CN108441482A - The monoclonal antibody of AntiCD3 McAb 0, its hybridoma cell strain, preparation method and application - Google Patents
The monoclonal antibody of AntiCD3 McAb 0, its hybridoma cell strain, preparation method and application Download PDFInfo
- Publication number
- CN108441482A CN108441482A CN201810486811.5A CN201810486811A CN108441482A CN 108441482 A CN108441482 A CN 108441482A CN 201810486811 A CN201810486811 A CN 201810486811A CN 108441482 A CN108441482 A CN 108441482A
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- albumen
- anticd3 mcab
- cell strain
- hybridoma cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57407—Specifically defined cancers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
- G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
- G01N33/57492—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds localized on the membrane of tumor or cancer cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30 CD40 or CD95
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Oncology (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Organic Chemistry (AREA)
- Hospice & Palliative Care (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses the monoclonal antibody of AntiCD3 McAb 0, its hybridoma cell strain, preparation method and applications.The hybridoma cell strain merges acquisition with myeloma cell by the CD30 protein immunizations mouse boosting cell of prokaryotic expression, the monoclonal antibody of the AntiCD3 McAb 0 can specifically identify CD30 albumen, and have compared with strong reactivity with tumour cell, it can be applied to diagnose or treat tumour, it includes in a kind of, for diagnosing or treating in the preparation of tumour, the invention also discloses CD30 albumen pronucleus expressions method, the preparation methods of expressing gene sequence used, the monoclonal antibody of hybridoma cell strain and AntiCD3 McAb 0.The present invention is prepared for 0 hybridoma cell strain of AntiCD3 McAb, can secrete the monoclonal antibody specific of AntiCD3 McAb 0, there is the diagnosing and treating that can be applied to tumour compared with strong reactivity with tumour cell by immune CD30 albumen.
Description
Technical field
The invention belongs to bio-pharmaceutical engineer technology domains, and in particular to the monoclonal antibody of AntiCD3 McAb 0, its hybridoma are thin
Born of the same parents' strain, preparation method and application.
Background technology
Lymphoma peripheral T cell (PeripheralT-cell lymphoma, PTCL) is derived from thymus gland different phase
T cell, biological behaviour and clinical manifestation have a kind of malignant lymphatic tumor of apparent heterogeneity, morbidity to have region and race
Difference, PTCL only accounts for the 6%-7% of NHL in western countries, higher with lymph node lymthoma incidence, including PTCL-U,
ALCL and angioimmunoblastic lymthoma (AlTL)；And it is common in Asian countries PTCL, the 15%-30% of NHL is accounted for, it is outer to tie
Lymthoma is common.Since the incidence of PTCL rises year by year, National Cancer comprehensive network (NCCN) guide arranges for the first time within 2007
Enter PTCL.This shows that western countries have begun to pay close attention to and pay attention to the diagnosing and treating of PTCL.
Numerous studies show that CD30 is one of main tumor markers of lymthoma, and CD30 is a kind of molecular weight 120KDa
Cell surface glycoprotein was reported and is described by Stein the eighties in last century.1992, the cDNA of coding mankind CD30 by
Work(is cloned, to confirm that CD30 belongs to a member of NGFR/TNFR superfamilies.Research find CD30 can participate in cell activation and
In the activation that differentiation, the conduction of the activation signals such as participation NF-kB and T cell are immunized.It is sent out at Hodgkin lymphoma (HL)
During disease, the expression of CD30 can be increased significantly, under the collective effect with other factors, to CD8+ and CD4+Th2 cells
Activation has very strong facilitation the study found that CD30 expression quantity dramatically increases under a variety of pathological states.The correlations such as Smith
Research finds to have in HL what CD30 expressed to increase, Watanabe etc. also by the methods of cell culture, find CD30 including
It expresses and increases in a variety of lymthomas including HL.Many researchs find CD30 high expression in PTCL.Bossard is studied
Report finds that 50% patient's PTCL expression can detect CD30 using immunohistochemical method (IHC) detection.
From first monoclonal antibody drug rituximab list of U.S. Food and Drug Administration (FDA) approval in 1997
Anti- (Rituximab) is for after oncotherapy, the immunization therapy based on antibody to be increasingly becoming one of the Critical policies in the field.Needle
The antibody research of CD30 is started from the early 1990s, there are two types of the drug for being directed to CD30, Iratumumab (SGN- at present
And Brentuximab vedotin (SGN-35) 30).Iratumumab is the treatment antibody for CD30, positive to CD30
Patient HL has certain curative effect.Brentuximab vedotin are CD30 antibody and monomethyl auristatin compositions
The immunoconjugate of microtubule inhibitors, FDA approved Brentuximab vedotin treatment recurrents and intractable CD30 are positive
Patient HL.It is shown in a Brentuximab vedotin treatment PTCL II phase multi-center clinical trial, Overall response rate is
86%, complete remission rate 53%.In another II phase of I/ is studied, researcher has evaluated brentuximab vedotin and uses
Combine in CHOP successive treatments or with CHP safety and the validity of first-line treatment CD30+PTCL.As a result it shows：Patient always delays
Solution rate is 73%-85%, complete remission rate 35%-62%, 62% patient's 3/4 grade of adverse reaction of generation, adverse reaction packet
Include febrile neutropenic.
CD30 is an important molecule target spot of Hematological malignancies, obtain high-titer, high specific AntiCD3 McAb 0 list
Clonal antibody is the premise for researching and developing novel 0 antibody drug conjugates of AntiCD3 McAb, and the successful research and development of the conjugate will provide one for China
New type of lymphoma drug candidate of the kind with independent intellectual property right.
Invention content
The purpose of this part is to summarize some aspects of the embodiment of the present invention and briefly introduce some preferably to implement
Example.It may do a little simplified or be omitted to avoid our department is made in this section and the description of the application and the title of the invention
Point, the purpose of abstract of description and denomination of invention it is fuzzy, and this simplification or omit and cannot be used for limiting the scope of the invention.
Therefore, as one aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides a kind of miscellaneous
Hand over tumor cell strain.
In order to solve the above technical problems, the present invention provides following technical solutions：A kind of hybridoma cell strain, in Wuhan
The deposit number of university's China typical culture collection center is CCTCC NO：C201861.
Preferred embodiment as hybridoma cell strain of the present invention：The hybridoma cell strain is the hybridization of AntiCD3 McAb 0
Tumor cell strain, the CD30 albumen are the recombinant protein of prokaryotic expression, are named as prokaryotic expression CD30 albumen.
Preferred embodiment as hybridoma cell strain of the present invention：The hybridoma cell strain is by prokaryotic expression
CD30 protein immunizations mouse boosting cell merges acquisition with myeloma cell.
As another aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides a kind of AntiCD3 McAb 0
Monoclonal antibody.
In order to solve the above technical problems, the present invention provides following technical solutions：A kind of monoclonal antibody of AntiCD3 McAb 0,
It is that gained is secreted by hybridoma described in claim 1.
The preferred embodiment of monoclonal antibody as AntiCD3 McAb 0 of the present invention：The monoclonal antibody of the AntiCD3 McAb 0
Subclass belongs to IgG1, and the monoclonal antibody of the AntiCD3 McAb 0 can specifically identify CD30 albumen, and have by force with tumour cell
Reactivity, for the monoclonal antibodies against CD 30 of 1mg/ml concentration when CD30 dosages are 2.5ng, antibody titer reaches 1:
640000。
As another aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provide claim 4 or
Application of the monoclonal antibody of AntiCD3 McAb 0 described in 5 in the pharmaceutical preparation for preparing diagnosis or treatment tumour.
As another aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provides a kind of for examining
Disconnected or treatment tumour pharmaceutical preparation comprising the monoclonal antibody of the AntiCD3 McAb 0 described in claim 4 or 5.
As another aspect of the present invention, the present invention overcomes the deficiencies in the prior art, provide claim 4 or
The preparation method of the monoclonal antibody of 5 AntiCD3 McAbs 0.
In order to solve the above technical problems, the present invention provides following technical solutions：The AntiCD3 McAb of claim 4 or 50
The preparation method of monoclonal antibody comprising,
Prokaryotic expression CD30 albumen and purifying：
Design primer builds pET-28a-CD30 prokaryotic expression plasmids, identifies that correct plasmid is transformed into BL21, with
IPTG induction expression proteins；The bacterium solution ultrasonic treatment of IPTG inductions, egg is eluted after taking the supernatant after centrifugation to be combined with Ni fillers
In vain, the CD30 albumen of purifying is obtained, molecular weight of albumen size is about 40KDa；
Prepare hybridoma cell strain：By the purified CD30 protein emulsifyings, multi-point injection add intraperitoneal injection in
The amount of Balb/c mouse, multi-point injection CD30 albumen is 50 μ g/ mouse, and frequency injection is 2 times, and time interval is 2 weeks, and second more
Behind 4 days that point injection plus intraperitoneal injection are completed, the amount of tail vein injection CD30 albumen is 50 μ g/ mouse；Take the spleen of immune mouse thin
Born of the same parents merge to obtain hybridoma with Sp2/0 myeloma cell；It screens positive hybridoma cell strain and expands culture.
The preparation method of monoclonal antibody as AntiCD3 McAb 0 of the present invention further includes,
The preparation of the monoclonal antibody of AntiCD3 McAb 0：The positive hybridoma cell strain that claim 8 obtains is injected in Balb/
So that the mouse is generated ascites in c mouse peritoneals, collects ascites；
The purifying of the monoclonal antibody of AntiCD3 McAb 0：With protein-G column affinity purifications, the monoclonal for obtaining AntiCD3 McAb 0 is anti-
Body.
Beneficial effects of the present invention：It is thin to be prepared for 0 hybridoma of AntiCD3 McAb by immune CD30 prokaryotic expression proteins by the present invention
Born of the same parents' strain, can secrete corresponding monoclonal antibody, can specifically identify CD30 albumen, and have stronger react with tumour cell
Property, it can be applied to the diagnosing and treating of tumour, CD30 monoclonal antibodies prepared by the present invention, the CD30 monoclonals of 1mg/ml concentration
For antibody when CD30 amounts are the holes 2.5ng/, antibody titer reaches 1:640000, monoclonal antibody after purification is reflected through SDS-PAGE
Fixed, band is clear, and no miscellaneous band respectively has clearly band at 50KDa and 25KDa, respectively represents the heavy chain and light chain of antibody.
Description of the drawings
In order to illustrate the technical solution of the embodiments of the present invention more clearly, required use in being described below to embodiment
Attached drawing be briefly described, it should be apparent that, drawings in the following description are only some embodiments of the invention, for this
For the those of ordinary skill of field, without having to pay creative labor, it can also be obtained according to these attached drawings other
Attached drawing.Wherein：
Fig. 1 is identification (SDS-PAGE identifications) figure of CD30 prokaryotic expression proteins.
Fig. 2 is identification (Mass Spectrometric Identification) figure of CD30 prokaryotic expression proteins.
Fig. 3 is reactivity (indirect immunofluorescence) figure of monoclonal antibodies against CD 30 and tumour cell.
Fig. 4 is reactivity (Western blot) figure of monoclonal antibodies against CD 30 and CD30 recombinant proteins.
Fig. 5 be it is purified after CD30 monoclonal antibodies 6B6 (SDS-PAGE identifications) figure.
Specific implementation mode
In order to make the foregoing objectives, features and advantages of the present invention clearer and more comprehensible, with reference to specific embodiment pair
The specific implementation mode of the present invention is described in detail.
Many details are elaborated in the following description to facilitate a thorough understanding of the present invention, still the present invention can be with
Implemented different from other manner described here using other, those skilled in the art can be without prejudice to intension of the present invention
In the case of do similar popularization, therefore the present invention is not limited by following public specific embodiment.
Secondly, " one embodiment " or " embodiment " referred to herein refers to that may be included at least one realization side of the present invention
A particular feature, structure, or characteristic in formula." in one embodiment " that different places occur in the present specification not refers both to
The same embodiment, nor the individual or selective embodiment mutually exclusive with other embodiment.
The hybridoma cell strain of the present invention is deposited on March 20th, 2018 in Wuhan University's China typical culture collection
The heart.Address：Wuhan City, Hubei Province Wuchang District Wuhan University collection；Deposit number：CCTCC NO：C201861.
The preparation method of the monoclonal antibody of AntiCD3 McAb 0, it is characterised in that：Including following two parts：
The prokaryotic expression of CD30 albumen and purifying：
One, design of primers (CD30 protein 14 1-379aa)
PET28a-CD30-F:CGC GGATCCGGCACGGCGCAGAAGAACAC
PET28a-CD30-R:CCC AAGCTTTTACTTCCCCGTGGAGGAGAG
Two, operating procedure
(1) RNA is extracted
The peripheral blood T lymphoma cells of the 1CD30 positives, 1000rpm centrifuge 8min, abandon supernatant, and 1ml Trizol are added, and
It is blown and beaten with 1ml pipette tips until without obvious sediment in lysate, is stored at room temperature 5 minutes repeatedly；
200 μ L chloroforms are added in 2 lysates obtained to step 1, cover tightly centrifuge tube pipe lid, use is lower on hand to vibrate 15s,
12000rpm, 4 DEG C of centrifugation 10min；
3 take out centrifuge tubes, and sample is divided into three layers, transparent supernatant water phase, the lower layer of intermediate white layer and red, carefully
It draws in about 400 μ L phases to another centrifuge tube of transparent supernatant water；
The isometric isopropanols of 400 μ L are added in the 4 supernatant water phases obtained into step 3, gently mixing, is stored at room temperature
10min, 12000rpm, 4 DEG C of centrifugation 10min；
The ethyl alcohol (with the processed water configurations of DEPC) of 1ml 75% is slowly added in 5 careful removal supernatants along tube wall,
12000rpm, 4 DEG C of centrifugation 10min；
6 careful exhaustion supernatants, drying at room temperature precipitate 5min, 30 μ L are added without RNase water dissolution RNA precipitates；
7 survey OD values, a concentration of 155ng/ μ L of RNA.OD260/OD280=1.84
(2) reverse transcription system and program
5xPrimeScript RT Master Mix
(reverse transcriptase 200U/ μ L；125mM MgCl2；12.5mM dNTPs；Olige dT primers) 4 μ L
RNase Free dH2O 1μL
RNA (a concentration of 155ng/ μ L) 2 μ L
37℃ 15min 85℃ 5min 4℃∞
(3) PCR system (high fidelity enzyme amplification) and program
Program：95 DEG C of pre-degeneration 4min；95 DEG C of denaturation 30s, 56 DEG C of annealing 45s, 72 DEG C of extension 50s, if 30 cycles；72
DEG C extend 10min.5 μ LPCR product electrophoresis are taken, electrophoresis is carried out.
(4) glue recycles
1, the Ago-Gel containing target DNA is cut in the UV lamp, 800 μ L Buffer DE-A are added, and mixing is equal
It is heated in 75 DEG C of water-baths after even, 2-3min mixings are primary, until gel piece melts (about 8-10min) completely；
2,400 μ L Buffer DE-B are added, are uniformly mixed；
3, the mixed liquor in aspiration step 2, is transferred to DNA and prepares in pipe, and 12000rpm centrifuges 1min, abandons filtrate, repeats
This step, until mixed liquor has centrifuged；
4, pipe will be prepared to put back into centrifuge tube, adds 500 μ L Buffer W1,12000rpm centrifugation 30s, abandons filtrate；
5, pipe will be prepared to put back into centrifuge tube, adds 700 μ L Buffer W2,12000rpm centrifugation 30s, abandons filtrate；With same
The mode of sample washed once with 700 μ L Buffer W2 again, and 12000rpm centrifuges 1min；
6, pipe will be prepared to put back into centrifuge tube, 12000rpm centrifuges 1min；
7, pipe will be prepared to be placed in clean 1.5ml centrifuge tubes, add 30 μ L Eluent preparing film center, be stored at room temperature
3min, 12000rpm centrifuge 1min eluted dnas；
8, concentration, segment 224ng/ μ L are surveyed.
(5) digestion
(6) cleaning recycling
1, the Buffer PCR-A of 3 times of volumes are added into digestion products, is transferred to and is prepared in pipe after mixing, are managed preparing
It is placed in 2ml centrifuge tubes, 12000rpm centrifuges 1min, abandons waste liquid；
2, pipe will be prepared to put back into 2ml centrifuge tubes, 700 μ L Buffer W2,12000rpm centrifugation 1min is added, abandon useless
Liquid adds 400 μ L Buffer W2,12000rpm and centrifuges 1min；
3,12000rpm skies are from 1min；
4, pipe will be prepared to be placed in clean 1.5ml centrifuge tubes, 20 μ L Eluent are added preparing film center, room temperature is quiet
3min is set, 12000rpm centrifuges 1min eluted dnas；
5, concentration is surveyed, 79ng/ μ L after digestion post-fragment 103ng/ μ L, pet28a plasmid enzyme restrictions.
(7) it connects
16 DEG C of metal bath connections are overnight.
(8) connection product is converted
Connection product is added in competence DH5a, is incubated 30min, 42 DEG C of water-bath heat stress 90s on ice, then put
3-5min on ice is set, 1ml liquid LB is added, 37 DEG C, 100rpm Zhen Oscillating 1h, 5000rpm centrifuge 5min, abandon supernatant, and bacterium solution suspends
It is coated on afterwards on the LB tablets of the resistance containing Kan, 37 degree of overnight incubations.
(9) it identifies
Picking single bacterium is fallen in the LB liquid medium of 3ml or so resistances containing Kan, 37 DEG C, and 200rpm shakes Oscillating overnight incubations
PCR, which is identified and extracted plasmid, send sequencing.
(10) plasmid is converted
It is connect with prokaryotic expression carrier pET28a after the segment digestion of acquisition, the plasmid built send sequencing, sequencing correct
Plasmid be transformed into BL21, method is the same as (eight).
(11) induction expression protein
Picking single bacterium is fallen in the LB liquid medium of 3ml or so resistances containing Kan, 37 DEG C, and the 200rpm Oscillating that shake were cultivated
Night takes in 40 μ L bacterium solutions to the LB liquid medium of the fresh resistances containing Kan of 4ml and to take out 1ml after , Zhen Oscillating 2h and do pair for second day
According to, be added the IPTG of 3 μ L 1M into remaining bacterium solution, 37 DEG C of induction 4h, take out the bacterium solution of control and induction from 12000rpm from
Heart 1min collects bacterium solution, and PBS is washed 2 times, and 60 μ L PBS are added into bacterium solution, and 20 μ L 4x albumen loadings are added in suspension bacteria liquid
Buffer solution, boils 15min, and 4 DEG C of centrifugation 10min of 12000rpm respectively take 10 μ L sample point samples, 80v 2h, coomassie brilliant blue staining
30min rear decolorings.The albumen size about 40KDa of CD30 protein 14s 1-379aa expression.
The development of CD30 monoclonal antibodies：
One, trituration procedure and process
1, animal immune
The CD30 albumen (1mg/ml) for taking 500 μ L purifying, is added 200 μ L ddH2It is complete to add isometric Freund by O
Adjuvant (300 μ L) emulsifies, and the Balb/c mouse that 6 week old or so are immunized are subcutaneously injected in multiple spot；After 2 weeks, same dosage is taken to carry out two
Exempt from, supplementary immunization is primary again after two weeks, antibody titer, while tail vein and intraperitoneal injection 50ug albumen is surveyed after four days, after 3 days
It is dead to take out mouse spleen, the splenocyte for being ground into individual cells is carried out with myeloma cell Sp2/0 with polyethylene glycol (PEG)
Cell fusion.
2, it merges
Feeder cells can prepare in fusion the previous day, take 6-8 week old ICR mouse 2, dislocation of cervical vertebra is lethal, is put in 75%
5-10min is sterilized in alcohol, is fixed on disk, the sterile abdominal cut skin in super-clean bench.HAT choosings are drawn with asepsis injector
Culture solution 20ml injection mouse peritoneals are selected, abdomen is gently rubbed with cotton ball soaked in alcohol, draws back culture medium.It is added in 10ml HAT culture solutions,
It spreads into 10 piece of 96 porocyte culture plates, 100 holes μ L/, 37 DEG C, is cultivated in 5%CO2 cell incubators.
Fusion the last week recovery Sp2/0 cells, 37 DEG C, 5%CO2Secondary culture in incubator.Exponential phase will be in
Cell collect into centrifuge tube, cell is diluted to 10 by cell count6A/ml is spare.
3 days Balb/c mouse of booster immunization, Culling heart blood is taken to prepare positive serum, cervical dislocation is put to death, and 75% alcohol disappears
Malicious 5min, in the sterile taking-up spleen of superclean bench, Xian Di for several times, removes connective tissue in sterilized petri dishes.Spleen is placed on
On micropore copper mesh, fresh DMEM is added, gently spleen is ground to as unicellular with grinding rod.Splenocyte in plate is hanged
Liquid is transferred in 10ml centrifuge tubes, and 1000r/min centrifuges 10min, collects splenocyte.
Immune mouse spleen cell and Sp2/0 cells are pressed into cell quantity 4:1 mixing, is added in the fusion pipe of 50ml, 1000r/
Min centrifuges 10min, abandons supernatant, gently rubbing in the palm of the hand makes two kinds of cells mix well；Then it under 37 DEG C of water-baths, will preheat
Good 1ml PEG are added in 60s in fusion pipe, and fast after first slow, side edged is gently agitated for.Exist soon after elder generation is slow immediately after
Nonreactive is added in 90s without blood DMEM 30ml, terminates reaction.37 DEG C of water-bath 10min, rear 1000r/min centrifuge 10min, abandon
Clearly, precipitation is hanged with HAT, in the HAT selection culture solutions of 20% calf serum of the mixing to 30ml containing 37 DEG C of preheatings, is spread into
In 96 porocyte plates added with feeder cells, culture plate is put into 37 DEG C, 5%CO by 100 holes μ L/2Incubator culture.It will after 5d
Liquid is partly changed to cell plates with fresh HAT culture mediums, liquid is changed entirely with HT culture mediums after 10 days.
To continuously be detected twice in 96 orifice plates is positive cell expansion culture, and sub- gram is carried out using limiting dilution assay
It is grand：The preparation for first carrying out feeder cells according to the method, instills in 96 orifice plates, vacates first row.It will be positive miscellaneous with HT culture mediums
It hands over oncocyte to blow afloat, takes 100 μ L to be counted, doubling dilution is carried out in first row, be allowed in every 10ml culture mediums containing about 100
A cell；It softly blows even rear be added to be covered in the culture plate of feeder cells, 100 holes μ L/, 37 DEG C, 5%CO2In cell incubator
Culture.Count clone's number in cell hole after about 7 days, the culture medium for marking and renewing, wait for cell be paved with entire bottom hole 1/3~
It is detected when 1/2.By 2-3 time clonings, when all cell holes of 96 orifice plates are the positive, you can be enlarged culture, singling
It freezes.
The positive hybridoma for determining singling of detection is expanded and cultivates and freezes.Detailed process is as follows：To grow it is vigorous,
Hybridoma in good condition is gently blown down from cell bottle with nonreactive without blood DMEM, and 1000 r/min centrifuge 5min, discard
Supernatant.Serum-free frozen stock solution is added, is dispensed into cell cryopreservation tube after cell is dispelled.By cryopreservation tube be put into freezing storing box be placed in-
In 70 DEG C of refrigerators, cryopreservation tube is transferred in liquid nitrogen after one day, is made a record.
3, the preparation of antibody ascites
Induce ascites method in vivo：Balb/c female rat of 10 week old through production is taken, sterilized liquid paraffin, 0.5 ml/ is injected intraperitoneally
Only；7d pneumoretroperitoneums injection culture to logarithmic phase hybridoma, 1~2 × 106A cell/only.Observation is paid attention to daily, is waited for small
After apparent protuberance occurs in mouse abdomen, lower abdomen skin is sterilized with 75% cotton ball soaked in alcohol, abdominal cavity is pierced into No. 16 syringe needles, collects abdomen
Water.After ascites regeneration accumulation, collect again.3000 r/min of ascites of collection is centrifuged into 10min, supernatant is taken, uses mineral wool
After filtering, packing, -70 DEG C of preservations.
4, the purifying of monoclonal antibody
By ascites with Binding Buffer (pH8.0):NaCl 0.15M+Na2HPO4 20mM make 1:1 dilution；In pillar
In be previously added 1ml Binding Buffer, transfer 1ml protein-G resins drain off, to pillar with 5ml Binding
Buffer is balanced；10ml can be once added in sample-adding product to pillar, started pillar (1ml/min flow velocity mistakes after acting on 10min
Column)；30ml Binding Buffer rinse (10ml × 3 time)；10-15ml Elution Buffer(pH2.5-3.0)：
Citric acid 0.1M wash pillar and are eluted (to be anti-because Elution Buffer pH peracid cause albuminous degeneration, needs to use
8.5 1M Tris-HCl tune pH of pH are to 7.4)；It regenerates (10ml Elution Buffer are washed)；With 5ml Binding
Buffer is balanced 2 times.
5, the identification of monoclonal antibody subclass
According to SIGMA kit specifications, the subgroup identification of monoclonal antibody is carried out in the method for capturing ELISA, it is specific as follows：It will
Monoclonal antibody subgroup identification reagent 1:It after 1000 dilutions, is added in enzyme mark hole, 100 holes μ L/, 2 holes/sample, 37 DEG C of incubation 1h；PBST is washed
Three times, it pats dry；After ascites is suitably diluted in adding hole, 100 holes μ L/,；PBST is washed three times, is patted dry；HRP enzyme mark sheep anti mouses
IgG secondary antibodies are with 1:It is added after 600 dilutions, 100 holes μ L/ are incubated at room temperature 30min；Develop the color 10~20min.With OD450Readings is apparent
It is the affiliated subclass type of monoclonal antibody higher than subclass reagent added by other holes.
The result that the partial hybridization tumor of acquisition is screened：
1, mice serum titration is as follows：
2, screening (ELISA method screening) is as follows after merging：
The present invention is further described below in conjunction with the accompanying drawings.
The main operational steps of invention are：CD30 prokaryotic expression plasmids are built, plasmid is transformed into competence BL21,
IPTG inducible proteins are expressed, Ni column purification albumen.By CD30 protein immunization Balb/c mouse, pass through the multiple cell of hybridoma technology
Fusion filters out the hybridoma cell strain of energy stably excreting antibody using Elisa, and ascites is purified through protein-G, the list of gained
Clonal antibody carries out titration and subgroup identification.Through screening one plant of obtained monoclonal cell that can be reacted with tumour cell
Strain, is named as 6B6 (subclass IgG1).
Material and source：
Experimental animal：Balb/c mouse and ICR mouse are purchased from Yangzhou University's comparative medicine center.
Albumen：CD30 albumen builds induced expression and purifying by this laboratory.
Reagent：Sheep anti-mouse igg fluorescence secondary antibody and Subclass of antibody identification kit are purchased from Sigma companies；protein-G
It is purchased from invitrigen companies.
One, CD30 albumen pronucleus expressions and purifying
1) CD30 albumen pronucleus expressions
Design prokaryotic expression CD30 protein primers, sense primer：
CGCGGATCCGGCACGGCGCAGA AGAACAC, downstream primer
CCCAAGCTTTTACTTCCCCGTGGAGGAGAG, primer is with RT-PCR methods from the peripheral blood T lymphoma cells of the CD30 positives
Fishing takes CD30 gene extracellular fragment region segments (141aa-379aa), after the segment digestion of acquisition with prokaryotic expression carrier pET28a
Connection product overnight, is transformed into competence DH5a, bacterium solution is coated on the resistance containing kan by connection, 16 DEG C of metal bath for second day
On solid LB tablets, 37 DEG C of overnight incubations, single bacterium drops down onto in the LB liquid mediums of 3ml resistances containing Kan on picking LB tablets, and 37
DEG C, 200rpm shakes Oscillating overnight incubations, and primer PCR identifies the bacterium solution being incubated overnight, positive bacterium solution 1:100, which are transferred to 20ml, contains Kan
In the LB liquid medium of resistance, 37 DEG C of overnight incubations, upgrading grain in the bacterium solution of 37 DEG C of overnight incubations of 20ml, plasmid is through above-mentioned
Sequencing is sent after primer PCR identification is correct, correct plasmid is sequenced and is transformed into competence BL21, bacterium solution is coated on resistance containing kan
Solid LB tablets on, 37 DEG C of overnight incubations, single bacterium drops down onto in the LB liquid mediums of 3ml resistances containing Kan on picking LB tablets,
37 DEG C, 200rpm Zhen Oscillating overnight incubations；Above-mentioned primer PCR identifies the bacterium solution being incubated overnight, and is resisted containing kan with oese after correct
Three line partitions on the solid LB tablets of property, 37 DEG C of overnight incubations.Picking single bacterium drops down onto the LB liquid medium of 3ml resistances containing Kan
In, 37 DEG C, 200rpm Zhen Oscillating overnight incubations take 2ml bacterium solutions to the LB Liquid Cultures of the fresh resistances containing Kan of 200ml for second day
In base, 37 DEG C, 200rpm Zhen Oscillating cultures are taken out 1ml and are compared, into remaining bacterium solution when bacterium solution OD600 values reach 0.6 or so
The IPTG of 100ul 1M is added, 37 DEG C of induction 4h, thalline were collected by centrifugation for induction bacterium solution.
2) CD30 protein purifications and identification
The bacterium solution PBS being collected by centrifugation is washed twice, and ultrasound 20min after 30ml lysis buffer suspension thallines is added, and is surpassed
Sound is complete, and 4 DEG C of 12000rpm centrifuge 20min, take supernatant, are filtered with 0.22um or 0.45um disposable filters, are added in precipitation
5ml PBS suspend, by Ni fillers with 11) in filtered fluid mix, 4 DEG C are waved in conjunction with 1h, and treated that mixed liquor is transferred to egg by general
In white purification column, 5min is stood, allows its liquid to flow down naturally, then foreign protein is washed with 10-15ml lysis buffer, used
Wahing buffer wash foreign protein, until a concentration of 0mg/ml of albumen in eluent, adds 2ml elution buffer to elute
Target protein adds 1ml every time later, until albumen wash-out is clean, E-1 on the protein labeling of elution, E-2, E-3 etc., elution
Albumen surveys concentration, and -80 DEG C of preservations, not freeze repeatedly after marking, and thalline were collected by centrifugation for control bacterium solution, after PBS is washed twice
60ul PBS are added to suspend, add albumen sample-loading buffer to boil, precipitation suspension, protein eluate respectively take 60ul to add on albumen
Sample buffer solution boils, and the above-mentioned samples of 10ul is respectively taken to run SDS-PAGE, and coomassie brilliant blue staining rear decoloring is taken pictures, and is sent after albumen rubber tapping
Mass Spectrometric Identification.The result is shown in Figure 1 and Fig. 2.
Two, the development of monoclonal antibodies against CD 30 6B6
1) preparation of monoclonal antibody
200ul ddH are added in the CD30 albumen (1mg/ml) for taking 50ul to purify2O adds isometric Freund and helps completely
Agent (300ul) emulsifies, and the Balb/c mouse that 6 week old or so are immunized are subcutaneously injected in multiple spot；After 2 weeks, takes same dosage to carry out two and exempts from,
Supplementary immunization is primary again after two weeks, and antibody titer, while tail vein and intraperitoneal injection 50ug albumen are surveyed after four days, is put to death after 3 days
Mouse spleen is taken out, the splenocyte for being ground into individual cells and myeloma cell Sp2/0 are subjected to cell with polyethylene glycol (PEG)
Positive cell clone is screened in fusion.
The positive hybridoma for determining singling of detection is expanded and cultivates and freezes.Detailed process is as follows：To grow it is vigorous,
Hybridoma in good condition is gently blown down from cell bottle with nonreactive without blood DMEM, and 1000 r/min centrifuge 5min, discard
Supernatant.Serum-free frozen stock solution is added, is dispensed into cell cryopreservation tube after cell is dispelled.By cryopreservation tube be put into freezing storing box be placed in-
In 70 DEG C of refrigerators, cryopreservation tube is transferred in liquid nitrogen after one day, is made a record.
Induce ascites method in vivo：Balb/c female rat of 10 week old through production is taken, sterilized liquid paraffin, 0.5 ml/ is injected intraperitoneally
Only；7d pneumoretroperitoneums injection culture to logarithmic phase hybridoma, 1~2 × 106A cell/only.Observation is paid attention to daily, is waited for small
After apparent protuberance occurs in mouse abdomen, lower abdomen skin is sterilized with 75% cotton ball soaked in alcohol, abdominal cavity is pierced into No. 16 syringe needles, collects abdomen
Water.After ascites regeneration accumulation, collect again.3000 r/min of ascites of collection is centrifuged into 10min, supernatant is taken, uses mineral wool
After filtering, packing, -70 DEG C of preservations.
2) purifying of monoclonal antibody 6B6
By ascites with Binding Buffer (pH8.0):NaCl 0.15M+Na2HPO4 20mM make 1:1 dilution；In pillar
In be previously added 1ml Binding Buffer, transfer 1ml protein-G resins drain off, to pillar with 5ml Binding
Buffer is balanced；10ml can be once added in sample-adding product to pillar, started pillar (1ml/min flow velocity mistakes after acting on 10min
Column)；30ml Binding Buffer rinse (10ml × 3 time)；10-15ml Elution Buffer(pH2.5-3.0)：
Citric acid 0.1M wash pillar and are eluted (to be anti-because Elution Buffer pH peracid cause albuminous degeneration, needs to use
8.5 1M Tris-HCl tune pH of pH are to 7.4)；It regenerates (10ml Elution Buffer are washed)；With 5ml Binding
Buffer is balanced 2 times.The prokaryotic expression CD30 albumen of the monoclonal antibody 6B6 purifying of purifying is carried out to the survey of antibody titer
Fixed, for the monoclonal antibody 6B6 of 1mg/ml concentration when CD30 amounts are the holes 2.5ng/, antibody titer reaches 1:640000.Dan Ke after purification
Grand antibody identifies that band is clear through SDS-PAGE, no miscellaneous band, respectively have at 50KDa and 25KDa clearly band (such as Fig. 5 institutes
Show), respectively represent the heavy chain and light chain of antibody.
1 monoclonal antibody 6B6 purified antibodies potency of table
3) identification of monoclonal antibody 6B6 subclass
According to SIGMA kit specifications, the subgroup identification of monoclonal antibody is carried out in the method for capturing ELISA, it is specific as follows：It will
Monoclonal antibody subgroup identification reagent 1:It after 1000 dilutions, is added in enzyme mark hole, 100 holes μ l/, 2 holes/sample, 37 DEG C of incubation 1h；PBST is washed
Three times, it pats dry；After ascites is suitably diluted in adding hole, 100 holes μ l/,；PBST is washed three times, is patted dry；HRP enzyme mark sheep anti mouses
IgG secondary antibodies are with 1:It is added after 600 dilutions, 100 holes μ l/ are incubated at room temperature 30min；Develop the color 10~20min.With OD450Readings is apparent
It is the affiliated subclass type of monoclonal antibody higher than subclass reagent added by other holes.Identified, it is sub- that monoclonal antibody 6B6 belongs to IgG1 antibody
Class.
4) indirect immunofluorescence identification monoclonal antibody and tumour cell reactivity
Tumour cell is spread in 96 orifice plates, after it covers with single layer, is washed three times with PBS, 5min/ times, is added -20 DEG C in advance
15min is fixed at 4 DEG C cold of methanol, after PBS is washed three times, the 0 monoclonal antibody 6B6 of AntiCD3 McAb that 50 μ l dilute 1000 times is taken to be added
Kong Zhong, 37 DEG C are incubated 1h, and PBS is washed three times, is protected from light addition 1:200 diluted fluorescence secondary antibodies, 37 DEG C of incubation 1h, after PBS is washed three times
It dries, in fluorescence microscopy microscopic observation.As a result see Fig. 3,6B6 is in 1*10 for CD30 monoclonal antibodies-4Under the concentration of mg/ml, still with
Tumour cell has very strong reactivity.
5) reactivity of Western blot identification monoclonal antibody and recombinant C D30 albumen
It is formulated according to table 2 and prepares separation gel.(unit：Ml, total amount：7.5ml/ glue)
Table 2 detaches glue formula (15ml)
| Resolving gel concentration | 10% |
| H2O | 6ml |
| 1.5M Tris-HCl (pH=8.8) | 3.75ml |
| 10%SDS | 150μl |
| 10%AP | 75μl |
| TEMED | 7.5μl |
| 30%Acry/bis | 5ml |
| Protein isolate size (KD) | 20~80 |
It is slowly added to one layer of distilled water (about 1ml) on separation gel, flattens separation gel, being put in 30 DEG C makes its solidification.It waits for point
After collecting from gelling, concentration glue is prepared, is shown in Table 3.(unit：Ml, total amount：2.5ml/ glue)
Table 3 concentrates glue formula (5ml)
| Concentrate gum concentration | 4% |
| H2O | 3.6ml |
| 1M Tris-HCL (pH=6.8) | 600μl |
| 10%SDS | 50μl |
| 10%APS | 25μl |
| TEMED | 5μl |
| 30%Acry/bis | 670μl |
Concentration glue is rapidly inserted into preprepared comb after adding, and 30 DEG C are waited for its solidification.5 times of sample-loading buffers and sample
Mixing, 100 DEG C of metal baths or water-bath 10min, 12000r/min centrifuge 5min.It after gelling is solid, is put into electrophoresis tank, electricity is added
Swimming buffer solution did not had gel, vertically took out comb, loading, electrophoresis.Sample uses 60V voltages in concentrating glue, until sample electrophoresis
To interface, adjust voltage to 100V, glue surface will be gushed out by continuing electrophoresis to bromophenol blue.After electrophoresis, take out gel, go from
It is rinsed in sub- water, removes concentration glue；According to glue size clip with homalographic 6 layers of nitrocellulose filter and filter paper, pre-
30min is thoroughly impregnated in cold transfer buffer solution；According to -3 layers of filter paper-gel of (cathode) sponge--3 layers of nitrocellulose filter filter
The sequence of paper-sponge (anode) installs transfer device, marks, cannot there is bubble in each layer；Transfer buffer solution is added, it will be electric
Swimming slot is placed in ice bath transfers 100min with 200mA electric currents.After transfer, transfer device is removed, is rinsed with deionized water
Pvdf membrane is added confining liquid rocked at room temperature and closes 2h；5 times, each 5min are washed with TBST, the list that addition has been diluted with confining liquid
Anti- and film is incubated with, 4 DEG C of overnight or room temperature 1h.It is washed 5 times with TBST, each 5min.It is added 1:8000 diluted horseradish mistakes
The sheep anti-mouse igg secondary antibody of oxide enzyme label, is incubated at room temperature 1h.It is washed 5 times with TBST, each 5min.Film transfer is matched to fresh
Avoid light place 1-3min in the developer solution of system, develops in scotography instrument.As a result see Fig. 4, monoclonal antibody 6B6 is in 5*10- 3Under the concentration of mg/ml, there is very strong reactivity with recombinant C D30 albumen.
It should be noted that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although with reference to preferable
Embodiment describes the invention in detail, it will be understood by those of ordinary skill in the art that, it can be to the technology of the present invention
Scheme is modified or replaced equivalently, and without departing from the spirit of the technical scheme of the invention and range, should all be covered in this hair
In bright right.
Claims (9)
1. a kind of hybridoma cell strain is CCTCC in the deposit number of Wuhan University's China typical culture collection center
NO：C201861.
2. hybridoma cell strain according to claim 1, it is characterised in that：The hybridoma cell strain is the miscellaneous of AntiCD3 McAb 0
It is the recombinant protein of prokaryotic expression to hand over tumor cell strain, the CD30 albumen, is named as prokaryotic expression CD30 albumen.
3. hybridoma cell strain according to claim 1 or 2, it is characterised in that：The hybridoma cell strain is to pass through original
The CD30 protein immunizations mouse boosting cell of nuclear expression merges acquisition with myeloma cell.
4. a kind of monoclonal antibody of AntiCD3 McAb 0, it is characterised in that：Gained is secreted by hybridoma described in claim 1.
5. the monoclonal antibody of AntiCD3 McAb 0 according to claim 4, it is characterised in that：The monoclonal antibody of the AntiCD3 McAb 0
Subclass belong to IgG1, the monoclonal antibody of the AntiCD3 McAb 0 can specifically identify CD30 albumen, and have with tumour cell
Strong reactivity, for the monoclonal antibodies against CD 30 of 1mg/ml concentration when CD30 dosages are 2.5ng, antibody titer reaches 1:
640000。
6. the monoclonal antibody of the AntiCD3 McAb 0 described in claim 4 or 5 is in the pharmaceutical preparation for preparing diagnosis or treatment tumour
Using.
7. a kind of pharmaceutical preparation for diagnosing or treating tumour, it is characterised in that：Including anti-described in claim 4 or 5
The monoclonal antibody of CD30.
8. the preparation method of the monoclonal antibody of the AntiCD3 McAb of claim 4 or 50, it is characterised in that：Including,
Prokaryotic expression CD30 albumen and purifying：
Design primer is built pET-28a-CD30 prokaryotic expression plasmids, identifies that correct plasmid is transformed into BL21, lured with IPTG
Lead expression albumen；The bacterium solution ultrasonic treatment of IPTG inductions, albumen is eluted after taking the supernatant after centrifugation to be combined with Ni fillers, is obtained
The CD30 albumen of purifying, molecular weight of albumen size are about 40KDa；
Prepare hybridoma cell strain：By the purified CD30 protein emulsifyings, multi-point injection adds intraperitoneal injection in Balb/c
The amount of mouse, multi-point injection CD30 albumen is 50 μ g/ mouse, and frequency injection is 2 times, and time interval is 2 weeks, second of multi-point injection
Behind add intraperitoneal injection completion 4 days, the amount of tail vein injection CD30 albumen is 50 μ g/ mouse；Take the splenocyte of immune mouse with
Sp2/0 myeloma cell merges to obtain hybridoma；It screens positive hybridoma cell strain and expands culture.
9. preparation method as claimed in claim 8, it is characterised in that：Further include,
The preparation of the monoclonal antibody of AntiCD3 McAb 0：It is small that the positive hybridoma cell strain that claim 8 obtains is injected in Balb/c
Mouse is intraperitoneal to make the mouse generate ascites, collects ascites；
The purifying of the monoclonal antibody of AntiCD3 McAb 0：With protein-G column affinity purifications, the monoclonal antibody of AntiCD3 McAb 0 is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810486811.5A CN108441482A (en) | 2018-05-21 | 2018-05-21 | The monoclonal antibody of AntiCD3 McAb 0, its hybridoma cell strain, preparation method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810486811.5A CN108441482A (en) | 2018-05-21 | 2018-05-21 | The monoclonal antibody of AntiCD3 McAb 0, its hybridoma cell strain, preparation method and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108441482A true CN108441482A (en) | 2018-08-24 |
Family
ID=63204155
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810486811.5A Pending CN108441482A (en) | 2018-05-21 | 2018-05-21 | The monoclonal antibody of AntiCD3 McAb 0, its hybridoma cell strain, preparation method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108441482A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110559430A (en) * | 2019-10-21 | 2019-12-13 | 江苏省肿瘤医院 | Anti-lymphoma CAR-T medicine and application thereof |
| CN110628823A (en) * | 2019-10-21 | 2019-12-31 | 江苏省肿瘤医院 | CD30CAR lentiviral expression vector and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0657533A1 (en) * | 1993-10-30 | 1995-06-14 | Biotest Pharma Gmbh | Monoclonal antibodies with high cytotoxicity against the human CD16 antigen, and bispecific monoclonal antibodies using such monoclonal antibodies and the CD30-HRS-3 antibody |
| CN1638800A (en) * | 2002-01-09 | 2005-07-13 | 米德列斯公司 | Human monoclonal antibodies against CD30 |
| CN104017773A (en) * | 2014-05-08 | 2014-09-03 | 南京工业大学 | Bel/fu-resistant monoclonal antibody and hybridoma cell strain |
| CN106636007A (en) * | 2016-12-09 | 2017-05-10 | 新乡学院 | Anti-USP2a protein monoclonal antibody hybridoma cell, anti-USP2a monoclonal antibody generated from anti-USP2a protein monoclonal antibody hydridoma cell and application |
-
2018
- 2018-05-21 CN CN201810486811.5A patent/CN108441482A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0657533A1 (en) * | 1993-10-30 | 1995-06-14 | Biotest Pharma Gmbh | Monoclonal antibodies with high cytotoxicity against the human CD16 antigen, and bispecific monoclonal antibodies using such monoclonal antibodies and the CD30-HRS-3 antibody |
| CN1638800A (en) * | 2002-01-09 | 2005-07-13 | 米德列斯公司 | Human monoclonal antibodies against CD30 |
| CN104017773A (en) * | 2014-05-08 | 2014-09-03 | 南京工业大学 | Bel/fu-resistant monoclonal antibody and hybridoma cell strain |
| CN106636007A (en) * | 2016-12-09 | 2017-05-10 | 新乡学院 | Anti-USP2a protein monoclonal antibody hybridoma cell, anti-USP2a monoclonal antibody generated from anti-USP2a protein monoclonal antibody hydridoma cell and application |
Non-Patent Citations (4)
| Title |
|---|
| HIROMI MUTA ET AL.: "CD30: from basic research to cancer therapy", 《IMMUNOL RES》 * |
| 吴俊英等: "《临床免疫学检验》", 31 March 2014, 华中科技大学出版社 * |
| 杜欣: "抗CD16/CD30双特异性单克隆抗体治疗难治性霍奇金氏病", 《国外医学输血及血液学分册》 * |
| 许晓光等: "抗CD30L/CD153单克隆抗体的制备与初步鉴定", 《细胞与分子免疫学杂志》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110559430A (en) * | 2019-10-21 | 2019-12-13 | 江苏省肿瘤医院 | Anti-lymphoma CAR-T medicine and application thereof |
| CN110628823A (en) * | 2019-10-21 | 2019-12-31 | 江苏省肿瘤医院 | CD30CAR lentiviral expression vector and preparation method and application thereof |
| CN110628823B (en) * | 2019-10-21 | 2022-12-27 | 江苏省肿瘤医院 | CD30CAR lentivirus expression vector and preparation method and application thereof |
| CN110559430B (en) * | 2019-10-21 | 2023-07-11 | 江苏省肿瘤医院 | Anti-lymphoma CAR-T medicine and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Solomon et al. | Calcifying epithelial odontogenic (Pindborg) tumor-associated amyloid consists of a novel human protein | |
| CN112501131B (en) | anti-IMP (anti-IMP) carbapenemase hybridoma cell strain, monoclonal antibody and application | |
| AU669474B2 (en) | T-cadherin adhesion molecule | |
| JPH07505528A (en) | Antibodies against αvβ3 integrin | |
| WO2021104326A1 (en) | Monoclonal antibody for detection of car-t cells, kit and application | |
| CN113416710B (en) | Mouse anti-MCR-1 protein hybridoma cell strain, monoclonal antibody and application | |
| CN108329378A (en) | Senecan paddy virus VP 1 albumen, encoding gene, hybridoma cell strain and monoclonal antibody and its application | |
| CN108441482A (en) | The monoclonal antibody of AntiCD3 McAb 0, its hybridoma cell strain, preparation method and application | |
| CN117924478A (en) | Chimeric antibodies and methods of production for treating amyloid deposition disease | |
| CN110551213A (en) | Anti-filovirus monoclonal neutralizing antibody and preparation method and application thereof | |
| CN114250203B (en) | Mouse anti-MCR-1/MCR-2 protein hybridoma cell strain, monoclonal antibody and application | |
| CN113583122B (en) | Anti-human SEMA4D antibody and preparation method and application thereof | |
| CN113122617B (en) | Method and system for screening specific BCR/TCR (binary-coded decimal) and system thereof | |
| CN110511277B (en) | anti-HSP 90 monoclonal antibody and application thereof | |
| CN109535255B (en) | Anti-human CD26 antibody and application thereof in detection kit | |
| CN114349852B (en) | anti-H3N 2 influenza virus hemagglutinin protein monoclonal antibody ZJU32-01 and application thereof in detection | |
| CN115838416A (en) | Antibody for African swine fever CD2v and application thereof | |
| CN114671953B (en) | Single domain anti-Nectin-4 antibodies | |
| JPH07504399A (en) | Treatment for chronic rheumatoid arthritis based on T-cell receptors | |
| CN113527479B (en) | Antibody or antibody fragment specifically binding to voltage-gated sodium ion channel alpha subunit Nav1.7 | |
| DK172758B1 (en) | Monoclonal antibody to prosomal proteins, immortalized cell line producing the antibody, method of detection | |
| CN108624602A (en) | One plant with blocking activity anti-Nipah virus G-protein monoclonal antibody and its application | |
| CN1826137A (en) | Inducible ligand for alpha1beta1 integrin and uses | |
| CN108794625A (en) | A kind of monoclonal antibody of anti-EV-D68 viruses and its preparation and application | |
| Forrest | Monoclonal antibodies: nematodes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |