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc 8340

aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc 8400

tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg 8460

aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac 8520

ctgacgtcta agaaaccatt attatcatga cattaaccta taaaaatagg cgtatcacga 8580

ggccctttcg tctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 8640

cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 8700

cgtcagcggg tgttggcggg tgtcggggct ggcttaacta tgcggcatca gagcagattg 8760

tactgagagt gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg agaaaatacc 8820

gcatcaggcg ccattcgcca ttcaggctgc gcaactgttg ggaagggcga tcggtgcggg 8880

cctcttcgct attacgccag ctggcgaaag ggggatgtgc tgcaaggcga ttaagttggg 8940

taacgccagg gttttcccag tcacgacgtt gtaaaacgac ggccagtgcc aagctg 8996

Claims

1. An anti-lymphoma CAR-T drug, characterized by: the anti-lymphoma CAR-T drug is a CD30CAR-T drug, and the CD30CAR-T drug is capable of expressing a human CD30 antibody.

2. the anti-lymphoma CAR-T drug according to claim 1, wherein: the CD30 antibody is a CD30 monoclonal antibody, the CD30 monoclonal antibody is derived from a hybridoma cell, and the preservation number of the CD30 monoclonal antibody is CCTCC NO: C201861.

3. An anti-lymphoma CAR-T medicament according to claim 1 or 2, wherein: the anti-lymphoma CAR-T drug is obtained by infecting T cells with CD30CAR lentiviral expression vector.

4. the anti-lymphoma CAR-T drug according to claim 3, wherein: the CD30CAR lentiviral expression vector comprises a CD30 scFv gene fragment formed by connecting a heavy chain and a light chain of a CD30 antibody with a single-chain variable fragment scFv, wherein the sequence of the CD30 scFv gene fragment is shown as SEQ ID NO: 1 is shown in the specification; connecting the CD30 scFv gene fragment with a CD8aSP, a 4-1BB intracellular signal region and a CD3 zeta gene sequence in series to obtain a CD30CAR gene sequence; and (2) connecting the CD30CAR gene sequence with a pCDH-CMV-SMC-EF1a-GFP vector to obtain the CD30CAR lentiviral expression vector, wherein the CD30CAR lentiviral expression vector gene sequence is shown as SEQ ID NO: 2, respectively.

5. The anti-lymphoma CAR-T drug according to claim 4, wherein: also included is a CD30CAR lentivirus packaged by adding 3. mu.g pMD2G, 6. mu.g psPAX and 7.5. mu.g of the CD30CAR lentivirus expression vector to 150. mu.L of OPTI-MEM, mixing well, adding to 500. mu.L of OPTI-MEM containing 25. mu.L Lipo 2000, standing at room temperature for 15min, adding to a petri dish, standing at 37 ℃ with 5% CO₂After 12h of culture in the incubator, 293T cells are transfected and amplified, and lentiviruses are collected to obtain lentivirus Lenti-2G.CAR-CD 30.

6. The anti-lymphoma CAR-T drug according to claim 5, wherein: the preparation method of the anti-lymphoma CAR-T drug comprises the steps of mixing the lentivirus Lenti-2G.CAR-CD30 with T cells, adding 8 mug/mL polybrene, and incubating for 0.5-2 hours at 37 ℃ in an incubator with 5% CO 2; t cell culture solution was prepared by adding 50. mu.g/mL human serum albumin, 1000U/mL IL-2, 100U/mL OKT3 and CD28 to GT-T551H3 culture solution, adding to the incubated cells, and culturing at 37 ℃ in a 5% CO2 incubator for 14 days.

7. the anti-lymphoma CAR-T drug according to claim 6, wherein: the amount of CD30CAR lentivirus required to infect T cells was calculated according to an MOI of 5.

8. Use of an anti-lymphoma CAR-T medicament according to claim 1, characterized in that: the anti-lymphoma CAR-T drug can inhibit the growth of lymphoma cells, has the effects of inhibiting tumors and prolonging the survival rate.

9. Use of an anti-lymphoma CAR-T medicament according to claim 8, characterized in that: the lymphoma includes human anaplastic large cell lymphoma and peripheral T cell lymphoma.