CN110548069B - Traditional Chinese medicine composition and application thereof in preparation of medicine for treating rhinitis - Google Patents
Traditional Chinese medicine composition and application thereof in preparation of medicine for treating rhinitis Download PDFInfo
- Publication number
- CN110548069B CN110548069B CN201910918219.2A CN201910918219A CN110548069B CN 110548069 B CN110548069 B CN 110548069B CN 201910918219 A CN201910918219 A CN 201910918219A CN 110548069 B CN110548069 B CN 110548069B
- Authority
- CN
- China
- Prior art keywords
- parts
- traditional chinese
- mass
- chinese medicine
- medicine composition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/23—Apiaceae or Umbelliferae (Carrot family), e.g. dill, chervil, coriander or cumin
- A61K36/236—Ligusticum (licorice-root)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/48—Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
- A61K36/484—Glycyrrhiza (licorice)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/57—Magnoliaceae (Magnolia family)
- A61K36/575—Magnolia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/60—Moraceae (Mulberry family), e.g. breadfruit or fig
- A61K36/605—Morus (mulberry)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/02—Nasal agents, e.g. decongestants
Landscapes
- Health & Medical Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Biotechnology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Medical Informatics (AREA)
- Botany (AREA)
- Alternative & Traditional Medicine (AREA)
- Otolaryngology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Pulmonology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Medicines Containing Plant Substances (AREA)
Abstract
The invention relates to the technical field of traditional Chinese medicines, in particular to a traditional Chinese medicine composition and application thereof in preparing a medicine for treating rhinitis. The traditional Chinese medicine composition provided by the invention comprises magnolia flower, ligusticum, mulberry leaf, liquorice and purslane, and the medicinal materials are compounded according to a certain proportion, so that the expression of key inflammatory factors IL-6 and IL-1 beta can be obviously inhibited, and the content of nitric oxide, a vascular endothelial relaxation factor, can be inhibited. Therefore, the composition has the function of treating rhinitis or assisting in treating the rhinitis. The traditional Chinese medicine composition provided by the invention has the main functional indications that: disperse cold, relieve stuffy nose. It is suitable for rhinitis and allergic rhinitis, and has clinical manifestations of continuous sneezing, rhinocnesmus, nasal obstruction, rhinorrhea, etc. caused by pollen, dust mite, cold air, etc.
Description
Technical Field
The invention relates to the technical field of traditional Chinese medicines, in particular to a traditional Chinese medicine composition and application thereof in preparing a medicine for treating rhinitis.
Background
Rhinitis, that is, inflammatory diseases of nasal cavity, is inflammation of nasal mucosa caused by viruses, bacteria, allergens, various physicochemical factors and some systemic diseases, and is classified into acute rhinitis, chronic rhinitis, allergic rhinitis and the like, and rhinitis belongs to a frequently encountered disease, and no better treatment method exists at present.
When rhinitis occurs, the levels of various inflammatory cytokines in the serum of patients rise. Inflammatory cytokines refer to various cytokines involved in inflammatory responses. Common inflammatory cytokines include interleukin 1(IL-1), interleukin 6(IL-6), etc., which are cytokines that primarily affect the inflammatory process, and the release of IL-6 cytokines stimulates cells to release inflammatory mediators such as NO, oxygen radicals, etc. IL-1 takes IL-1 beta as a main secretion form, IL-1 beta is mainly secreted and produced by mononuclear/macrophage and lymphocyte in peripheral blood, is one of inflammation mediators with the strongest action in vivo, and has the biological functions of inducing the expression of cell adhesion molecules, attracting the aggregation of neutrophils, activating immune cells to produce various cytokines and inducing the expression and secretion of inflammatory cytokines. It has been shown that inflammatory cytokines, represented by IL-1 β and IL-6, mediate and participate in the pathophysiological processes of a number of diseases. Not only is a large amount of inflammatory factors expressed in acute infection, but also chronic diseases such as diabetes, cardiovascular diseases and tumors are considered to be involved in chronic inflammation. Therefore, the development of drugs capable of inhibiting the expression of inflammatory cytokines and inflammatory mediators is essential for the treatment and clinical application of inflammatory diseases and allergic diseases.
Disclosure of Invention
In view of the above, the technical problem to be solved by the present invention is to provide a traditional Chinese medicine composition and an application thereof in preparing a medicine for treating rhinitis. The traditional Chinese medicine composition provided by the invention can inhibit the expression of IL-1 beta, IL-6 and INOS.
The traditional Chinese medicine composition provided by the invention comprises magnolia flower, ligusticum, mulberry leaf, liquorice and purslane.
The traditional Chinese medicine composition comprises 5-30 parts by mass of magnolia flower, 5-30 parts by mass of ligusticum, 5-20 parts by mass of mulberry leaf, 5-20 parts by mass of liquorice and 5-30 parts by mass of purslane.
In some embodiments, the Chinese medicinal composition comprises 5 parts by mass of magnolia flower, 5 parts by mass of ligusticum, 5 parts by mass of mulberry leaf, 5 parts by mass of licorice and 5 parts by mass of purslane.
In some embodiments, the Chinese medicinal composition comprises 30 parts by mass of magnolia flower, 30 parts by mass of ligusticum, 20 parts by mass of mulberry leaf, 20 parts by mass of licorice and 30 parts by mass of purslane.
In some embodiments, the Chinese medicinal composition comprises 10 parts by mass of magnolia flower, 10 parts by mass of ligusticum, 10 parts by mass of mulberry leaf, 10 parts by mass of licorice and 15 parts by mass of purslane.
The recipe disperses cold, and is effective in relieving nasal obstruction. In the recipe, flos Magnoliae is used as the monarch drug because it disperses wind-cold and relieves stuffy nose. The ligusticum sinense is used as a ministerial drug for dispelling wind and cold. Mulberry leaves can disperse wind-heat, clear lung-heat and moisten dryness, and purslane can clear away heat and toxic materials, which are used as adjuvant drugs together. Licorice root, radix Glycyrrhizae is a guiding drug for replenishing qi to regulate the middle warmer and harmonizing the effects of the other drugs in the recipe. The medicines are combined to play the roles of dispersing cold and freeing nasal orifices. The experiment proves that the extract of the composition has the functions of inhibiting the content of inflammatory factors, regulating the expression of inflammatory genes and inhibiting the release of inflammatory mediators. Early tests show that the components of the composition are most reasonable, and the compatibility of other Chinese medicinal materials cannot realize the effect of the composition. And under the proportion provided by the invention, the composition can realize the best synergistic and synergistic effect.
The invention also provides an extract which is prepared by extracting the traditional Chinese medicine composition.
The preparation method of the extract comprises the following steps: extracting the Chinese medicinal composition with ethanol water solution.
Before extraction, the traditional Chinese medicinal materials are crushed into 80-100-mesh powder.
The volume fraction of ethanol in the ethanol aqueous solution is 90%.
The volume mass ratio of the ethanol aqueous solution to the traditional Chinese medicine powder is 15: 1.
The extraction is Soxhlet extraction for 3 h.
The method also comprises the steps of concentration and freeze-drying after extraction.
The concentration method is evaporation to dryness. The temperature of the evaporation to dryness was 45 ℃. The extract of each 10g of the medicinal materials is concentrated to 2 mL.
The freeze-drying procedure is that the freeze-drying is carried out for 24 hours at the temperature of-60 ℃ and under the vacuum degree of 0.08 kpa.
The traditional Chinese medicine composition or the extract prepared by the preparation method disclosed by the invention is applied to preparation of a medicine for preventing and treating rhinitis.
The rhinitis prevention and treatment comprises inhibition of inflammatory cytokine expression; the inflammatory cytokine is IL-1 beta, IL-6 or INOS.
The invention also provides a medicine for treating rhinitis, which comprises the traditional Chinese medicine composition or the extract prepared by the preparation method.
The medicament formulation of the invention is nose drops or spray.
The nasal drop comprises the traditional Chinese medicine extract and an auxiliary material, wherein the auxiliary material is a 75% ethanol solution.
The spray comprises the traditional Chinese medicine extract and auxiliary materials, wherein the auxiliary materials comprise tween 20, glycerol, glycine and deionized water.
The traditional Chinese medicine composition provided by the invention comprises magnolia flower, ligusticum, mulberry leaf, liquorice and purslane (hereinafter referred to as an anti-inflammatory formula), and the medicinal materials are compounded according to a certain proportion, so that the expression of key inflammatory factors IL-6 and IL-1 beta can be obviously inhibited, and the content of vascular endothelial relaxation factor Nitric Oxide (NO) can be inhibited. Therefore, the composition has the function of treating rhinitis or assisting in treating the rhinitis. The traditional Chinese medicine composition provided by the invention has the main functional indications that: disperse cold, relieve stuffy nose. It is suitable for rhinitis and allergic rhinitis, and has clinical manifestations of continuous sneezing, rhinocnesmus, nasal obstruction, rhinorrhea, etc. caused by pollen, dust mite, cold air, etc.
Drawings
FIG. 1 shows the effect of the Chinese medicinal composition on the expression of genes related to THP1 cytokines;
FIG. 2 shows the effect of the Chinese medicinal composition on the expression of genes related to RAW cytokines;
FIG. 3 the effect of the Chinese medicinal composition on NO content.
Detailed Description
The invention provides a traditional Chinese medicine composition and application thereof in preparing a medicine for treating rhinitis. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
The test materials adopted by the invention are all common commercial products and can be purchased in the market.
The invention is further illustrated by the following examples:
example 1
10g of biond magnolia flower, 10g of Chinese ligusticum rhizome, 10g of mulberry leaf, 10g of liquorice and 15g of purslane are taken.
Pulverizing flos Magnoliae, rhizoma Ligustici, folium Mori, Glycyrrhrizae radix, and herba Portulacae into 80-100 mesh powder, weighing and mixing at a certain ratio, weighing 10g of mixed powder, adding 15 times volume of 90% ethanol water solution 150mL, performing Soxhlet heating reflux extraction for 3h, heating and concentrating the extractive solution for 20min to volume of 2mL, transferring to a freeze dryer at-60 deg.C, vacuum lyophilizing at 0.08kpa for 24h to obtain extract lyophilized powder, weighing certain mass of lyophilized powder, dissolving in dimethyl sulfoxide (DMSO) to obtain extract mother liquor with concentration of 100mg/mL, and storing at 4 deg.C.
Efficacy verification
The method comprises the following steps of discovering the influence of a traditional Chinese medicine composition extract on the expression of an IL-6 gene by utilizing a qPCR technology, wherein the specific experimental process comprises the following steps: (example of THP1 human monocyte)
THP1 cells were plated in 12-well plates at 40 ten thousand/mL/well, while phorbol ester PMA-treated cells were added to each well at a final concentration of 100ng/mL for 24h to induce the cells into macrophages.
2. Adding 1 μ L of Chinese medicinal composition extract with final concentration of 100 μ g/mL into the drug treatment group, adding 1 μ L of DMSO solvent control into the induction group, and treating the cells for 1 h;
3. and adding LPS (lipopolysaccharide) with the final concentration of 1 mu g/mL into cell culture medium supernatants of the drug treatment group and the induction group to stimulate cell inflammation to occur, and treating the cells for 24 hours.
4. RNA of each group of cells is extracted by using the kit and inverted into cDNA, and the inversion condition is 1h at 37 ℃ and 5min at 95 ℃.
qPCR reaction, program: at 95 ℃ for 3 min; (95 ℃, 3 s; 60 ℃, 30s)40 cycles.
Wherein, the primer sequence is as follows:
IL-6 upstream primer: actcacctcttcagaacgaattg
IL-6 downstream primer: ccatctttggaaggttcaggttg
6. Data processing: the gene expression quantity of the induction group is 1, the gene expression quantity of the drug treatment group is more than 1, the gene expression is up-regulated, and the gene expression quantity of the drug treatment group is less than 1, the gene expression is down-regulated. The results of four qPCR experiments are shown in table 1 and figure 1 (. p <0.05,. p <0.01,. p < 0.001).
TABLE 1 qPCR results for Chinese medicinal compositions
| Grouping | Mean value (N is 4) | SD | TTEST |
| Induction of | 1.00 | 0 | |
| Induction and anti-inflammatory formulation | 0.26 | 0.1381 | 0.0017 |
The qPCR result shows that the anti-inflammatory formula extract of the traditional Chinese medicine composition can obviously reduce the expression of the IL-6 gene of the cell inflammatory factor.
Secondly, discovering the influence of the traditional Chinese medicine composition extract on the expression of IL-6, IL-1 beta and INOS genes by utilizing a qPCR technology, wherein the specific experimental process comprises the following steps: (taking RAW264.7 mouse macrophage as an example)
Spreading RAW264.7 cells in a 12-well plate at 40 ten thousand/mL/well, simultaneously adding 1 μ L of the Chinese medicinal composition extract with a final concentration of 100 μ g/mL to the drug-treated group, adding 1 μ L of DMSO solvent control to the induced group, and treating the cells for 1 h;
2. and adding LPS (lipopolysaccharide) with the final concentration of 1 mu g/mL into cell culture medium supernatants of the drug treatment group and the induction group to stimulate cell inflammation to occur, and treating the cells for 24 hours. 3. RNA of each group of cells is extracted by using the kit and inverted into cDNA, and the inversion condition is 1h at 37 ℃ and 5min at 95 ℃.
qPCR reaction, procedure: at 95 ℃ for 3 min; (95 ℃, 3 s; 60 ℃, 30s)40 cycles.
Wherein, the primer sequence is as follows:
IL-1 β upstream primer: gcaactgttcctgaactcaact
IL-1 beta downstream primer: atcttttggggtccgtcaact
IL-6 upstream primer: ctgcaagagacttccatccag
IL-6 downstream primer: agtggtatagacaggtctgttgg
INOS upstream primer: gttctcagcccaacaatacaaga
INOS downstream primer: gtggacgggtcgatgtcac
5. Data processing: the gene expression quantity of the induction group is 1, the gene expression quantity of the drug treatment group is more than 1, the gene expression is up-regulated, and the gene expression quantity of the drug treatment group is less than 1, the gene expression is down-regulated. The results of four qPCR experiments are shown in table 2 and figure 2 (. p <0.05,. p <0.01,. p < 0.001).
TABLE 2 qPCR results for Chinese medicinal compositions
The qPCR result shows that the anti-inflammatory formula extract of the traditional Chinese medicine composition can obviously reduce the expression of IL-6, IL-1 beta and INOS genes.
Thirdly, detecting the influence of the traditional Chinese medicine composition extract on the content of Nitric Oxide (NO) of the vasodilator of vascular endothelium in inflammatory cells by using a nitric acid reduction method, wherein the specific experimental process is as follows: (taking RAW264.7 mouse macrophage as an example)
Spreading RAW264.7 cells in a 12-well plate at 40 ten thousand/mL/well, simultaneously adding 1 μ L of the Chinese medicinal composition extract with a final concentration of 100 μ g/mL to the drug-treated group, adding 1 μ L of DMSO solvent control to the induced group, and treating the cells for 1 h;
2. and adding LPS (lipopolysaccharide) with the final concentration of 1 mu g/mL into cell culture medium supernatants of the drug treatment group and the induction group to stimulate cell inflammation to occur, and treating the cells for 24 hours. 3. The culture medium supernatant is sucked, reacted with the reagent kit, read at 550nm by a microplate reader, and the NO content (unit. mu. mol/L) is calculated. The results of four experiments are shown in table 3 and figure 3 (. p <0.05,. p <0.01,. p < 0.001).
TABLE 3 NO results for Chinese medicinal composition
| Grouping | Mean value (N is 4) | SD | TTEST |
| Induction of | 1.00 | 0 | |
| Induction and anti-inflammatory formulation | 0.24 | 0.1110 | 0.0008 |
NO detection results show that the anti-inflammatory formula extract of the traditional Chinese medicine composition can obviously reduce the content of vascular endothelial relaxation factor NO in inflammatory cells.
Example 2
The embodiment is basically the same as the embodiment 1, except that the mixture ratio of the traditional Chinese medicine components is as follows: 5 parts of biond magnolia flower, 5 parts of Chinese ligusticum rhizome, 5 parts of mulberry leaf, 5 parts of liquorice and 5 parts of purslane.
Efficacy verification as described in example 1 was also performed, with results similar to example 1.
Example 3
The embodiment is basically the same as the embodiment 1, except that the mixture ratio of the traditional Chinese medicine components is as follows: 30 parts of biond magnolia flower, 30 parts of Chinese ligusticum rhizome, 20 parts of mulberry leaf, 20 parts of liquorice and 30 parts of purslane.
Efficacy verification as described in example 1 was also performed, with results similar to example 1.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that it is obvious to those skilled in the art that various modifications and improvements can be made without departing from the principle of the present invention, and these modifications and improvements should also be considered as the protection scope of the present invention.
Claims (8)
1. A traditional Chinese medicine composition for preventing and treating rhinitis is characterized in that,
it is composed of 5 parts by mass of magnolia flower, 5 parts by mass of ligusticum, 5 parts by mass of mulberry leaf, 5 parts by mass of liquorice and 5 parts by mass of purslane;
or comprises 30 parts by mass of magnolia flower, 30 parts by mass of Chinese ligusticum, 20 parts by mass of mulberry leaf, 20 parts by mass of liquorice and 30 parts by mass of purslane;
or comprises flos Magnoliae 10 weight parts, rhizoma Ligustici 10 weight parts, folium Mori 10 weight parts, Glycyrrhrizae radix 10 weight parts and herba Portulacae 15 weight parts.
2. An extract for preventing and treating rhinitis, which is prepared by extracting the traditional Chinese medicine composition of claim 1;
the preparation method is to extract the traditional Chinese medicine composition of claim 1 by using 90 percent ethanol water solution by volume fraction.
3. The method for preparing the extract according to claim 2, comprising: extracting the Chinese medicinal composition of claim 1 with 90% ethanol aqueous solution by volume fraction.
4. The method according to claim 3, wherein the extraction is a Soxhlet heating reflux extraction for 3 hours.
5. The method of claim 3, wherein the extraction step further comprises a concentration step and a lyophilization step.
6. The application of the traditional Chinese medicine composition as claimed in claim 1, the extract as claimed in claim 2, or the extract prepared by the preparation method as claimed in any one of claims 3 to 5 in preparing a medicament for preventing and treating rhinitis.
7. The use of claim 6, wherein the prevention and treatment of rhinitis comprises inhibition of inflammatory cytokine expression, inhibition of endothelin-relaxing factor expression; the inflammatory cytokine is IL-1 beta, IL-6 or INOS.
8. A medicament for treating rhinitis, which is characterized by comprising the traditional Chinese medicine composition as claimed in claim 1, the extract as claimed in claim 2, or the extract prepared by the preparation method as claimed in any one of claims 3 to 5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910918219.2A CN110548069B (en) | 2019-09-26 | 2019-09-26 | Traditional Chinese medicine composition and application thereof in preparation of medicine for treating rhinitis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910918219.2A CN110548069B (en) | 2019-09-26 | 2019-09-26 | Traditional Chinese medicine composition and application thereof in preparation of medicine for treating rhinitis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110548069A CN110548069A (en) | 2019-12-10 |
| CN110548069B true CN110548069B (en) | 2022-06-10 |
Family
ID=68741540
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910918219.2A Active CN110548069B (en) | 2019-09-26 | 2019-09-26 | Traditional Chinese medicine composition and application thereof in preparation of medicine for treating rhinitis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110548069B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113491756B (en) * | 2020-03-19 | 2022-07-05 | 博奥生物集团有限公司 | Anti-inflammatory traditional Chinese medicine composition and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103006893A (en) * | 2013-01-15 | 2013-04-03 | 鲍旭刚 | Medicine for treating chronic rhinitis and preparation method thereof |
| CN106581256A (en) * | 2016-12-30 | 2017-04-26 | 河南科技大学 | Traditional Chinese medicinal composition for treating nasosinusitis, medicinal preparation for treating nasosinusitis, and preparation method of medicinal preparation |
-
2019
- 2019-09-26 CN CN201910918219.2A patent/CN110548069B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103006893A (en) * | 2013-01-15 | 2013-04-03 | 鲍旭刚 | Medicine for treating chronic rhinitis and preparation method thereof |
| CN106581256A (en) * | 2016-12-30 | 2017-04-26 | 河南科技大学 | Traditional Chinese medicinal composition for treating nasosinusitis, medicinal preparation for treating nasosinusitis, and preparation method of medicinal preparation |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110548069A (en) | 2019-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105147800B (en) | Detection method of ephedra, apricot, gypsum and licorice decoction formula granules | |
| CN107714805B (en) | Application of thoroughfare bitter orange extract in preparation of traditional Chinese medicine preparation or functional food | |
| CN112569332A (en) | Application of bupleurum tenue extract in treating viral pneumonia | |
| CN111870568B (en) | Anti-allergy itching-relieving plant composition and preparation method and application thereof | |
| KR102172571B1 (en) | Complex Medicines for Improving Respiratory Inflammation and Hypersensitivity Caused Fine Dust | |
| CN110548069B (en) | Traditional Chinese medicine composition and application thereof in preparation of medicine for treating rhinitis | |
| JP4399162B2 (en) | Herbal pharmaceutical composition for immunological disease treatment | |
| CN106924374B (en) | Composition, preparation method thereof and application of composition in preparation of products for reducing blood sugar and/or blood fat | |
| CN108186832A (en) | A kind of Chinese medicinal granule for treating cough variant asthma in childhood: prednison comparing and preparation method thereof | |
| KR101929632B1 (en) | Method for preparing ginseng extract having a protective effect against heat stress exposure | |
| CN114425058B (en) | Traditional Chinese medicine composition for treating rhinitis and preparation method, medicine and preparation thereof | |
| CN114344358A (en) | Eucommia ulmoides composition containing aucubin and geniposide, preparation and application | |
| WO2017129060A1 (en) | Medicine used for treating influenza, upper respiratory tract infection, viral pneumonia | |
| WO2018090276A1 (en) | Chinese medicine composition for prevention and treatment of combined allergic rhinitis and asthma syndrome and preparation method thereof | |
| CN113082187B (en) | Application of bupleurum extract and azithromycin in combination for treating viral pneumonia | |
| CN102240328B (en) | Traditional Chinese medicine for treating cold and preparation method thereof | |
| CN115814049B (en) | Traditional Chinese medicine composition and preparation method and application thereof | |
| CN113491756B (en) | Anti-inflammatory traditional Chinese medicine composition and application thereof | |
| CN106539979A (en) | A kind of Chinese medicine preparation for treating allergic rhinitises | |
| CN111568955B (en) | Traditional Chinese medicine composition for relieving allergic rhinitis and preparation method and application thereof | |
| CN116570688A (en) | Traditional Chinese medicine composition for reducing influenza susceptibility and preparation method and application thereof | |
| CN116474016A (en) | Traditional Chinese medicine extract for treating or relieving allergic airway inflammation and application thereof | |
| CN115501315A (en) | Traditional Chinese medicine composition and preparation method and application thereof | |
| CN116236546A (en) | Traditional Chinese medicine composition and preparation method and application thereof | |
| CN112353764A (en) | Bozuri hot granules and extraction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20220331 Address after: 102200 b201-1, No. 18, shengshengyuan Road, Life Science Park, Changping District, Beijing Applicant after: Beijing Boao Jingfang Biotechnology Co.,Ltd. Address before: 102206 No. 18, life science Road, Beijing, Changping District Applicant before: CAPITALBIO Corp. Applicant before: Tsinghua University |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |