CN110526958A - A kind of vigor repairs peptide Tvigour A and its application - Google Patents
A kind of vigor repairs peptide Tvigour A and its application Download PDFInfo
- Publication number
- CN110526958A CN110526958A CN201910663377.8A CN201910663377A CN110526958A CN 110526958 A CN110526958 A CN 110526958A CN 201910663377 A CN201910663377 A CN 201910663377A CN 110526958 A CN110526958 A CN 110526958A
- Authority
- CN
- China
- Prior art keywords
- dna
- seq
- amino acid
- peptide
- tvigour
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/02—Preparations for care of the skin for chemically bleaching or whitening the skin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
- A61Q19/08—Anti-ageing preparations
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
- C07K2319/21—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Dermatology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Birds (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Gerontology & Geriatric Medicine (AREA)
- Genetics & Genomics (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Peptide Tvigour A is repaired the present invention relates to a kind of vigor and its is preparing the application in external preparation for skin product, especially dermal tissue insult regeneration and the product for repairing aspect.A kind of vigor peptide Tvigour A provided by the invention has the ability for inhibiting scar cell Proliferation, while can promote skin fibroblasts proliferation, to have tissue repair function；When sharing with other molecules (especially macromolecular polypeptides, proteinaceous molecule), the transdermal absorption factor of other molecules can be improved, to efficiently solve the problems, such as the Transdermal absorption inefficiency of polypeptide bioactive molecule and drug.
Description
Technical field
The invention belongs to biomedicine fields, and in particular to a kind of vigor repairs peptide Tvigour A and its preparing skin
Application in the product of the regeneration of externally applied product, especially dermal tissue insult and reparation aspect.
Background technique
Human skin is the organ most directly contacted with the external world, is first of physiologic barrier of human immune system.Its
Extraneous unfavorable factor (physics, chemistry, biology etc.) can be prevented to enter human body to a certain extent to damage body, had simultaneously
There is the effects of moisturizing, anti-inflammatory and skin are adjusted, to maintain the stabilization of its skin barrier function.Safeguard the normal barrier function of skin
It can be basis and the important component of skin nursing.Hormonal readiness fluctuation, stress, environmental stimuli, ultraviolet light, environment are dirty
The internal and external factors such as the reasons such as dye, improper diet and wrong skin nursing can all cause different degrees of skin barrier structure and function
Can be abnormal, when skin barrier is damaged, skin self-defense scarce capacity, it may appear that the skins such as dry skin, aging, pigmentation
Skin symptom can even cause the skin diseases such as eczema, acne, dermatitis, psoriasis, ichthyosis when serious.With living standard
It improves, people increasingly pay close attention to the nursing of skin, the especially nursing of skin of face.Damaged skin is not intended merely to quickly to repair,
Also require to reduce the generation of scar simultaneously, with reach injury tissue as far as possible it is perfect repair and regeneration, meet patient's physiology and
The requirement of psychology.So medical field reduces the research for the problems such as scar generates about how tissue repair efficiency is improved in recent years
It is unprecedentedly active.
With the development of functional cosmetics, the traditional formula technique of cosmetics is increasingly by the challenge of new technology.This
A little challenges are mainly from two aspects: being on the one hand the applications of new raw material；It on the other hand is the transdermal penetration of functional components.Object
There are four elements for the percutaneous dosing of matter: when correct site of action, correct chemicals, correct concentration and effect appropriate
Between.Substance percutaneous effects overall process includes transdermal penetration, skin absorption and gathers in site of action, with transdermal drug delivery
It is the transdermal penetration of functional components that maximum difference, which is the final purpose of cosmetics percutaneous dosing, is gathered simultaneously in skin site of action
Play efficacy effect.Necessarily functional components in site of action reach effective concentration for the performance of the validity of product, and continue
Time enough.Therefore, while application new raw material, the method for finding promotion functions ingredient transdermal penetration is development efficacy
One of the key of property cosmetics.
However, in the prior art, generating the substance report of promotion functions ingredient transdermal penetration simultaneously very to scar is reduced
It is few, therefore, a kind of inhibition scar cell Proliferation is studied, has tissue repair function；(especially macromolecular is more with other molecules
Peptide, proteinaceous molecule) when sharing, the polypeptide that can improve the transdermal absorption factor of other molecules becomes that this field is urgently to be resolved to ask
Topic.
Summary of the invention
In order to overcome the shortcomings of the prior art and insufficient, the present invention provides a kind of vigor peptide Tvigour A, has and inhibits scar
The ability of trace cell Proliferation, while can promote skin fibroblasts proliferation, to have tissue repair function；With other molecules
When (especially macromolecular polypeptides, proteinaceous molecule) share, the transdermal absorption factor of other molecules can be improved, to effectively solve
The problem of Transdermal absorption inefficiency of polypeptide of having determined bioactive molecule and drug.
For this purpose, first aspect present invention provides a kind of peptide T vigour A, amino acid sequence includes containing 1) or 2)
Amino acid sequence:
1) amino acid sequence shown in SEQ ID NO:1；
2) amino acid sequence shown in SEQ ID NO:1 through conservative substitution, missing or adds more than one and has and SEQ
The amino acid sequence with the same function of amino acid sequence shown in ID NO:1, it is preferable that shown in described and SEQ ID NO:1
Amino acid sequence amino acid sequence with the same function it is not low with the homology of amino acid sequence shown in SEQ ID NO:1
In 90%.
In certain embodiments of the present invention, the polypeptide is with the polypeptide for being not more than 35 amino acid lengths.
In other embodiments of the invention, the polypeptide is with the polypeptide for being not more than 32 amino acid lengths.
In the present invention, the amino acid sequence of the peptide T vigour A includes 1) amino acid sequence contained 1) refers to
Amino acid sequence be peptide T vigour A essential amino acid sequence, and be continuous sequence, in addition to amino acid sequence 1)
Arranging can also be containing other amino acid in the amino acid sequence of outer peptide T vigour A, but the selection of other amino acid must
The biological activity for not influencing the essential amino acid sequence of peptide T vigour A must be met.
In some preferred embodiments of the invention, the amino acid sequence of the peptide T vigour A is to contain SEQ
The amino acid length of amino acid sequence shown in ID NO:1, the peptide T vigour A is not more than 35 amino acid lengths.
In other preferred embodiments of the invention, the amino acid sequence of the peptide T vigour A be containing
The amino acid length of amino acid sequence shown in SEQ ID NO:1, the peptide T vigour A is not more than 32 amino acid longs
Degree.
In other preferred embodiments of the invention, the amino acid sequence of the peptide T vigour A is SEQ
Amino acid sequence shown in ID NO:1.
In certain embodiments of the present invention, the amino acid sequence of the peptide T vigour A can also be containing SEQ
Amino acid sequence shown in ID NO:1 through conservative substitution, missing or add more than one and have with shown in SEQ ID NO:1
Amino acid sequence amino acid sequence with the same function, also, the amino acid length of the peptide T vigour A is not more than 35
A amino acid length.
In certain embodiments of the present invention, the amino acid sequence of the peptide T vigour A can also be containing SEQ
Amino acid sequence shown in ID NO:1 through conservative substitution, missing or add more than one and have with shown in SEQ ID NO:1
Amino acid sequence amino acid sequence with the same function, also, the amino acid length of the peptide T vigour A is not more than 32
A amino acid length.
In other embodiments of the invention, the amino acid sequence of the peptide T vigour A is SEQ ID NO:1
Shown in amino acid sequence through conservative substitution, missing or add more than one and have and amino acid shown in SEQ ID NO:1
Sequence amino acid sequence with the same function.
In certain embodiments of the present invention, the amino acid sequence of the peptide T vigour A is to contain SEQ ID
Amino acid sequence shown in NO:1 is through conservative substitution, missing or adds more than one and has and ammonia shown in SEQ ID NO:1
Base acid sequence amino acid sequence with the same function, and it is described have with amino acid sequence shown in SEQ ID NO:1 it is identical
The homology of amino acid sequence shown in the amino acid sequence and SEQ ID NO:1 of function is not less than 90%.
In certain embodiments of the present invention, the amino acid sequence of the peptide T vigour A is to contain SEQ ID
Amino acid sequence shown in NO:1 is through conservative substitution, missing or adds more than one and has and ammonia shown in SEQ ID NO:1
Base acid sequence amino acid sequence with the same function, and it is described have with amino acid sequence shown in SEQ ID NO:1 it is identical
The homology of amino acid sequence shown in the amino acid sequence and SEQ ID NO:1 of function is not less than 95%.
In the present invention, " peptide T vigour A " refers both to first aspect present invention with " vigor repair peptide TvigourA " and mentions
The polypeptide of confession.
In the present invention, refer to amino acid sequence amino acid sequence with the same function shown in SEQ ID NO:1
After amino acid sequence shown in SEQ ID NO:1 is replaced, missed or added more than one amino acid, the polypeptide of acquisition have with
The same biological activity of the polypeptide that amino acid shown in SEQ ID NO:1 obtains, peptide T vigour as described in the present invention
A has the double effects for promoting tissue repair and Transdermal absorption.
In certain embodiments of the present invention, molecular cloning or chemical synthesis etc. can be used in the peptide T vigour A
Conventional method obtains.
In some preferred embodiments of the invention, the peptide T vigour A is obtained using the method for molecular cloning
.
The nucleic acid molecules of second aspect of the present invention offer coding said polypeptide Tvigour A.
In certain embodiments of the present invention, the DNA sequence dna of the nucleic acid molecules includes the DNA sequence contained 1) or 2)
Column:
1) DNA sequence dna shown in SEQ ID NO:2；
2) DNA sequence dna shown in SEQ ID NO:2 through conservative substitution, missing or adds more than one base, and have with
DNA sequence dna DNA molecular with the same function shown in SEQ ID NO:2, it is preferable that shown in described and SEQ ID NO:2
The DNA sequence dna of DNA sequence dna DNA molecular with the same function and the homology of DNA sequence dna shown in SEQ ID NO:2 are not less than
90%.
In some preferred embodiments of the invention, the DNA sequence dna of the nucleic acid molecules includes SEQ ID NO:2 institute
The DNA sequence dna shown.
In other preferred embodiments of the invention, the DNA sequence dna of the nucleic acid molecules is SEQ ID NO:2 institute
The DNA sequence dna shown.
In certain embodiments of the present invention, the DNA sequence dna of the nucleic acid molecules is containing shown in SEQ ID NO:2
DNA sequence dna is through conservative substitution, missing or adds more than one base, and have have with DNA sequence dna shown in SEQ ID NO:2
The DNA molecular of identical function.
In other embodiments of the invention, the DNA sequence dna of the nucleic acid molecules is shown in SEQ ID NO:2
DNA sequence dna is through conservative substitution, missing or adds more than one base, and have have with DNA sequence dna shown in SEQ ID NO:2
The DNA molecular of identical function.
In certain embodiments of the present invention, the DNA sequence dna of the nucleic acid molecules is DNA shown in SEQ ID NO:2
Sequence is through conservative substitution, missing or adds more than one base, and with DNA sequence dna shown in SEQ ID NO:2 have phase
The DNA molecular of congenerous, and the DNA sequence with DNA sequence dna DNA molecular with the same function shown in SEQ ID NO:2
The homology of column and DNA sequence dna shown in SEQ ID NO:2 is not less than 90%.
In other embodiments of the invention, the DNA sequence dna of the nucleic acid molecules is shown in SEQ ID NO:2
DNA sequence dna is through conservative substitution, missing or adds more than one base, and have have with DNA sequence dna shown in SEQ ID NO:2
The DNA molecular of identical function, and the DNA with DNA sequence dna DNA molecular with the same function shown in SEQ ID NO:2
Sequence and the homology of DNA sequence dna shown in SEQ ID NO:2 are not less than 95%.
Third aspect present invention provides a kind of expression cassette, and it includes the nucleic acid molecules of the coding peptide T vigour A.
Fourth aspect present invention provides a kind of recombinant vector, and it includes the nucleic acid point of the coding peptide T vigour A
Son.
Fifth aspect present invention provides a kind of N-terminal in peptide T vigour A or C-terminal connects what a His label was constituted
Polypeptide.
In certain embodiments of the present invention, the His label is 6 × His label, and the amino acid sequence of the polypeptide is such as
Shown in SEQ ID NO:3.
In certain embodiments of the present invention, the nucleic acid molecules of amino acid sequence shown in SEQ ID NO:3 are encoded
Nucleic acid sequence is as shown in SEQ ID NO:4.
Sixth aspect present invention provides the polypeptide of the peptide T vigour A or the nucleic acid molecule encoding
Tvigour A is inhibiting the application in scar cell Proliferation.
Seventh aspect present invention provides the polypeptide of the peptide T vigour A or the nucleic acid molecule encoding
Tvigour A is promoting the application in skin normal fibroblast proliferation.
Eighth aspect present invention provides the polypeptide of the peptide T vigour A or the nucleic acid molecule encoding
Tvigour A is promoting the application in bioactive molecule Transdermal absorption.
In certain embodiments of the present invention, the bioactive molecule be active peptides, reactive protein or nucleic acid,
In, the polypeptide, which has, efficiently wears film activity, the large biological molecules cross-film such as other polypeptides, albumen, nucleic acid can be promoted to import thin
In born of the same parents, the Transdermal absorption efficiency of other active components can be significantly improved.
In other embodiments of the invention, the Transdermal absorption effect of the peptide T vigour A is by Tvigour
The high molecular weight protein that A is carried positions to evaluate in different cells.
Ninth aspect present invention provides the polypeptide or the nucleic acid molecules or the expression cassette or the weight
Group carrier is preparing the application in external preparation for skin product, especially dermal tissue insult regeneration and the product for repairing aspect.
In certain embodiments of the present invention, tissue repair effect of the peptide T vigour A is normal by promoting
Fibroblastic proliferation activity inhibits the proliferative conditions of scar cell to be evaluated.
In other embodiments of the invention, the peptide T vigour A can be prepared by mixing into doctor with other auxiliary materials
With product, skin care item or cosmetics.
In other embodiments of the invention, the preparation type of the product is solution, lyophilized preparation, emulsion, frost
Agent, gel, facial mask or dressing.
In some preferred embodiments of the invention, the peptide T vigour A is applied to medical treatment or change
When in cosmetic, medicinal or cosmetic can be properly added and be prepared into finished product.
In other preferred embodiments of the invention, the peptide T vigour A can be auxiliary with other cosmetics
Material, which combines, is prepared into freeze-drying powder product and essence product etc..
Compared with prior art, the invention has the following advantages that vigor, which repairs peptide TvigourA, has Transdermal absorption and group
Knit reparation double effects.In the repair process to tissue, TvigourA has active influence to the regeneration of cambium, together
When TvigourA scar cell Proliferation is shown to inhibit the phenomenon that, this illustrates that Tvigour A has the generation of scar and inhibits
Effect reduces the generation of scar during skin injury.Meeting the growing pursuit side to self-image and beauty of people
Face has great importance.
On the other hand, vigor repairs peptide TvigourA and other molecules (especially macromolecular polypeptides, proteinaceous molecule)
When sharing, the transdermal absorption factor of other molecules can be improved, to efficiently solve the saturating of polypeptide bioactive molecule and drug
The low problem of skin absorption efficiency.Therefore, the inventors found that vigor repair peptide TvigourA wound, cutting
Wound, burn are whole after repairing, sensitive flesh reparation, tender skin, desalinating microgroove, is anti-ageing, improving skin resistance, improving skin quality, laser operation
Shape reparation aspect and whitening spot-removing etc. have broader development prospect.
Detailed description of the invention
Illustrate the present invention below in conjunction with attached drawing.
Fig. 1 shows the control group after 0h, 48h and 96h, TvigourA+BSA-EGFP, BSA-EGFP and TvigourA-
The effect of EGFP albumen inhibition people's scar fibroblast proliferation, wherein EGFP is green fluorescent protein, and BSA is that ox blood is pure
Albumen, black scale is 100 μm in figure；
Fig. 2 shows under laser confocal microscope, Tvigour A-EGFP and the Tvigour A+BSA-EGFP of observation
To the transduction of Balb/c 3T3 and HaCat cell, fluorescence is observed in white arrow instruction in cytoplasm in figure.White mark
Ruler is 20 μm；
Fig. 3 is shown under the laser confocal microscope visual field, using immunofluorescence analysis PDGF in PC12 cell traffic feelings
Condition.Fig. 3 a is that PDGF is mediated to be transported into PC12 cell using Tvigour A when 1h, 2h, 4h and 8h, and Fig. 3 b is 1h, 2h, 4h
And PDGF is transported into PC12 cell when 8h.Wherein, white indicates nucleus in A column, the light areas of arrow meaning in B column
It indicates to indicate Tubulin- with the light closed area of arrow instruction in the PDGF that the antibody for being loaded with green fluorescence combines, C column
The cytoskeleton of Tracker Red (micro-pipe red fluorescence probe) dyeing, D is the picture that A, B, C are combined；
Fig. 4 shows the content using enzyme linked immunosorbent assay (ELISA) (ELISA) analysis BSA, with the concentration of standard items for horizontal seat
Mark, OD 450nm value are that ordinate draws standard curve and calculating fits curve, quadratic polynomial fitting: y=a+bx+cx^2,
Fitting coefficient: a=7.57E-02, b=1.60E-02, c=-4.03E-05.Phase is found out by standard curve according to the OD value of sample
The concentration answered calculates the actual content of BSA in cuticula multiplied by extension rate.
Specific embodiment
To keep the present invention easier to understand, below in conjunction with embodiment, the present invention will be described in detail, these embodiments are only
Serve illustrative, it is not limited to application range of the invention, unmentioned specific experiment method in the following example, usually
It is carried out according to routine experiment method.
It should be appreciated by those skilled in the art that unless otherwise instructed, reagent as used in the following examples is commercially available point
Analyse the reagent of pure rank.
The present inventor's creativeness finds that a kind of vigor repairs peptide Tvigour A, with Transdermal absorption and group
Knit reparation double effects.In the repair process to tissue, TvigourA has active influence to the regeneration of cambium, together
When TvigourA scar cell Proliferation is shown to inhibit the phenomenon that；With other molecules (especially macromolecular polypeptides, protein-based
Molecule) when sharing, the transdermal absorption factor of other molecules can be improved, to efficiently solve polypeptide bioactive molecule and drug
Transdermal absorption inefficiency the problem of.
In a specific embodiment of the invention, the vigor repairs peptide Tvigour A and passes through molecular cloning
Method preparation.
Below by specific embodiment, the invention will be further elaborated:
Embodiment 1
The preparation of vigor reparation peptide Tvigour A
Vigor repairs the preparation method of peptide Tvigour A (amino acid sequence is as shown in SEQ ID NO:1), including following step
It is rapid:
(1) vigor of coding is repaired to DNA fragmentation (nucleotide sequence shown in SEQ ID NO:2, the DNA of peptide Tvigour A
Segment is synthesized by Shanghai Jierui Biology Engineering Co., Ltd) it is cloned into prokaryotic expression carrier pET3c, it newly constructs and recombinantly expresses
Plasmid pET3c-Tvigour A；
The primer for carrying out molecular cloning is as follows:
Upstream primer: AAGATGAAGGGTAGAAA, as shown in SEQ ID NO:5；
Downstream primer: TTGCAAACCTGGAGCTCC, as shown in SEQ ID NO:6.
(2) plasmid built is transformed into e. coli bl21 (DE3), ammonia benzyl antibiotic-screening method preferably recombinates
Son；
(3) IPTG (1mmol/L) inducing expression, optimization of fermentation conditions, IPTG inducing expression collect thallus；
(4) after carrying out homogeneous crusher machine to thallus, pass through cation-exchange chromatography (M-Crystarose Fast Flow)
It isolates and purifies to obtain vigor reparation peptide Tvigour A with molecular sieve (Sephadex G-25) combination.
Embodiment 2
The preparation of vigor reparation peptide Tvigour A
Vigor repairs the preparation method of peptide Tvigour A (amino acid sequence is as shown in SEQ ID NO:3), including following step
It is rapid:
(1) vigor of coding is repaired to DNA fragmentation (nucleotide sequence shown in SEQ ID NO:4, the DNA of peptide Tvigour A
Segment is synthesized by Shanghai Jierui Biology Engineering Co., Ltd) it is cloned into prokaryotic expression carrier pET3c, it newly constructs and recombinantly expresses
Plasmid pET3c-Tvigour A；
The primer for carrying out molecular cloning is as follows:
Upstream primer: CATCATCATCATCATCATAAGATG, as shown in SEQ ID NO:7；
Downstream primer: TTGCAAACCTGGAGCTCC, as shown in SEQ ID NO:6.
(2) plasmid built is transformed into e. coli bl21 (DE3), ammonia benzyl antibiotic-screening method preferably recombinates
Son；
(3) IPTG (1mmol/L) inducing expression, optimization of fermentation conditions, IPTG inducing expression collect thallus；
(4) after carrying out homogeneous crusher machine to thallus, by Ni column affinity chromatography (Ni Sepharose 6Fast Flow) and
Molecular sieve (Sephadex G-25) combination isolates and purifies to obtain vigor reparation peptide Tvigour A.
Embodiment 3
The preparation of the freeze-dried powder of peptide Tvigour A is repaired comprising vigor
1) liquid composition before the freeze-dried powder for repairing peptide Tvigour A containing vigor is lyophilized
Before the freeze-dried powder that vigor repairs peptide Tvigour A is lyophilized in liquid, the mass percent of each component is as follows:
2) preparation method of the freeze-dried powder of peptide Tvigour A is repaired containing vigor
Step 1: hyaluronic acid is soluble in water, and swelling is stayed overnight at room temperature, then high pressure sterilization (121 DEG C, 20min),
It is cooled to room temperature, obtains solution A；
Step 2: soluble collagen being dissolved in water, proteoglycan and Tvigour A are then added thereto, obtains molten
Liquid B；
Step 3: by solution B filtration sterilization, obtaining solution C；
Step 4: aseptically, the A and C solution that sterilizing is completed are mixed, first pre-freeze 5h under the conditions of -20 DEG C, so
After be transferred to -80 DEG C under the conditions of pre-freeze 2h, be finally freeze-dried for 24 hours, can obtain in -20 DEG C~-75 DEG C of freeze drier
To required freeze-dried powder product.
Embodiment 4
The preparation of peptide Tvigour A and restructuring lactoferrin freeze-dried powder are repaired comprising vigor
1) peptide Tvigour A is repaired containing vigor and preceding liquid composition is lyophilized in restructuring lactoferrin freeze-dried powder
Before the freeze-dried powder for repairing peptide Tvigour A and restructuring lactoferrin containing vigor is lyophilized in liquid, each component
Mass percent is as shown in the table:
2) preparation method of peptide Tvigour A and lactoferrin freeze-dried powder are repaired comprising vigor
Step 1: hyaluronic acid is soluble in water, and swelling is stayed overnight at room temperature, then high pressure sterilization (121 DEG C, 20min),
It is cooled to room temperature, obtains solution A；
Step 2: soluble collagen being dissolved in water, mannitol, proteoglycan, Tvigour A are then added thereto
And restructuring lactoferrin (Wuhan standing grain member), obtain solution B；
Step 3: by solution B filtration sterilization, obtaining solution C；
Step 4: aseptically, the A and C solution that sterilizing is completed are mixed, first pre-freeze 5h under the conditions of -20 DEG C, so
After be transferred to -80 DEG C under the conditions of pre-freeze 2h, be finally freeze-dried for 24 hours, can obtain in -20 DEG C~-75 DEG C of freeze drier
To required freeze-dried powder product.
Embodiment 5
The preparation of the Essence of peptide Tvigour A is repaired comprising vigor
1) composition of the Essence of peptide Tvigour A is repaired containing vigor
In the final Essence obtained for repairing peptide Tvigour A comprising vigor, the mass percent of each component is as follows:
2) preparation method of the Essence of peptide Tvigour A is repaired containing vigor
Step 1: Sodium Hyaluronate, hydroxyethyl cellulose and ultrapure water are mixed according to formula rate, it is after mixing evenly, molten
It is swollen to obtain component A for 24 hours, it is spare；
Step 2: by alkyl-glucoside, glycerol, butanediol, 1,2- hexylene glycol and parahydroxyacet-ophenone according to recipe ratio
Example is uniformly mixed, and obtains component B, and in the component A that swelling is completed, component B is added, stirs evenly, high pressure steam sterilization,
It 121 DEG C, is taken out after 20min；
Step 3: the mixed solution placement of the sterilized completion in step 2 being cooled down at room temperature, in superclean bench
Operation, is added the Phenoxyethanol of formulation content, and stir evenly；
Step 4: in superclean bench, the Tvigour A after filtration sterilization being added to the mixed solution in step 3
In, it stirs evenly；
Step 5: the sample that preparation is completed being dispensed into the cillin bottle of 3mL, every bottle of 3mL, gland, saved.
Embodiment 6
Vigor repairs influence of the peptide Tvigour A to people's scar fibroblast proliferation
The growth conditions of the fibroblasts from hypertrophic scars of the repairing effect and people of human skin tissue are closely related, therefore this hair
Vigor has been probed into bright repairs influence of the peptide Tvigour A to people's fibroblasts from hypertrophic scars.Tvigour A+ has been probed into below
Shadow of the three kinds of fluorescins such as BSA-EGFP, BSA-EGFP and Tvigour A-EGFP to people's scar fibroblast proliferation
It rings, wherein EGFP is green fluorescent protein.
Specific operating procedure is as follows:
Step 1: cicatricial tissue (offer of shaped laser section, No.1 Hospital Attached to Jinan Univ.) is dual anti-in 2-3 times of addition
Repeated multiple times flushing in PBS is cut into remaining tissue using sterile scalpel and scissors after removing unwanted tissue
3~4mm small pieces pass through the balanced salt solution cleansing tissue fragment of not calcium-magnesium-containing.It allows fragment of tissue to precipitate, removes supernatant.Weight
It cleans 2 to 3 times again.The culture dish for filling fragment of tissue is placed on ice, remaining supernatant is removed.0.25% is added without calcium and magnesium
Trypsase (about 100mg tissue be added 1ml trypsase).It is incubated overnight, makes almost without tryptic activity at 4 DEG C
Enzyme permeates as far as possible.The trypsase in fragment of tissue is discarded, it is broken that the tissue comprising residual trypsase is incubated at 37 DEG C
Piece 20 to 30 minutes.The complete medium of heat is added in fragment of tissue, with pipette lightly dispersion tissue.By sterile stainless
Steel wire (100~200mm) filtering disperses all remaining tissues.It counts and inoculating cell, height of the addition containing 10%FBS is sugared
DMEM is cultivated.Above method culture cell changed liquid after 36 hours for the first time, continues culture and merges to cell 70-80%,
The digestion of 0.25% pancreatin passes culture by 1:2.
Step 2: cell routine culture to 80-90% converges, and is digested with 0.25% pancreatin, cell is collected by centrifugation, with containing
Cell is resuspended in the 90%H-DMEM culture medium of 10%FBS, adjusts cell suspension density, is inoculated in 20000/hole of cell density
In the orifice plate of 24 orifice plates, at 37 DEG C, 5% CO2It is cultivated under concentration and carries out drug treatment afterwards for 24 hours；
Step: 3: by Tvigour A+BSA-EGFP of same molar ratio, BSA-EGFP and Tvigour A-EGFP
Albumen is added drop-wise to respectively in the different holes in 24 orifice plates of step 1, so that protein solution is uniformly distributed, and is marked, it is spare
(control group is blank orifice plate)；
Step 4: at 37 DEG C, 5% CO2Culture is to 48h and 96h under concentration, and recorder's fibroblasts from hypertrophic scars is in difference
Proliferative conditions under the conditions of albumen.
It can be seen that the increase with incubation time, increasing of people's fibroblasts from hypertrophic scars in three kinds of albumen from attached drawing 1
The effect of being suppressed is grown, and the inhibiting effect of Tvigour A-EGFP is most obvious, the BSA-EGFP albumen without Tvigour A
It is minimum to the inhibiting effect of scar cell Proliferation.It can be said that bright, Tvigour A albumen is to people's scar fibroblast proliferation
Inhibited, this has positive meaning for the reparation of the skin repair of people or its hetero-organization.
Embodiment 7
Vigor repairs the influence that peptide Tvigour A is proliferated people's normal fibroblast
The repairing effect of human skin tissue is not only closely related with the growth conditions of the fibroblasts from hypertrophic scars of people, but also
It is also closely bound up with normal fibroblastic growing state, the reparation of tissue do not require nothing more than proliferation of hypertrophic scar fibroblasts by
To inhibition, while being also contemplated that the surface of a wound quickly heals, i.e. the fast breeding of normal fibroblast.The surface of a wound after repairing in this way just may be used
The generation of scar can be reduced, to meet the growing pursuit to self-image and beauty of people.Specific operating procedure is as follows
It is shown:
Step 1: child's foreskin (being provided by No.1 Hospital Attached to Jinan Univ.'s reproduction surgery) after cyclic annular resection, Yu Chao are provided
With containing penicillin 2 × 10 on net workbench5U/L, streptomysin 200mg/L PBS sufficiently wash, reject subcutaneous tissue, be cut into about
2mm × 2mm fritter is placed in II Collagenase Type digestive juice of 1g/L and digests overnight (about 18h) for 4 DEG C, removes epidermis.Corium is cut
It is broken, it is then transferred to about 15min in 25.g/L trypsase, the high sugar-DMEM culture solution of 10%FBS terminates digestion, 1000r/
Min is centrifuged 3min, and sediment is inoculated in 25cm2Tissue Culture Flask adds the high sugar-DMEM culture solution containing 10%FBS on a small quantity, sets
In 37 DEG C, volume fraction 5%CO2It is cultivated in incubator, adds culture solution within second day.Cell covers with about 80% or more and can pass
Generation, 1.25g/L pancreatin digest about 30s, and the DMEM culture solution of 10%FBS stops digestion, and suction pipe gently blows and beats cell, 1000r/
Min is centrifuged 3min, abandons supernatant, passes on by 1: 2 inoculation, routine culture.
Step 2: people's normal fibroblast routine culture of culture medium containing 90%DMEM+10%FBS to logarithmic growth phase,
It is digested with 0.25% pancreatin, cell is collected by centrifugation, cell is resuspended with the 90%DMEM culture medium containing 10%FBS, adjustment cell is outstanding
Liquid density, with 5 × 104The cell number of a/mL is inoculated in 96 orifice plates.
Step: 3: after culture for 24 hours, changing plasma-free DMEM medium culture, be separately added into after culture medium is sucked out afterwards for 24 hours dense
Degree for 40.00,10.00,2.50,0.63, (positive control is given birth to by Ji'nan University's medicine by the Tvigour A and EGF of 0.15ng/mL
Object technical research development centre provides) each concentration sets 3 multiple holes, and blank group is six multiple holes.
Step 4: being put into incubator after administration and continue to cultivate 72h, 10 μ l MTT (thiazolyl blue 0.5mg/ml, purchased from beauty is added
State sigma), after being incubated for 4h in incubator, solution in hole is sucked out and 100 μ l DMSO are added, is examined under 570nm wavelength after oscillation
Survey absorbance OD value.Proliferation rate %=(administration group OD value/blank control group OD value -1) × 100%.It the results are shown in Table 1.
1. people's normal fibroblast proliferation rate (%) of table (n=3,)
As shown in table 1, Tvigour A of the invention has the function of promoting people's normal fibroblast proliferation, and has
Concentration dependent.
Embodiment 8
Vigor repairs positioning of the high molecular weight protein of peptide Tvigour A mediation in different cells
It tests Balb/c 3T3 cell, HaCat cell and PC12 cell used and is purchased from the training of Wuhan University's Chinese Typical Representative
Support object collection.
Exploration vigor repairs the high molecular weight protein (BSA is model protein) of peptide Tvigour A mediation in different cells
Positioning judges the quantity into the high molecular weight protein of cell by fluorescence intensity.
Specific operating procedure is as follows:
Experiment one,
Step 1: the culture of l cell
Balb/c 3T3 cell use contain 10% newborn bovine serum culture medium culture, 1-2d replace a culture solution, 2-3d into
The primary passage of row.After cell growth condition is good, with -0.01% digestive juice of 0.25% trypsase of 1mL, 37 DEG C of digestion
5min.EDTA- pancreatin digestive juice is removed, the piping and druming of 4-5mL EDTA complete culture solution is added, single cell suspension is made.Cell is hanged
Liquid is diluted to density 1 × 106/ mL is inoculated in new culture bottle with the volume of every bottle of 3mL.
The culture of step 2:HaCat cell
HaCat cell, which is used, contains 10% culture of newborn bovine serum culture medium (every liter of nonessential amino acid containing 10mL and 0.11g third
Ketone acid sodium), 2-3d replaces a culture solution, and 3-4d is once passed on.After cell growth condition is good, with 1mL 0.25%
- 0.01% digestive juice of trypsase, 37 DEG C of digestion 5-10min.Pancreas enzyme -EDTA digestive juice is removed, it is complete that 4-5Ml EDTA is added
Culture solution is blown and beaten to single cell suspension.Cell suspension is diluted to density 1 × 106/ mL is inoculated in newly with the volume of every bottle of 3mL
Culture bottle in.
Step 3: Mice Inoculated fibroblast (Balb/c 3T3) and application on human skin horn cell are distinguished on culture plate
(HaCat), culture is added the Tvigour A-EGFP and Tvigour A+BSA-EGFP of final concentration of 10 μ g/ml afterwards for 24 hours, and 37 DEG C
Cultivate 8h.Cell, the fixed 10min of paraformaldehyde are collected in different time points.And use confocal laser scanning microscope.
As a result as shown in Fig. 2, Tvigour A-EGFP and Tvigour A+BSA-EGFP can pass through Balb/c 3T3
With the cell membrane of HaCat, and it is primarily targeted in cytoplasm.
Experiment two:
Step 1: the culture of the thermophilic chromium nerve tumor cell strain PC12 cell of rat
PC12 cell is taken out from -80 DEG C of refrigerators, is quickly put, makes its fast melt in 37 DEG C of water-baths.Alcohol disinfecting freezes
After depositing pipe nozzle, with suction pipe be sucked out cell suspension be placed in the centrifuge tube for having complete medium 5mL containing DMEM, 1000rmp from
Heart 10min abandons supernatant.Cell precipitation is resuspended with 5mL DMEM complete medium, repeated washing is primary, and piping and druming uniformly, makes into list
Cell suspension.Then with density 1 × 106/ mL is inoculated in Tissue Culture Flask, at 37 DEG C, culture that gas concentration lwevel is 5%
It is cultivated in case.The every 2-3d replacement of the culture solution of PC12 cell is primary, and passage inoculation is carried out when cell is collected to 80%.Use suction pipe
Cell culture fluid is sucked out, D-Hank`s liquid cleans 2 times.0.25% pancreatin 1-2mL is added in culture bottle, and front-rear direction gently shakes
It shakes, while observing cellular morphology under inverted microscope, when cell process shortens, gap is broadening, i.e. the digestion of termination pancreatin is anti-
Answer process.Pancreatin is sucked out, the PC12 cell on DMEM complete medium piping and druming culture bottle bottom wall is added, makes into single cell suspension,
Then a little cell suspension is taken, cell number is counted in cell counting board, cell suspension is diluted to density 1 × 106/ mL,
It is inoculated in every bottle of 3mL of volume in new culture bottle.
Step 2: being inoculated with the thermophilic chromium nerve oncocyte (PC12) of rat respectively on culture plate, final concentration is added in culture afterwards for 24 hours
For the Tvigour A+PDGF and PDGF of 10 μ g/ml, 37 DEG C of culture 8h.Cell is collected in different time points, and paraformaldehyde is fixed
10min.After cleaning, the PBS containing 5%BSA is added and closes 60min, PDGF primary antibody (Affinity, BeiJing, China) 4 is then added
It DEG C is incubated overnight, FITC label secondary antibody (not moral biology, Hangzhou China), Tubulin-Tracker Red (micro-pipe is added after washing clearly
Red fluorescence probe) carry out cytoskeleton dyeing, Hoechst 33258 (blue fluorescent dyes) carry out nucleus dyeing,
And use confocal laser scanning microscope.
Attached drawing 3a and attached drawing 3b shows that Tvigour A+PDGF and PDGF can pass through the cell membrane of PC12 cell, and positions
In cell membrane and cytoplasm.Two groups compare, and the amount of Tvigour A+PDGF penetrating cell film is more, and reaches in 2 hours or so
To peak value, this shows that Tvigour A can carry more PDGF and enter into the cell.With the extension of incubation time, Tvigour A
+ PDGF and PDGF gradually hydrolyzes (green fluorescence starts to weaken) by cell.After cultivating 8h, two kinds of albumen are substantially by complete generation
Thank (green fluorescence substantially completely disappears).
Embodiment 9
Vigor repairs peptide Tvigour A healthy volunteer's skin and absorbs test
Vigor repair peptide Tvigour A healthy volunteer's skin absorb test specific steps are as follows:
Step 1: it is 2.0mg/mL (being calculated with BSA) that TvigourA+BSA, BSA protein solution, which are adjusted separately concentration,；
Step 2: Tvigour A+BSA, BSA protein solution wetting cotton pads being taken to spread on test zone.It is used after 15s respectively
Paper handkerchief, which presses lightly on, sucks unabsorbed solution；
Step 3: D-squame R disk (diameter 22mm) is sticked in into test zone uniformly by (index finger pressing 12 after flattening
Secondary, each sucker need to be placed on same location), D-squame R disk is removed, same test zone is repeated 15 times (primary to paste generation
One layer of cuticula of table)；
Step 4: extracting the albumen in each D-squameR disk with 1mL purified water, extraction conditions is vortex 2min, ultrasound
(100HZ) 10min, extract liquor is after membrane filtration with the content of enzyme linked immunosorbent assay (ELISA) (ELISA) analysis BSA.
2 ELISA method of table measure cuticula in BSA content (n=3,)
Using the concentration of standard items as abscissa, OD 450nm value is that ordinate draws standard curve and calculating fits curve,
Corresponding concentration is found out by standard curve according to the OD value of sample, multiplied by extension rate, calculates the actual concentrations of sample.
As shown in attached drawing 4 and table 2, Tvigour A+BSA, BSA protein solution, can be in epidermises after contacting skin 10s
Layer detect that BSA's penetrates absorption, wherein the penetration of BSA is most in first layer cuticula, and cuticula is deeper, penetration by
It is decrescence few.For Tvigour A+BSA group compared with BSA group, the content for the BSA that each layer of cuticula strips down is bigger.Work as removing
For cuticula to after the 13rd layer, BSA group is nearly no detectable the presence of BSA, and Tvigour A+BSA still can detecte it is a small amount of
BSA.The result shows that Tvigour A+BSA, BSA energy fast skin penetration cuticula, and in the same time,
Tvigour A+BSA penetrates the speed of skin and depth is higher than BSA, thus speculates, when smearing skin, Tvigour A can be taken
Enter in skin with more BSA through skin barrier.
It should be noted that embodiment described above for explaining only the invention, is not constituted to of the invention any
Limitation.By referring to exemplary embodiments, invention has been described, it should be appreciated that word used in it is descriptive
With explanatory vocabulary, rather than limited vocabulary.The present invention can be made within the scope of the claims by regulation
Modification, and the present invention is revised in without departing substantially from scope and spirit of the present invention.Although the present invention described in it relates to
And specific method, material and embodiment, it is not intended that the present invention is limited to particular case disclosed in it, on the contrary, this hair
It is bright to can be extended to other all methods and applications with the same function.
Sequence table
<110>Biopharmaceutial Research & Development Center of Jinan University
Guangzhou and reach Biotechnology Co., Ltd
<120>a kind of vigor repairs peptide Tvigour A and its application
<130> IB192135
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 30
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 1
Lys Met Lys Gly Arg Lys Ala Arg Leu Glu Lys Arg Gly Arg Lys Gly
1 5 10 15
Ala Pro Gly Ala Pro Gly Ser Gln Gly Ala Pro Gly Leu Gln
20 25 30
<210> 2
<211> 90
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
aagatgaagg gtagaaaggc tagattagaa aaacgcggac gcaaaggtgc tccaggtgcc 60
cctggatctc aaggagctcc aggtttgcaa 90
<210> 3
<211> 36
<212> PRT
<213>artificial sequence (Artificial Sequence)
<400> 3
His His His His His His Lys Met Lys Gly Arg Lys Ala Arg Leu Glu
1 5 10 15
Lys Arg Gly Arg Lys Gly Ala Pro Gly Ala Pro Gly Ser Gln Gly Ala
20 25 30
Pro Gly Leu Gln
35
<210> 4
<211> 108
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
catcatcatc atcatcataa gatgaagggt agaaaggcta gattagaaaa acgcggacgc 60
aaaggtgctc caggtgcccc tggatctcaa ggagctccag gtttgcaa 108
<210> 5
<211> 17
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
aagatgaagg gtagaaa 17
<210> 6
<211> 18
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 6
ttgcaaacct ggagctcc 18
<210> 7
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 7
catcatcatc atcatcataa gatg 24
Claims (14)
1. a kind of peptide T vigour A, amino acid sequence includes the amino acid sequence contained 1) or 2):
1) amino acid sequence shown in SEQ ID NO:1；
2) amino acid sequence shown in SEQ ID NO:1 through conservative substitution, missing or adds more than one and has and SEQ ID
The amino acid sequence with the same function of amino acid sequence shown in NO:1, it is preferable that ammonia shown in described and SEQ ID NO:1
Base acid sequence amino acid sequence with the same function and the homology of amino acid sequence shown in SEQ ID NO:1 are not less than
90%.
2. peptide T vigour A according to claim 1, which is characterized in that the polypeptide is with no more than 35 ammonia
The polypeptide of base acid length, preferably no greater than 32 amino acid lengths.
3. encoding the nucleic acid molecules of the described in any item polypeptides of claim 1-2.
4. nucleic acid molecules according to claim 3, which is characterized in that the DNA sequence dna of the nucleic acid molecules includes containing 1)
Or 2) DNA sequence dna:
1) DNA sequence dna shown in SEQ ID NO:2；
2) DNA sequence dna shown in SEQ ID NO:2 through conservative substitution, missing or adds more than one base, and has and SEQ
The DNA molecular with the same function of DNA sequence dna shown in ID NO:2, it is preferable that DNA sequence shown in described and SEQ ID NO:2
The homology of DNA sequence dna shown in the DNA sequence dna and SEQ ID NO:2 of DNA molecular with the same function is arranged not less than 90%.
5. a kind of expression cassette, it includes the nucleic acid molecules described in claim 3 or 4.
6. a kind of recombinant vector, it includes the nucleic acid molecules described in claim 3 or 4.
7. a kind of N-terminal or C-terminal in peptide T vigour A of any of claims 1 or 2 connects the more of a His label composition
Peptide.
8. the polypeptide of nucleic acid molecule encoding described in polypeptide of any of claims 1 or 2 or claim 3 or 4 is inhibiting scar
Application in cell Proliferation.
9. the polypeptide of nucleic acid molecule encoding described in polypeptide of any of claims 1 or 2 or claim 3 or 4 is promoting skin
Application in normal fibroblast proliferation.
10. the polypeptide of nucleic acid molecule encoding described in polypeptide of any of claims 1 or 2 or claim 3 or 4 is promoting activity
Application in molecule Transdermal absorption.
11. application according to claim 10, which is characterized in that the bioactive molecule is active peptides, reactive protein
Or nucleic acid.
12. table described in nucleic acid molecules described in polypeptide of any of claims 1 or 2 or claim 3 or 4 or claim 5
The answering in the product in terms of the regeneration and reparation of preparation skin injury up to frame or recombinant vector as claimed in claim 6
With.
13. application according to claim 12, which is characterized in that the product is curable product, skin care item or cosmetics.
14. application according to claim 12 or 13, which is characterized in that the preparation type of the product is solution, freeze-drying
Preparation, emulsion, creme, gel, facial mask or dressing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910663377.8A CN110526958B (en) | 2019-07-22 | 2019-07-22 | Activity repair peptide Tvigour A and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910663377.8A CN110526958B (en) | 2019-07-22 | 2019-07-22 | Activity repair peptide Tvigour A and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110526958A true CN110526958A (en) | 2019-12-03 |
| CN110526958B CN110526958B (en) | 2022-04-29 |
Family
ID=68660434
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910663377.8A Active CN110526958B (en) | 2019-07-22 | 2019-07-22 | Activity repair peptide Tvigour A and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110526958B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112321723A (en) * | 2020-10-23 | 2021-02-05 | 广州暨南大学医药生物技术研究开发中心有限公司 | Polypeptide compound for resisting skin photoaging and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1303948A (en) * | 2000-01-07 | 2001-07-18 | 广州暨南大学医药生物技术研究开发中心 | Method for secreting and expressing acid fibroblast growth factor |
| CN1541107A (en) * | 2000-09-22 | 2004-10-27 | ��ʿ����ѧ | Growth factor complex |
| US20050181973A1 (en) * | 2003-06-25 | 2005-08-18 | Massachusetts Institute Of Technology | Self-assembling peptides incorporating modifications and methods of use thereof |
| CN106986944A (en) * | 2017-04-05 | 2017-07-28 | 湖南爱可生物科技有限公司 | Recombinate ternary fusion collagen and its application |
| US20170260504A1 (en) * | 2009-05-19 | 2017-09-14 | University Of Rochester | Ultrasound technology to control the spatial organization of cells and proteins in engineered tissues |
-
2019
- 2019-07-22 CN CN201910663377.8A patent/CN110526958B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1303948A (en) * | 2000-01-07 | 2001-07-18 | 广州暨南大学医药生物技术研究开发中心 | Method for secreting and expressing acid fibroblast growth factor |
| CN1541107A (en) * | 2000-09-22 | 2004-10-27 | ��ʿ����ѧ | Growth factor complex |
| US20050181973A1 (en) * | 2003-06-25 | 2005-08-18 | Massachusetts Institute Of Technology | Self-assembling peptides incorporating modifications and methods of use thereof |
| US20170260504A1 (en) * | 2009-05-19 | 2017-09-14 | University Of Rochester | Ultrasound technology to control the spatial organization of cells and proteins in engineered tissues |
| CN106986944A (en) * | 2017-04-05 | 2017-07-28 | 湖南爱可生物科技有限公司 | Recombinate ternary fusion collagen and its application |
Non-Patent Citations (4)
| Title |
|---|
| JINMEI XU等: "Evaluation of the Safety and Brain-Related Tissues Distribution", 《BIOLOGICAL AND PHARMACEUTICAL BULLETIN》 * |
| ZHANG BEI-BEI等: "Safety Evaluation of GP-EGF Lyophilised Powder", 《LAWARENCE PRESS》 * |
| 孙宏等: "蛋白水解物的生产和抗氧化活性评价及其作用机理", 《中国畜牧杂志》 * |
| 李燕梅等: "酸性成纤维细胞生长因子的促细胞增殖作用和对实验秃毛大鼠的疗效研究", 《中国生物工程杂志》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112321723A (en) * | 2020-10-23 | 2021-02-05 | 广州暨南大学医药生物技术研究开发中心有限公司 | Polypeptide compound for resisting skin photoaging and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110526958B (en) | 2022-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110204608A (en) | One primary yeast fermentation small molecule recombination fibronectin peptide and its preparation method and application | |
| CN108753708B (en) | A kind of preparation method of Stem Cell Activity factor freeze-dried powder | |
| CN103102407A (en) | Genetic recombinant human-like collagen | |
| CN105132358B (en) | Method for obtaining tissue engineering epidermis by culture and application thereof | |
| CN113563452B (en) | Biological active peptide and application of biological active peptide and adipose-derived stem cell exosome in skin proliferation repair | |
| CN108330108A (en) | CH-GD-12-2014 plants of 3 type inactivated vaccine of Ana 1 aviadenovirus | |
| CN107224617A (en) | A kind of hydrogel using spleen cell epimatrix as raw material and preparation method thereof | |
| KR20120058865A (en) | Cosmetic composition for promoting the stemness of adipose-derived stem cell containing apple stem cell extracts | |
| CN114317661B (en) | Method for preparing multiple active collagen | |
| CN111888279A (en) | Method for promoting collagen production and corresponding medicine or cosmetic | |
| CN106084006A (en) | A kind of transdermal peptide and application thereof | |
| CN100581502C (en) | Human soft tissue filler for injection, and its preparation method | |
| CN110526958A (en) | A kind of vigor repairs peptide Tvigour A and its application | |
| CN107446022B (en) | Polypeptide PIP-14 capable of antagonizing RNA binding activity of PARP1 protein and application thereof | |
| CN109554454A (en) | A method of freeze-dried powder hair regrowth is evaluated by measurement cytokine content | |
| CN105194660B (en) | Ubiquitin specific proteinase 18（USP18）Function and application in myocardial hypertrophy is treated | |
| CN102498128B (en) | Peptide having activity of transforming growth factor and production method therefor | |
| CN109646459A (en) | A kind of water optoinjection instrument injection umbilical cord mesenchymal stem cells preparation and its application | |
| CN114432427B (en) | Application of anti-aging active peptide and bone marrow mesenchymal stem cells in preparation of anti-aging drugs | |
| CN110403958A (en) | The treatment pulmonary fibrosis of Stem Cell Activity peptide aerosol rebreathing method and Alevaire prepare | |
| CN108949730A (en) | A kind of preparation method and applications recombinating allosteric clostridiopetidase A | |
| CN109182264A (en) | Prepare the method for human adipose-derived stem cell culture solution and its application in cosmetic products | |
| CN101804071A (en) | Injection for treating skin defect and preparation method thereof | |
| CN103333915A (en) | Vegetable oil skin care lotion containing basic fibroblast growth factor active peptide | |
| CN111961119A (en) | Application of polypeptide in preparation of medicine or cosmetic for promoting collagen secretion |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 510630 floor 3, No.37, Huajing Road, Tianhe District, Guangzhou City, Guangdong Province Applicant after: Guangzhou Jinan University Medical Biotechnology Research and Development Center Co., Ltd Applicant after: Guangzhou Jida Biological Technology Co., Ltd. Address before: 510630 3, 37 Hua Jing Road, Tianhe District, Guangzhou, Guangdong. Applicant before: Medical and Biological Technology Research and Development Center, Jinan Univ. G Applicant before: Guangzhou Jida Biological Technology Co., Ltd. |
|
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |