CN110551807A - Method for identifying important microorganisms in universal edible fungus fermentation material - Google Patents

Abstract

The invention provides a general method for identifying important microorganisms in edible fungus fermentation materials, which comprises the following steps: s1, sampling and culturing: collecting secondary materials from the secondary fermentation materials of the edible fungi, and activating; s2, screening and purifying: culturing the activated secondary material discharged from the warehouse by adopting different culture media, and inoculating for purification culture after the radius of a bacterial colony is enlarged to 1 cm; s3, identification: and extracting genome DNA of the colonies after the purification culture, then carrying out PCR amplification, recovering the obtained product, carrying out DNA sequencing, and comparing to obtain the identification result of each colony. The method can simultaneously obtain various microorganisms of different types, has accurate and reliable identification result, and lays a foundation for the research of the action of important microorganisms in the edible fungus fermentation material.

Description

method for identifying important microorganisms in universal edible fungus fermentation material

Technical Field

the invention relates to the technical field of microorganism separation, purification and identification in edible fungus culture materials, in particular to a general identification method of important microorganisms in edible fungus fermentation materials.

background

along with the improvement of living standard of people, the market demands for edible fungi more and more, a large amount of culture materials are required to be prepared for producing the edible fungi, and the prepared culture materials contain a large amount of beneficial microorganisms, wherein some important microorganisms can normally grow only in the fermentation process of the culture materials, and some important microorganisms can be artificially cultured after separation and purification. After a certain microorganism is successfully separated and purified, identification is carried out through NCBI species similarity comparison, and the effect of the microorganism in the fermentation process of the edible fungus culture material can be researched after the identification is finished.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a universal method for identifying important microorganisms in edible fungus fermentation materials.

The purpose of the invention is realized by the following technical scheme:

The invention provides a general method for identifying important microorganisms in edible fungus fermentation materials, which comprises the following steps:

S1, sampling and culturing: collecting secondary materials from the secondary fermentation materials of the edible fungi, and activating;

s2, screening and purifying: culturing the activated secondary material discharged from the warehouse by adopting different culture media, and inoculating for purification culture after the radius of a bacterial colony is enlarged to 1 cm;

S3, identification: and extracting genome DNA of the colonies after the purification culture, then carrying out PCR amplification, recovering the obtained product, carrying out DNA sequencing, and comparing to obtain the identification result of each colony.

Preferably, the edible fungus is agaricus bisporus.

Preferably, in step S1, the activation conditions are: and packaging the secondary materials discharged from the warehouse, and then placing the packaged secondary materials in an incubator with the temperature of 55 ℃ and the humidity of about 60 percent for activation for 12 hours.

preferably, in step S2, the culture medium includes PGA culture medium, beef extract peptone culture medium, bangla red culture medium, modified No.1 culture medium.

Preferably, the PGA medium is prepared by: dissolving peptone 5.0g, glucose 10.0g, yeast powder 1.0g, calcium carbonate 3g, sodium chloride 5g, and agar 15g in 1L water amount in water, and sterilizing at 121 deg.C for 20 min;

The preparation method of the beef extract peptone medium comprises the following steps: dissolving 5g of beef extract, 10.0g of peptone, 5.0g of sodium chloride and 18.0g of agar in distilled water based on the amount of 1L of water, and adjusting the pH value to 7.0-7.2; sterilizing at 121 deg.C for 20 min;

The preparation method of the Bengal red culture medium comprises the following steps: based on the amount of 1L of water, 5.0g of peptone, 10.0g of glucose, 1.0g of monopotassium phosphate, 0.5g of magnesium sulfate, 20.0g of agar, 0.033g of Bengal and 0.1g of chloramphenicol are dissolved in distilled water and sterilized at 121 ℃ for 30 min;

The preparation of the improved Gao's 1 culture medium comprises the following steps: based on the amount of 1L water, 20.0g of soluble starch, 1.0g of potassium nitrate, 0.5g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate, 0.01g of ferrous sulfate, 0.5g of sodium chloride and 18.0g of agar are dissolved in distilled water, and the pH is adjusted to 7.2-7.4; when in preparation, the soluble starch is added with a small amount of cold distilled water to be mixed into paste, and then is added into boiling distilled water; sterilizing at 121C for 20 min; for clinical application, 3% potassium dichromate was added to 300mL of the medium in an amount of 1 mL.

Preferably, in step S2, when the culture medium is PGA culture medium or beef extract peptone culture medium, the culture method is as follows:

Immersing 5 to 10 g of secondary materials taken out of the warehouse in sterile water, oscillating, absorbing a certain amount of leachate of the secondary materials taken out of the warehouse, diluting and releasing the leachate to six concentration gradients of 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, 10 ^-5 and 10 ^-6, and respectively coating bacterial liquid with 6 concentrations on a PGA culture medium and a beef extract peptone culture medium;

And (3) inverting the culture medium coated with the bacterial liquid into an incubator at 55 ℃ and with the humidity of 60-80%, and culturing at constant temperature.

preferably, in step S2, when the culture medium is a bangladesh red culture medium, modified No.1 culture medium, the culture method is as follows:

Inoculating 1.5-2.5 cm of the secondary material in the bin on the culture medium, placing in an incubator at 55 deg.C and humidity of 70%, and culturing at constant temperature.

Preferably, in step S3, the method for extracting genomic DNA is as follows:

A. adding the purified thalli into a buffer GA, and oscillating to obtain a suspension;

B. adding a protease K solution into the suspension, and uniformly mixing;

C. Adding a buffer solution GB into the solution obtained in the step B, oscillating, standing for a period of time, and then centrifuging to remove water drops;

D. adding absolute ethyl alcohol into the solution obtained in the step C, and shaking up;

E. d, adding the mixture obtained in the step D into an adsorption column, and centrifuging to remove waste liquid;

F. Then adding a buffer GD (GD), and centrifuging to remove waste liquid;

G. Adding rinsing liquid, and centrifuging to remove waste liquid;

H. Repeating the step E-G, centrifuging the obtained centrifugate again to remove waste liquid, and standing at room temperature;

I. And D, dropwise adding an elution buffer TE into the adsorption column treated in the step H, standing at room temperature, centrifuging, and collecting the solution.

Preferably, in step S3, the sequences of the primer pairs used for PCR amplification are shown as SEQ ID NO.1 and SEQ ID NO. 2.

Compared with the prior art, the invention has the following beneficial effects:

the invention prepares different culture mediums capable of screening out bacteria, fungi and actinomycetes, coats a culture material leachate on the culture mediums, cultures in a specific environment (determined according to the growth habit of important microorganisms) to screen out single colonies, purifies the single colonies, extracts genome DNA from the purified strains, then performs genome PCR amplification, recovers PCR products by using an AxyPrep DNA gel recovery kit, extracts the PCR products after each strain purification, performs DNA sequencing by using a sequencer ABI3730-XL, and finally compares the spliced sequence file with the data in an NCBI nucleic acid database by using an NCBI Blast program to obtain species information with the maximum sequence similarity with the species to be detected, namely the identification result. The method can simultaneously obtain various microorganisms of different types, has accurate and reliable identification result, and lays a foundation for the research of the action of important microorganisms in the edible fungus fermentation material.

drawings

Other features, objects and advantages of the invention will become more apparent upon reading of the detailed description of non-limiting embodiments with reference to the following drawings:

FIG. 1 shows the results of culturing with beef extract peptone medium according to example 1 of the present invention;

FIG. 2 shows the results of culturing with modified Gao's 1 medium in example 1 of the present invention;

FIG. 3 shows the results of culturing with PGA medium according to example 1 of the present invention;

FIG. 4 shows the results of the culture using Bengal red medium in example 1 of the present invention.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples will assist those skilled in the art in further understanding the invention, but are not intended to limit the invention in any way. It should be noted that variations and modifications can be made by persons skilled in the art without departing from the spirit of the invention. All falling within the scope of the present invention.

Example 1

the embodiment provides a method for separating, purifying and identifying high-temperature bacteria in a secondary fermentation material of agaricus bisporus, which comprises the following steps:

1. preparation of a culture medium:

1.1PGA Medium: 5.0g of peptone, 10.0g of glucose, 1.0g of yeast powder, 3g of calcium carbonate, 5g of sodium chloride and 15g of agar are dissolved in 1L of water and sterilized at 121 ℃ for 20 min.

1.2 beef extract peptone medium: 5g of beef extract, 10.0g of peptone, 5.0g of sodium chloride, 18.0g of agar and 1000mL of distilled water, wherein the pH value is 7.0-7.2; sterilizing at 121 deg.C for 20 min; used for separating and culturing aerobic bacteria.

1.3 Bengal Red Medium: 5.0g of peptone, 10.0g of glucose, 1.0g of monopotassium phosphate, 0.5g of magnesium sulfate, 20.0g of agar, 0.033g of Bengal, 0.1g of chloramphenicol and 1000mL of distilled water; sterilizing at 121 deg.C for 30 min; used for separating and culturing filamentous fungi.

1.4 modified Hodgkin's No.1 Medium: 20.0g of soluble starch, 1.0g of potassium nitrate, 0.5g of dipotassium phosphate, 0.5g of magnesium sulfate, 0.01g of ferrous sulfate, 0.5g of sodium chloride, 18.0g of agar, 1000mL of distilled water and pH 7.2-7.4; when in preparation, a small amount of cold water is added into the starch to be mixed into paste, and then the paste is added into boiling water; sterilizing at 121 deg.C for 20 min; when in use, 1mL of 3 percent potassium dichromate is added into each 300mL of culture medium; used for separating and culturing actinomycetes.

2. Sampling and culturing:

Collecting secondary material discharged from the bin with obvious white actinomycetes on the surface from the middle part of a secondary agaricus bisporus fermentation material bin, packaging the secondary material by using a sterile self-sealing bag, and activating the secondary material for 12 hours in an incubator at the temperature of 55 ℃ and the humidity of about 60 percent.

3. Screening and purifying:

Immersing 5-10 g of secondary fermentation material in sterile water, oscillating for 10min, sucking a certain amount of secondary material leachate, diluting and releasing the leachate to six concentration gradients of 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, 10 ^-5 and 10 ^-6, and respectively coating the bacterial liquid with 6 concentrations on the various culture media of 1.1-1.4.

Inverting the culture medium coated with the bacterial liquid into an incubator at 55 ℃ and humidity of 60-80%, and culturing at constant temperature for 12 hours to obtain different single colonies; when the radius of the circular bacterial colony is enlarged to about 1 cm, the microorganism at the periphery of the bacterial colony is picked by an inoculating needle and inoculated into the similar culture medium for purification culture, and the times of the purification operation depend on the purification degree.

it should be noted that: experiments show that when the agaricus bisporus secondary leaching solution is diluted and then directly coated on a Bengal or an improved Gaulter medium, the probability of screening microorganisms is low, so that certain improvement needs to be made on the method when the two mediums are used.

therefore, the cultivation method using Bengal red or modified Goodpasture's medium is as follows:

Clamping the secondary material taken out of the bin with 1.5-2.5 cm by using a forceps, inoculating the secondary material on a culture medium, inverting the secondary material in an incubator at 55 ℃ and the humidity of about 70%, culturing for 1 day at constant temperature to discover that fungi grow on the culture medium, and picking out microorganisms on the periphery of bacterial colonies by using an inoculating needle to inoculate the microorganisms into the similar culture medium for purification culture when the radius of the bacterial colonies is enlarged to about 1 cm.

the results of the culture using each medium are shown in FIGS. 1 to 4.

Example 2 identification of bacterial species

1. Extracting strain genome DNA:

1.1, scraping a certain sample from the plate, placing the sample in a 2ml centrifuge tube, adding 200 mu L of buffer GA, and shaking until the thalli are completely suspended. (Note: the step of adding lywallzyme after suspending the strain obtained by the culture in the Gauss medium for disruption treatment, wherein 180. mu.L of a buffer (20mM Tris, pH 8.0; 2mM Na 2-EDTA; 1.2% Trise; 20mg/ml of the final concentration of lywallzyme) is added and the suspension is treated at 37 ℃ for 30min or more.)

1.2, adding 20 mu of LProteinase K solution into the tube, and uniformly mixing.

1.3, adding 220 microliter of buffer GB, shaking for 15sec, standing at 70 ℃ for 10min, cleaning the solution, and centrifuging briefly to remove water beads on the inner wall of the tube cover.

1.4, adding 220. mu.L of absolute ethanol, shaking thoroughly to mix for 15sec, at which time a flocculent precipitate may appear, and centrifuging briefly to remove water droplets on the inner wall of the tube cover.

1.5, adding the solution and flocculent precipitate obtained in the previous step into an adsorption column CB3 (the adsorption column is placed into a collecting pipe), centrifuging at 12,000 rpm (-13,400 Xg) for 30sec, pouring the waste liquid, and placing an adsorption column CB3 into a collecting pipe.

1.6, 500. mu.L of buffer GD (check whether absolute ethanol was added before use) was added to adsorption column CB3, centrifuged at 12000rpm (13400 Xg) for 30sec, the waste liquid was discarded, and adsorption column CB3 was put into the collection tube.

1.7, 600. mu.L of the rinsing solution PW (it was checked whether or not absolute ethanol was added before use) was added to the adsorption column CB3, and the mixture was centrifuged at 12000rpm (13400 Xg) for 30sec to remove the waste liquid, and the adsorption column CB3 was put into a collection tube.

1.8, repeat procedure 1.7

1.9, the adsorption column CB3 was put back into the collection tube, and centrifuged at 12000rpm (about 13400 Xg) for 2min to discard the waste liquid. The adsorption column CB3 was left at room temperature for several minutes to completely dry the rinsing solution remaining in the adsorption material. (Note: the purpose of this step is to remove the residual rinsing solution from the adsorption column, which could affect the subsequent enzyme reaction (digestion, PCR, etc.) experiments.)

1.10, transferring the adsorption column CB3 into a clean centrifuge tube, suspending and dripping 50-200 mu L of elution buffer TE into the middle part of the adsorption film, standing at room temperature for 2-5min, centrifuging at 12000rpm (about 13400 Xg) for 2min, and collecting the solution into the centrifuge tube. (Note: the volume of the elution buffer should not be less than 50. mu.l, too small a volume affects the recovery rate. the pH of the eluate greatly affects the elution efficiency. if ddH2O is used as the eluent, it should be ensured that the pH is in the range of 7.0-8.5, and the pH is less than 7.0, the elution efficiency is lowered, and the DNA product should be kept at-20 ℃ to prevent DNA degradation. to increase the yield of genomic DNA, the centrifuged solution can be added to adsorption column CB3, left at room temperature for 2min, and centrifuged at 12000rpm (-13400 Xg) for 2 min.)

2. PCR amplification of fungal genome:

The amplification primer sequences were designed using conventional methods, as shown in Table 1.

TABLE 1 primer design

Primer name	sequence of
		ITS1(SEQ ID NO.1)	TCCGTAGGTGAACCTGCGG
ITS4(SEQ ID NO.2)	TCCTCCGCTTATTGATATGC

PCR amplification reaction System: the following ingredients in Table 2 were added to a 0.2ml centrifuge tube.

TABLE 2PCR amplification reaction System

Reagent	Volume of
		Genomic DNA (20ng/ul)	1.0ul
10 Xbuffer (containing 2.5mM Mg2+)	5.0ul
		Taq polymerase (5 u/. mu.L)	1.0ul
dNTP(10mM)	1.0ul
		ITS1 primer (10uM)	1.5ul
ITS4 primer (10uM)	1.5ul
		ddH2O	39.0ul
total volume	50.0ul

Flick and mix evenly, and then collect the liquid drop on the tube wall to the tube bottom by instantaneous centrifugation, and carry out PCR reaction on a PCR amplification instrument, wherein the reaction parameters are shown in the following table 3.

TABLE 3PCR amplification reaction procedure

Pre-denaturation	denaturation of the material	Annealing	Extension of	final extension	Number of cycles
						95℃，5min	95℃，30s	58℃，30s	72℃，1min	72℃，7min	35

After the reaction was completed, 3ul of PCR product was subjected to 1% agarose gel electrophoresis. The PCR amplified fragment was confirmed.

3. Recovery of PCR products

The PCR product is recovered by using an AxyPrep DNA gel recovery kit, the specific operation is carried out according to the kit instruction, and the steps are as follows:

3.1, cutting the agarose gel containing the target DNA under an ultraviolet lamp, putting the agarose gel into a clean centrifugal tube, and weighing.

3.2, adding 3 volumes of Buffer DE-A, mixing uniformly, heating at 75 ℃ until the gel block is completely melted.

3.3, adding 0.5 Buffer DE-B with the volume of the Buffer DE-A, and uniformly mixing; when the isolated DNA fragment was less than 400bp, 1 gel volume of isopropanol was added.

3.4, the mixture was transferred to a DNA preparation tube and centrifuged at 12000 Xg for 1 min. The filtrate was discarded.

3.5, the preparation tube is put back into a 2ml centrifuge tube, 500. mu.l of Buffer W1 is added, 12000 Xg is added, the mixture is centrifuged for 30s, and the filtrate is discarded.

3.6, the preparation tube is put back into a 2ml centrifuge tube, 700. mu.l of Buffer W2 is added, 12000 Xg is added, the mixture is centrifuged for 30s, and the filtrate is discarded. The cells were centrifuged again at 700. mu.l Buffer W2, 12000 Xg for 1min in the same manner.

3.7, placing the preparation tube back into a 2ml centrifuge tube, and centrifuging for 1min at 12000 Xg.

and (3) sequence determination:

And taking the PCR product after each strain purification, and carrying out DNA sequencing by using a sequencer ABI 3730-XL.

Sequence analysis:

And comparing the spliced sequence file with data in an NCBI nucleic acid database by using an NCBI Blast program to obtain species information with the maximum similarity with the sequence of the species to be detected, namely the identification result. Specific results are shown in table 4 below.

TABLE 4

The invention has many applications, and the above description is only a preferred embodiment of the invention. It should be noted that the above examples are only for illustrating the present invention, and are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that various modifications can be made without departing from the principles of the invention and these modifications are to be considered within the scope of the invention.

Sequence listing

<110> Shanghai city academy of agricultural sciences

<120> a general method for identifying important microorganisms in edible fungus fermentation materials

<130> DD06787

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tccgtaggtg aacctgcgg 19

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tcctccgctt attgatatgc 20

Claims (8)

1. A general identification method for important microorganisms in edible fungus fermentation materials is characterized by comprising the following steps:

S1, sampling and culturing: collecting secondary materials from the secondary fermentation materials of the edible fungi, and activating;

S2, screening and purifying: culturing the activated secondary material discharged from the warehouse by adopting different culture media, and inoculating for purification culture after the radius of a bacterial colony is enlarged to 1 cm;

s3, identification: and extracting genome DNA of the colonies after the purification culture, then carrying out PCR amplification, recovering the obtained product, carrying out DNA sequencing, and comparing to obtain the identification result of each colony.

2. The method for identifying important microorganisms in edible fungus fermentation material in general as claimed in claim 1, wherein in step S1, the activation conditions are as follows: and packaging the secondary materials discharged from the warehouse, and then placing the packaged secondary materials in an incubator with the temperature of 55 ℃ and the humidity of about 60 percent for activation for 12 hours.

3. The method for identifying important microorganisms in edible fungus fermentation material in general as claimed in claim 1, wherein in step S2, the culture medium comprises PGA culture medium, beef extract peptone culture medium, Bengal culture medium, modified No.1 Gao' S culture medium.

4. The method for identifying important microorganisms in a universal edible fungus fermentation material according to claim 3, wherein the PGA culture medium is prepared by: dissolving peptone 5.0g, glucose 10.0g, yeast powder 1.0g, calcium carbonate 3g, sodium chloride 5g, and agar 15g in 1L water amount in water, and sterilizing at 121 deg.C for 20 min;

The preparation method of the beef extract peptone medium comprises the following steps: dissolving 5g of beef extract, 10.0g of peptone, 5.0g of sodium chloride and 18.0g of agar in distilled water based on the amount of 1L of water, and adjusting the pH value to 7.0-7.2; sterilizing at 121 deg.C for 20 min;

the preparation method of the Bengal red culture medium comprises the following steps: based on the amount of 1L of water, 5.0g of peptone, 10.0g of glucose, 1.0g of monopotassium phosphate, 0.5g of magnesium sulfate, 20.0g of agar, 0.033g of Bengal and 0.1g of chloramphenicol are dissolved in distilled water and sterilized at 121 ℃ for 30 min;

The preparation of the improved Gao's 1 culture medium comprises the following steps: based on the amount of 1L water, 20.0g of soluble starch, 1.0g of potassium nitrate, 0.5g of dipotassium hydrogen phosphate, 0.5g of magnesium sulfate, 0.01g of ferrous sulfate, 0.5g of sodium chloride and 18.0g of agar are dissolved in distilled water, and the pH is adjusted to 7.2-7.4; when in preparation, the soluble starch is added with a small amount of cold distilled water to be mixed into paste, and then is added into boiling distilled water; sterilizing at 121C for 20 min; for clinical application, 3% potassium dichromate was added to 300mL of the medium in an amount of 1 mL.

5. The method for identifying important microorganisms in edible fungus fermentation materials in general as claimed in claim 3, wherein in step S2, when the culture medium is PGA culture medium or beef extract peptone culture medium, the culture method is as follows:

Immersing 5 to 10 g of secondary materials taken out of the warehouse in sterile water, oscillating, absorbing a certain amount of leachate of the secondary materials taken out of the warehouse, diluting and releasing the leachate to six concentration gradients of 10 ^-1, 10 ^-2, 10 ^-3, 10 ^-4, 10 ^-5 and 10 ^-6, and respectively coating bacterial liquid with 6 concentrations on a PGA culture medium and a beef extract peptone culture medium;

and (3) inverting the culture medium coated with the bacterial liquid into an incubator at 55 ℃ and with the humidity of 60-80%, and culturing at constant temperature.

6. the method for identifying important microorganisms in edible fungus fermentation material in general as claimed in claim 3, wherein in step S2, when the culture medium is Bongah red culture medium, modified culture medium No.1, the culture method is as follows:

inoculating 1.5-2.5 cm of the secondary material in the bin on the culture medium, placing in an incubator at 55 deg.C and humidity of 70%, and culturing at constant temperature.

7. The method for identifying important microorganisms in edible fungus fermentation material in general as claimed in claim 1, wherein in step S3, the method for extracting genome DNA is as follows:

A. Adding the purified thalli into a buffer GA, and oscillating to obtain a suspension;

B. Adding a protease K solution into the suspension, and uniformly mixing;

C. Adding a buffer solution GB into the solution obtained in the step B, oscillating, standing for a period of time, and then centrifuging to remove water drops;

D. Adding absolute ethyl alcohol into the solution obtained in the step C, and shaking up;

E. D, adding the mixture obtained in the step D into an adsorption column, and centrifuging to remove waste liquid;

F. Then adding a buffer GD (GD), and centrifuging to remove waste liquid;

G. adding rinsing liquid, and centrifuging to remove waste liquid;

H. Repeating the step E-G, centrifuging the obtained centrifugate again to remove waste liquid, and standing at room temperature;

I. And D, dropwise adding an elution buffer TE into the adsorption column treated in the step H, standing at room temperature, centrifuging, and collecting the solution.

8. the method for identifying important microorganisms in edible fungus fermentation materials in general as claimed in claim 1, wherein in step S3, the sequences of the primer pair adopted in the PCR amplification are shown as SEQ ID No.1 and SEQ ID No. 2.