CN110499292B - High-reactivity cell strain for detecting biological activity of recombinant human epidermal growth factor - Google Patents
High-reactivity cell strain for detecting biological activity of recombinant human epidermal growth factor Download PDFInfo
- Publication number
- CN110499292B CN110499292B CN201910415900.5A CN201910415900A CN110499292B CN 110499292 B CN110499292 B CN 110499292B CN 201910415900 A CN201910415900 A CN 201910415900A CN 110499292 B CN110499292 B CN 110499292B
- Authority
- CN
- China
- Prior art keywords
- rhegf
- cell strain
- cell
- nih3t3
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/475—Assays involving growth factors
- G01N2333/485—Epidermal growth factor [EGF] (urogastrone)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A high-reactivity cell strain for detecting the biological activity of recombinant human epidermal growth factor is prepared through measuring the living cell NIH3T3 by original rhEGF, randomly knocking out some genes in cell, picking up single clone to obtain the cell strain NIH3T3-CRSPRV2(6) with better reactivity to rhEGF, carrying out secondary sequencing and transcriptome heat map experiment on the cell strain NIH3T3-CRSPRV2(6), knocking out some genes Pcdhgb4 and H1fx, and respectively setting gRNA ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA. The specific detection steps are as follows: NIH3T3-CRSPRV2(6) was plated in 96-well plates at 6,000/well, starved with PBS for 30min, added with assay medium containing serial concentrations of rhEGF, acted for 48h, and cell activity was assayed by MTT. The detection method has the advantages of short operation time, sensitive reaction, higher signal-to-noise ratio and reduction of serum interference, and has important significance for the quality control and clinical application of rhEGF.
Description
The technical field is as follows:
the invention relates to the field of biological drug activity detection, and aims at biological activity determination of recombinant human epidermal growth factor (rhEGF) to screen out a cell line with high reactivity to rhEGF, so as to establish a faster and more accurate determination method.
Background art:
the recombinant human epidermal growth factor (rhEGF) is one kind of polypeptide capable of promoting the growth of various epidermal tissues and expressed in high efficiency and applied in gene engineering technology, and is used in treating burns, scalds, ulcer, various kinds of wound and cornea damage. The currently commonly used activity determination method is an NIH3T3 cell proliferation method, but the NIH3T3 cells have poor reactivity to rhEGF, so that the onset concentration is high; the experimental result has great variability; the experimental period was 6 days. Mouse CRISPR knock out Pooled Library (GeCKO v2) (purchased from Addgene company, constructed by Zhang Feng, and used as CRISPR-Cas9 knock-out Library) is packaged into a lentivirus Library, the Library is used for infecting NIH3T3 cells according to the MOI value of 0.3, the monoclonal is selected by a flow cytometer and then induced by rhEGF with low dose, an NIH3T3 cell line which is sensitive to the rhEGF reaction is screened, and the cell line is used for establishing a detection method for detecting the rhEGF and the derivative activity, which has low effect concentration, small variation and shorter experimental period.
The invention content is as follows:
the invention aims to screen a cell strain with better reactivity to rhEGF, and establish a rhEGF activity determination method with low effect concentration, small variation degree and shorter experimental period by using the cell strain, thereby promoting the research and development, quality control and clinical application of the product.
The purpose of the invention is realized as follows: a highly reactive cell strain NIH3T 3-CRISPERV 2(6) for detecting the biological activity of recombinant human epidermal growth factor, characterized in that: the original rhEGF is used for detecting living cells NIH3T3, after certain genes in the cells are randomly knocked out, a single clone is picked to obtain a cell strain NIH3T 3-CRISPERV 2(6) with better reactivity to the rhEGF, the NIH3T 3-CRISPERV 2(6) cell strain is identified by second-generation sequencing and transcriptome heat map experiments, the knocked-out certain genes are Pcdhgb4 and H1fx, and gRNA is ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA respectively.
A preparation method of a high-reactivity cell strain NIH3T 3-CRISPERV 2(6) for detecting the biological activity of recombinant human epidermal growth factor is characterized in that: an NIH3T3 cell strain with better reactivity to rhEGF, namely NIH3T3-CRISPR 2(6), is screened out by packaging Mouse CRISPR knock-out Pooled Library (GeCKO v2) into a lentivirus Library (LentiCRISPR), infecting NIH3T3 cells by the Library according to the MOI value of 0.3, sorting monoclones by a flow cytometer, inducing by using rhEGF with low dose, and identifying by second-generation sequencing and transcriptome thermograph experiments, certain knocked-out genes are Pcdkgb 4 and H1fx, and gRNA is ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA respectively.
A preparation method of a high-reactivity cell strain NIH3T 3-CRISPERV 2(6) is characterized in that: the preparation steps are as follows:
materials, reagents, instruments and analysis software
Materials:
mouse CRISPR Knockout Pooled Library (GeCKO v2) (# 1000000052): purchased in Addgene;
NIH3T3 cells: purchased from ATCC;
rhEGF standards and samples: reserving in a recombined medicine room of China institute for food and drug testing;
reagent:
growth medium: RPMI-1640(GIBCO, C11875500BT) + 10% fetal bovine serum (GIBCO, #10099) + 1%;
double antibody (GIBCO, # 15240);
puromycin: amresco, J593;
96-well plate: CORNING, 3599;
selecting a culture medium: growth medium + 4. mu.g/ml puromycin;
induction medium: selecting culture medium +3.2IU/ml rhEGF;
analysis of the medium: 500ml RPMI-1640+1ml fetal bovine serum;
the instrument comprises the following steps:
flow cytometer, BD-FACSAria, USA TM III, a cell sorting system;
microplate reader, SpectraMax M5;
data analysis software:
SoftMax Pro software;
sigmaPlot 12.0 software;
II, an experimental process:
1) construction of LentiCRISPR
100ng of Mouse CRISPR Knockout Poolled Library plasmid (GeCKO v2) (#1000000052) Library plasmid is taken, transformed to escherichia coli competent cells by electric shock, coated with ampicillin resistant LB plate for screening, ampicillin resistant clone extraction Library plasmid is collected, 120ug of plasmid Library and virus packaging plasmid are transfected to 293 cells together, LentiCRISPR virus is collected after 24 hours, and frozen; and (3) determining the virus titer: the value of the total number of starting cells × the number of purine-resistant cells/(number of purine-free cells × volume of virus) is the virus titer;
2) infection with disease
a) Collecting cells, counting, and spreading the cells in a 9cm dish;
b) after the cells are attached to the wall, LentiCRISPR is taken, and the cells are infected according to the MOI (equal to 0.3);
c) after 4 hours of infection, removing the infection liquid, and adding a growth medium for culturing for 48 hours;
3) pressure screening and monoclonal cell strain isolation culture
a) Removing the growth culture medium, adding selective culture medium, culturing for 1 week, and replacing the selective culture medium every 3-4 days until the cells do not die in large area;
b) the remaining cells were collected, resuspended in growth medium, and individual cells plated into each well of a 96-well plate using a flow cytometer for a total of 24 plates. Setting negative control of uninfected cells;
c) after 24h of culture, the growth medium was removed and induction medium was added. Negative control same treatment;
d) observing cell growth, and changing liquid until finding out cells with obviously accelerated growth speed under the induction of an induction culture medium compared with a negative control, and performing amplification culture;
4) validation and sequencing identification of highly reactive cell lines
Further verifying the cells subjected to the expanded culture, and screening out the cells which are cultured in a growth culture medium and have no obvious change in growth speed and negative control; under the culture of the induction culture medium, the cell strain with obviously accelerated growth speed is the rhEGF high-reactivity cell strain; obtaining rhEGF high-reactivity cell strain 5 strain, wherein NIH3T 3-CRISPERV 2(6) cell strain has the best reactivity;
thirdly, carrying out second-generation sequencing and transcriptome heat map identification on an NIH3T3-CRISPRV2(6) cell strain, and determining that the gene sequence structures of the cell strain are knocked-out genes Pcdgb 4 and H1fx, and gRNAs are ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA respectively.
The invention discloses a method for detecting biological activity of recombinant human epidermal growth factor and derivatives thereof by using a high-reactivity cell strain NIH3T 3-CRISPER 2(6), which is characterized by comprising the following steps: NIH3T 3-CRISPERV 2(6) at 6,000/well, laying 96-well plate, starving with PBS for 30min, adding assay medium containing rhEGF at serial concentrations, acting for 48h, and detecting cell activity by MTT method.
Wherein the pre-dilution concentration of the rhEGF is 10IU/ml, the rhEGF is diluted by 4 times, and the serum concentration of an analysis culture medium is 0.2 percent.
The invention has the beneficial effects that: the establishment of the detection method is beneficial to the research and development, quality control and clinical application of rhEGF medicines, and has higher application value.
Compared with the existing method, the method has the following advantages:
(1) the rhEGF has low effect concentration, and can better eliminate the interference of auxiliary materials in rhEGF medicines on the activity of the rhEGF;
(2) when the analysis culture is carried out, the serum concentration is reduced, and the interference of the growth factor in the serum to the activity of the rhEGF can be reduced;
(3) the period is short, and the method shortens the time by 2 days compared with the prior NIH3T3 cell proliferation method;
(4) the result is objective and reliable, the accuracy is high, and the variation is small.
Description of the drawings:
FIG. 1-1 shows growth comparison of selected monoclonal cells with negative control cells
FIGS. 1-2 growth rates of highly reactive cell lines stimulated by rhEGF
FIG. 2 transcriptome thermographic alignment of highly reactive and primary cell lines
FIG. 3 shows a novel method for detecting rhEGF and a method for detecting rhEGF of a protocell established by a highly reactive cell strain
FIG. 4 comparison of recovery rates of old and new activity-measuring methods
FIG. 5 method repeatability test of the newly established method
FIG. 6 shows the passage stability detection of the newly established method
FIG. 7 method specificity detection for the newly created method
FIG. 8-1 method consistency comparison of new and old liveness test methods
FIG. 8-2 Signal-to-noise ratio, R, of new and old activity-measuring method 2 、EC 50 And (6) comparing the values.
The specific implementation mode is as follows:
the invention packages Mouse CRISPR knock out Pooled Library (GeCKO v2) as slow virus Library (LentiCRISPR), and uses the Library to infect NIH3T3 cell according to MOI value of 0.3, then uses low-dose rhEGF to induce after flow cytometry to sort single clone, screens out NIH3T3 cell line with better reactivity to rhEGF, and then establishes corresponding detection method to quantify rhEGF activity. The technical process comprises the following steps: screening of NIH3T3 high-reactivity cell strain (after NIH3T3 cells are infected by LentiCRISPR, rhEGF is used for induction) → rhEGF activity determination method establishment and methodological verification.
1. The material and the method are as follows:
1.1 study subjects: recombinant human epidermal growth factor
1.2 Mouse CRISPR Knockout Pooled Library (GeCKO v2) (# 1000000052): purchased from Addgene.
NIH3T3 cells: purchased from ATCC.
rhEGF standards and samples: the recombinant medicine chamber of the Chinese institute for food and drug testing is reserved.
1.3 reagent:
growth medium: RPMI-1640(GIBCO, C11875500BT) + 10% fetal bovine serum (GIBCO, #10099) + 1%
Double antibody (GIBCO, #15240)
Puromycin: amresco, J593
96-well plate: CORNING, 3599
Selecting a culture medium: growth Medium + 4. mu.g/ml puromycin
Induction medium: selection Medium +3.2IU/ml rhEGF
Analysis of the medium: 500ml RPMI-1640+1ml fetal bovine serum
1.4 Instrument:
flow cytometer, BD-FACSAria, USA TM III cell sorting system
Microplate reader, SpectraMax M5
1.5 data analysis software:
SoftMax Pro software
sigmaPlot 12.0 software
1.6 Experimental protocol:
1.6.1 construction of LentiCRISPR
100ng of Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052) Library plasmid is taken, transformed into an escherichia coli competent cell by electric shock, coated with an ampicillin resistant LB plate for screening, ampicillin resistant clone extracted Library plasmid is collected, 120ug of plasmid Library and virus packaging plasmid are transfected to 293 cells together, LentiCRISPR virus is collected after 24 hours, and the obtained product is frozen and stored. And (3) virus titer determination: the value of the total number of starting cells × the number of purine-resistant cells/(number of purine-free cells × volume of virus) is the virus titer.
1.6.2 infection
1) Collecting cells, counting, and spreading the cells in a 9cm dish;
2) after the cells are adhered to the wall, the LentiCRISPR is taken to infect the cells according to the MOI of 0.3;
3) after 4 hours of infection, removing the infection liquid, and adding a growth culture medium for culturing for 48 hours;
1.6.3 pressure screening and isolation culture of monoclonal cell lines
1) Removing the growth culture medium, adding selective culture medium, culturing for 1 week, and replacing the selective culture medium every 3-4 days until the cells do not die in large area;
2) the remaining cells were collected, resuspended in growth medium, and individual cells were plated into each well of a 96-well plate using a flow cytometer for a total of 24 plates. Setting negative control of uninfected cells;
3) after 24h of culture, the growth medium was removed and induction medium was added. Negative control same treatment;
4) observing cell growth, and changing liquid until finding out cells with obviously accelerated growth speed under the induction of an induction culture medium compared with a negative control, and performing amplification culture;
1.6.4 validation and sequencing identification of highly reactive cell lines
Further verifying the cells subjected to the expanded culture, and screening out the cells which are cultured in a growth culture medium and have no obvious change in growth speed and negative control; and under the culture of the induction culture medium, the cell strain with obviously accelerated growth speed is the rhEGF high-reactivity cell strain. Obtaining rhEGF high-reactivity cell strain 5 strain, wherein NIH3T 3-CRISPERV 2(6) cell strain has the best reactivity, and the subsequent activity measurement method is carried out by adopting the cell strain. And performing secondary sequencing and transcriptome heat map identification on the cell strain.
1.6.5 establishment of the method for determining rhEGF activity (CRI-3T 3):
according to the test results, the cell density is 6,000/well, the cell is starved for 30min by PBS, the rhEGF pre-dilution concentration is 10IU/ml, the drug action time is 48h, and the dose response curve of rhEGF diluted by 4 times is detected.
1.6.6 methodological validation
1.6.6.1 recovery rate
The activity of 2 rhEGF samples were assayed separately using the newly established method (CRI-3T3) and the original method (3T3) with 50% recovery at standard addition, 3 replicate wells per dose.
1.6.6.2 precision
The activity of 2 rhEGF samples was assayed by a newly established method, the precision of which was checked, 3 replicates per dose, 9 times.
1.6.6.3 repeatability
Two persons use a new method to carry out activity determination on the same batch of rhEGF samples, and the repeatability of the method is detected, wherein 17 times is carried out for each person.
1.6.6.4 passage stability
And respectively using the 6 th generation, the 26 th generation and the 46 th generation of the high-reactivity cell strain NIH3T3-CRISPRV2(6) to carry out activity determination on the same rhEGF sample by using a new method, and detecting the passage stability of the cell for determining the activity of the rhEGF.
1.6.6.5 method specificity
The new method is used for respectively carrying out activity determination on rhEGF, rhEPO, rhG-CSF, rhGM-CSF, rhIL-2, rhIL-11, rhIFN-gamma and rhIFN-alpha 2b samples, and the specificity of the method for rhEGF activity determination is detected.
1.6.6.6 comparison of two activity measuring methods of the newly-built method (CRI-3T3) and the original method (3T3)
Respectively using newly-built method (CRI-3T3) and original method (3T3) to make activity determination of rhEGF sample, making several tests, and detecting method consistency, signal-to-noise ratio and R between two methods 2 And EC 50 A difference.
2. Results and discussion
2.1 LentiCRISPR infects cells with MOI of 0.3, and the aim is to infect the cells infected with lentivirus with only one lentivirus as far as possible, and to avoid infecting excessive lentivirus with one cell as far as possible, thereby facilitating analysis and verification. While MOI values of 0.3 were obtained in the literature and from preliminary experiments.
2.2 comparing the cell growth speed under the condition of existence of rhEGF, 5 lines of high-reactivity cell lines (shown in figure 1-1) are obtained by co-screening, while the growth speed of NIH3T 3-CRISPER 2(6) under the stimulation of rhEGF reaches 2 times of that of negative control (shown in figure 1-2), and the reactivity is the best, so the new rhEGF activation detection method is established by adopting NIH3T 3-CRISPER 2 (6).
2.3 NIH3T 3-CRISPERV 2(6) cell strain was identified by secondary sequencing and transcriptome heat map experiments that the knockout genes were Pcdhgb4 and H1fx, and gRNA was ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA (see FIG. 2).
2.4 establishment of detection method
The parameters of the dilution ratio of the drug, the cell plating density, the drug action time and the like are optimized respectively. The detection scheme is preliminarily determined: the density of cell plating was 6,000 cells/well, starved with PBS for 30min, the rhEGF drug pre-dilution concentration was 10IU/ml, 4 fold dilution, the drug stimulation time was 48 hours, and the serum concentration of the assay medium was 0.2% (see figure 3).
2.5 Activity assays were performed on 2 rhEGF samples using the newly constructed method (CRI-3T3) and the original method (3T3), respectively, with 50% recovery on the spiked samples, and the results for 2 samples are shown in FIG. 4. The results in the figure show that the recovery rate of the newly-established method (CRI-3T3) for detecting the sample 1 is between 85.8 and 107.8 percent, the coefficient of variation is 11.4 percent, the recovery rate of the sample 2 is between 87.2 and 103.0 percent, and the coefficient of variation is 8.3 percent; and the recovery rate of the original method (3T3) detection sample 1 is between 79.9 and 100.7 percent, the coefficient of variation is 11.5 percent, the recovery rate of the sample 2 is between 88.5 and 104.7 percent, and the coefficient of variation is 8.4 percent (see figure 4, table 1-1). The result proves that the newly-established method (CRI-3T3) has higher accuracy and is suitable for being used as a conventional method for detecting the activity of rhEGF.
2.6 Activity assay of 2 rhEGF samples with the newly established method (CRI-3T3), testing the precision of the method, repeating the assay 3 times per dose, measuring 9 times, calculating the precision within the day and the precision between the day (see Table 1-2). The intra-day precision of sample 1 is between 2.7-13.6%, and the inter-day precision is 12.0%; the intra-day precision of sample 2 was between 1.0-4.0% and the inter-day precision was 6.3%. The result proves that the method has better reproducibility and is suitable for being used as a conventional method to detect the activity of rhEGF.
2.7 the activity of rhEGF samples of the same batch is measured by two persons by a newly-built method, and the repeatability of the method is detected, wherein each person carries out 17 times. The results are shown in fig. 5, the results of the two persons have no significant difference (P is 0.3179), and the method has better repeatability.
2.8 the highly reactive cell strain NIH3T 3-CRISPERV 2(6) generation 6, generation 26 and generation 46 are respectively used for carrying out activity determination on the same rhEGF sample by using a new method, and the cell is detected to be used for determining the passage stability of the rhEGF. As shown in FIG. 6-1, the reactivity of the cells of different generations to rhEGF was stable, and the variation of the measured activity was 5.84%.
2.9 the new method is used to measure the activity of rhEGF, rhEPO, rhG-CSF, rhGM-CSF, rhIL-2, rhIL-11, rhIFN-gamma and rhIFN-alpha 2b samples, and the specificity of the method for measuring the activity of rhEGF is detected. The result is shown in FIG. 7, the rhEGF activity measuring method established by the cell NIH3T 3-CRISPER 2(6) has better specificity to rhEGF.
2.10 Activity assay of rhEGF samples with newly built method (CRI-3T3) and original method (3T3), multiple tests, detection of method consistency, signal to noise ratio, R between the two methods 2 And EC 50 A difference. The results are shown in FIGS. 8-1 and 8-2, where there is agreement between the two methods, R 2 And EC 50 The method has no significant difference, the average signal-to-noise ratio is respectively 1.845 and 1.657, P is 0.0170, and the signal-to-noise ratio of the newly-built method (CRI-3T3) is remarkably improved.
TABLE 1-1 comparison of recovery rates between the old and the new processes
TABLE 1-2 New method (CRI-3T3) for precision determination of rhEGF assay
Claims (3)
1. A highly reactive cell line for detecting the biological activity of a recombinant human epidermal growth factor, comprising: the original rhEGF is used for detecting living cells NIH3T3, genes Pcdhgb4 and H1fx are knocked out, a cell strain which is highly reactive to the rhEGF is obtained and is named as NIH3T3-CRISPRV2(6), and gRNAs of the genes are ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA respectively.
2. A method for detecting the biological activity of a recombinant human epidermal growth factor drug and derivatives thereof by using the highly reactive cell strain NIH3T 3-CRISPER 2(6) as claimed in claim 1, which is characterized in that: NIH3T 3-CRISPERV 2(6) at 6,000/well, laying 96-well plate, starving with PBS for 30min, adding assay medium containing serial concentrations of rhEGF, acting for 48h, and detecting cell activity by MTT method.
3. The method for detecting the biological activity of the recombinant human epidermal growth factor drug and the derivatives thereof by the highly reactive cell strain NIH3T 3-CRISPER 2(6) as claimed in claim 2, wherein: wherein the pre-dilution concentration of the rhEGF is 10IU/ml, the rhEGF is diluted by 4 times, and the serum concentration of an analysis culture medium is 0.2 percent.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810505966 | 2018-05-19 | ||
| CN2018105059669 | 2018-05-19 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499292A CN110499292A (en) | 2019-11-26 |
| CN110499292B true CN110499292B (en) | 2022-09-06 |
Family
ID=68585623
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910415900.5A Active CN110499292B (en) | 2018-05-19 | 2019-05-19 | High-reactivity cell strain for detecting biological activity of recombinant human epidermal growth factor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499292B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1360022A (en) * | 2000-12-19 | 2002-07-24 | 中国科学院上海生物化学研究所 | Recombinant human epidermal growth factor and its preparing process and medicinal composition |
| CN103060249A (en) * | 2012-06-06 | 2013-04-24 | 浙江普洛康裕制药有限公司 | Escherichia coli and method for efficiently secreting and expressing human epidermal growth factor by using same |
-
2019
- 2019-05-19 CN CN201910415900.5A patent/CN110499292B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1360022A (en) * | 2000-12-19 | 2002-07-24 | 中国科学院上海生物化学研究所 | Recombinant human epidermal growth factor and its preparing process and medicinal composition |
| CN103060249A (en) * | 2012-06-06 | 2013-04-24 | 浙江普洛康裕制药有限公司 | Escherichia coli and method for efficiently secreting and expressing human epidermal growth factor by using same |
Non-Patent Citations (3)
| Title |
|---|
| 《CRISPR/Cas9-sgRNA全基因组文库筛选人单核细胞白血病功能性促癌/抑癌基因体系的建立与优化》;陈晨等;《中国科学:生命科学》;20160720;第46卷(第7期);第839-841、848页 * |
| 《Enhancement of skin wound healing with decellularized scaffolds loaded with hyaluronic acid and epidermal growth factor》;Zhongchun Su等;《Materials Science and Engineering: C》;20140719;第44卷;第440-443页 * |
| 《Genome-wide CRISPR/Cas9 screen identifies host factors essential for influenza virus replication》;Julianna Han等;《Cell Reports》;20180410;第23卷(第2期);第596-607页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110499292A (en) | 2019-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6620130B2 (en) | High-throughput multiplex detection system, apparatus and method | |
| CN105483229B (en) | A kind of method and system of detection foetal chromosome aneuploidy | |
| CN108676920A (en) | It is a kind of quickly to detect mouse norovirus primer, kit and its RT-RPA methods | |
| CN112048560B (en) | Kit for analyzing HER2 gene copy number variation by combining multiple internal references with sequential probability ratio test and use method | |
| CN110499393A (en) | The real-time fluorescence quantitative PCR detection of hepatitis infectiosa canis virus, hepatitis infectiosa canis virus I type and hepatitis infectiosa canis virus II type and diagnostic primers and probe | |
| CN113707316A (en) | Immune state evaluation method and application | |
| CN104880555B (en) | A kind of high-flux detection method of HPV neutralizing antibody | |
| CN110499292B (en) | High-reactivity cell strain for detecting biological activity of recombinant human epidermal growth factor | |
| CN103255196A (en) | Method for detecting effect of Coptis chinensis alkaloid monomer on tumor cells | |
| CN108486281A (en) | Specific primer and probe for detecting HTLV- I and HTLV- II and fluorescent quantificationally PCR detecting kit | |
| CN108624713A (en) | A kind of porcine pseudorabies vaccine virus differentiates the method and kit of detection with wild poison | |
| CN111579789B (en) | Method for rapidly detecting varicella virus titer by using fluorescence method | |
| CN103820570B (en) | The prawn taura syndrome visual LAMP detection reagent of virus and detection method | |
| CN105891193A (en) | Chemiluminescent immune detection kit for respiratory syncytial virus and preparation method thereof | |
| CN102605105B (en) | Diagnostic kit used for identifying reverse transcription-composite nested polymerase chain reaction of swine fever vaccine strains and pandemic strains and detection method | |
| CN105177130A (en) | Markers for evaluating whether AIDS patients have immune reconstitution inflammatory syndrome or not | |
| CN116837142B (en) | Break point cluster zone Abelson leukemia virus calibrator and preparation method and application thereof | |
| CN114480730B (en) | RAA primer probe for detecting dove-tail virus and detection method | |
| CN116102629B (en) | Mycobacterium tuberculosis T cell epitope polypeptide and application thereof | |
| CN109946450B (en) | Detection method and detection kit for opioid active substances based on concentration change effect of intracellular free calcium ions | |
| CN110804643B (en) | Method for evaluating influence of BCG (bacillus calmette guerin) on neutrophil activity in vitro | |
| CN110244059B (en) | Application of group of serum proteins in preparation of early screening reagent for detecting human pneumoconiosis | |
| CN108957003A (en) | Detect purposes of the reagent of IFI44L albumen in reagent preparation box | |
| CN114152756A (en) | Novel coronavirus neutralizing antibody rapid quantitative detection method and application | |
| Montgomery | High standards for high dimensional investigations |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |