CN110499292A - It is a kind of for detecting the high response cell strain of recombinant human epidermal growth factor biological activity - Google Patents
It is a kind of for detecting the high response cell strain of recombinant human epidermal growth factor biological activity Download PDFInfo
- Publication number
- CN110499292A CN110499292A CN201910415900.5A CN201910415900A CN110499292A CN 110499292 A CN110499292 A CN 110499292A CN 201910415900 A CN201910415900 A CN 201910415900A CN 110499292 A CN110499292 A CN 110499292A
- Authority
- CN
- China
- Prior art keywords
- cell
- nih3t3
- rhegf
- cell strain
- medium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56966—Animal cells
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/475—Assays involving growth factors
- G01N2333/485—Epidermal growth factor [EGF] (urogastrone)
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Genetics & Genomics (AREA)
- Cell Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Virology (AREA)
- Food Science & Technology (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is a kind of for detecting the high response cell strain of recombinant human epidermal growth factor biological activity, living cells NIH3T3 is surveyed using original rhEGF, after the intracellular certain genes of random knockout, picking monoclonal, obtain cell strain NIH3T3-CRSPRV2 (6) better to rhEGF reactivity, NIH3T3-CRISPRV2 (6) cell strain is through the sequencing of two generations and transcript profile thermal map experimental identification, the certain genes knocked out are Pcdhgb4 and H1fx, and gRNA is respectively ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA.Specific detecting step are as follows: NIH3T3-CRSPRV2 (6) spreads 96 orifice plates with 6,000/hole, and with PBS starvation 30min, the analysis culture medium of the rhEGF containing series of concentrations is added, and acts on 48h, and mtt assay detects cell activity.The invention detection method operating time shortens, and is quick on the draw, and noise is relatively high, reduces serum interference, is of great significance for the quality control and clinical application of rhEGF.
Description
Technical field:
The present invention relates to bio-pharmaceutical Activity determination fields, for the biology of recombinant human epidermal growth factor (rhEGF)
Determination of activity filters out one plant of cell line to rhEGF high response, establishes more fast and accurately measuring method for activity.
Background technique:
Recombinant human epidermal growth factor (rhEGF) is a kind of using technique for gene engineering, by the epidermal growth factor subbase of people
Because being transferred in mammalian cell, the polypeptide that can promote various epidermal tissues' growths of high efficient expression, for treat burn and scald,
Ulcer, all kinds of wounds and corneal injury.Currently used activity determination method is NIH3T3 cell proliferation method, but NIH3T3 cell
It is poor to rhEGF reactivity, cause action concentration high；Experimental result variability is big；6 days experimental periods.We are by Mouse
CRISPR Knockout Pooled Library (GeCKO v2) (is purchased from Addgene company, peak building, is CRISPR-
Cas9 knocks out library) it is packaged as slow virus library, and NIH3T3 cell is infected by 0.3 MOI value with the library, thin with streaming
Born of the same parents' instrument is induced after sorting monoclonal with low dosage rhEGF, is filtered out to the more sensitive NIH3T3 cell line of rhEGF reactivity,
And it is low with Establishment of Cell Line action concentration, that degree of variation is small, experimental period is shorter is living for detecting rhEGF and its derivative
The detection method of property.
Summary of the invention:
Object of the present invention is to filter out one plant to the better cell strain of rhEGF reactivity, and one kind is established with the cell strain
The rhEGF activity determination method that action concentration is low, degree of variation is small, experimental period is shorter, promotes the research and development of the product, quality
Control and clinical application.
The object of the present invention is achieved like this: a kind of for detecting the height of recombinant human epidermal growth factor biological activity
Reactive cell strain NIH3T3-CRSPRV2 (6), it is characterised in that: living cells NIH3T3 is surveyed using original rhEGF, random
After knocking out intracellular certain genes, picking monoclonal obtains cell strain NIH3T3-CRSPRV2 better to rhEGF reactivity
(6), NIH3T3-CRISPRV2 (6) cell strain is through the sequencing of two generations and transcript profile thermal map experimental identification, certain genes of knockout
Pcdhgb4 and H1fx, gRNA are respectively ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA.
For detecting the high response cell strain NIH3T3-CRSPRV2 (6) of recombinant human epidermal growth factor biological activity
Preparation method, it is characterised in that: by by Mouse CRISPR Knockout Pooled Library (GeCKO v2) wrap
Dress is slow virus library (LentiCRISPR), and infects NIH3T3 cell by 0.3 MOI value with the library, then use fluidic cell
Instrument is induced after sorting monoclonal with low dosage rhEGF, is filtered out to the better NIH3T3 cell strain of rhEGF reactivity, i.e.,
NIH3T3-CRISPRV2 (6), through the sequencing of two generations and transcript profile thermal map experimental identification, certain genes of knockout be Pcdhgb4 and
H1fx, gRNA are respectively ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA.
The preparation method of high response cell strain NIH3T3-CRSPRV2 (6), it is characterised in that: preparation step is as follows:
One, material, reagent, instrument and analysis software
Material:
Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052): purchase in
Addgene；
NIH3T3 cell: purchase is in ATCC；
RhEGF standard items and sample: it retains National Institute for Food and Drugs Control's reconstituted drug room；
Reagent:
Growth medium :+10% fetal calf serum (GIBCO, #10099) of RPMI-1640 (GIBCO, C11875500BT)+
1%；
Dual anti-(GIBCO, #15240)；
Puromycin: Amresco, J593；
96 orifice plates: CORNING, 3599；
Selective agar medium :+4 μ g/ml puromycin of growth medium；
Induced medium: Selective agar medium+3.2IU/ml rhEGF；
Analyze culture medium: 500ml RPMI-1640+1ml fetal calf serum；
Instrument:
Flow cytometer, U.S. company BD-BD FACSAriaTMIII cell sorting system；
Microplate reader, SpectraMax M5；
Data Analysis Software:
SoftMax Pro software；
12.0 software of sigmaPlot；
Two, experiment flow:
1) building of LentiCRISPR
Take Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052) Library plasmid
100ng, it is electroporated to competent escherichia coli cell, it is coated with amicillin resistance LB plate screening, collects ammonia benzyl mould
Plain resistance clone extracts Library plasmid, 120ug plasmid library and viral packaging plasmid is transfected jointly to 293 cells, 24 hours
LentiCRISPR virus is collected afterwards, is frozen；Virus titer measurement: initiator cell sum × purine resisting cell number/(not plus fast
Purine cell number × virus volume) value be virus titer；
2) it infects
A) cell is collected, is counted, spreads cell in 9cm ware；
B) after cell is adherent, LentiCRISPR is taken, by MOI=0.3 infection cell；
C) after infecting 4 hours, growth medium culture 48h is added in removal infection liquid；
3) pressurization screening and monoclonal cell strain are separately cultured
A) growth medium is removed, is added Selective agar medium culture 1 week, the Selective agar medium of replacement in every 3-4 days, until thin
Born of the same parents' no longer large area apoptosis；
B) remaining cell is collected, after being resuspended with growth medium, is spread individual cells into 96 orifice plates with flow cytometer
Each hole in, amount to 24 blocks of plates.Non-infected cells negative control is set simultaneously；
C) after culture for 24 hours, growth medium is removed, induced medium is added.Negative control same treatment；
D) observation cell growth, pays attention to changing liquid, until find compared with negative control, it is raw under induced medium induction
The cell that long speed is obviously accelerated, and do expansion culture；
4) verifying and sequencing identification of high response cell strain
Further verifying is done to the cell for expanding culture, is filtered out under growth medium culture, the speed of growth and feminine gender
Control is without significant change；And under induced medium culture, the reaction of the cell strain that the speed of growth is obviously accelerated, as rhEGF high
Property cell strain；5 plants of rhEGF high response cell strain is obtained, wherein NIH3T3-CRISPRV2 (6) cell strain reactivity is best；
Three, the sequencing of two generations is carried out to NIH3T3-CRISPRV2 (6) cell strain and transcript profile thermal map is identified, determine its gene
Sequential structure is that knock out gene be Pcdhgb4 and H1fx, gRNA be respectively ATAGTCTGTGTTTCACTACC,
GCGCCCTCGCTAGGGCCCGA。
High response cell strain NIH3T3-CRISPRV2 (6) detection recombinant human epidermal growth factor of the present invention and its derivative
The detection method of object biological activity, it is characterised in that: NIH3T3-CRSPRV2 (6) spreads 96 orifice plates with 6,000/hole, uses
The analysis culture medium of the rhEGF containing series of concentrations is added in PBS starvation 30min, acts on 48h, and mtt assay detects cell activity.
Wherein rhEGF drug pre-dilution concentration is 10IU/ml, and 4 doubling dilutions, the serum-concentration for analyzing culture medium is
0.2%.
Beneficial effects of the present invention: the foundation of the detection method is conducive to the research and development of rhEGF drug, quality control and
Clinical application, application value with higher.
By having the following advantages compared with existing method:
(1) rhEGF action concentration is low, can preferably exclude in rhEGF drug auxiliary material to the active interference of rhEGF；
(2) when analysis culture, serum-concentration is reduced, and can reduce in serum growth factor to the active interference of rhEGF；
(3) period is short, and the more original NIH3T3 cell proliferation method of this method shortens the time 2 days；
(4) result is objective reliable, and accuracy is high, makes a variation small.
Detailed description of the invention:
The monoclonal cell and negative control cell growth fraction pair that Fig. 1-1 is filtered out
Fig. 1-2 rhEGF stimulates the speed of growth of lower high response cell strain
Fig. 2 high response cell strain and initial cell strain transcript profile thermal map comparison result
The rhEGF that Fig. 3 high response cell strain is established surveys new method living and archaeocyte rhEGF measuring method for activity
The comparison of new, the old measuring method for activity rate of recovery of Fig. 4
The method repeatability of Fig. 5 rebuilding method detects
The mitotic stability of Fig. 6 rebuilding method detects
The method specific detection of Fig. 7 rebuilding method
Fig. 8-1 is new, old measuring method for activity method comparison of coherence
Fig. 8-2 is new, old measuring method for activity method signal-to-noise ratio, R2、EC50Value compares.
Specific embodiment:
The present invention is by being packaged as slow disease for Mouse CRISPR Knockout Pooled Library (GeCKO v2)
Malicious library (LentiCRISPR), and NIH3T3 cell is infected by 0.3 MOI value with the library, then with selected by flow cytometry apoptosis list
With low dosage rhEGF induction after clone, filters out to the better NIH3T3 cell line of rhEGF reactivity, resettle corresponding inspection
Survey method quantifies rhEGF activity.Its techniqueflow are as follows: (NIH3T3 is thin for the screening of NIH3T3 high response cell strain
After born of the same parents are infected with LentiCRISPR, being induced with rhEGF) → rhEGF activity determination method is established and methodology validation.
1. materials and methods:
1.1 research objects: recombinant human epidermal growth factor
1.2Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052): purchase in
Addgene。
NIH3T3 cell: purchase is in ATCC.
RhEGF standard items and sample: it retains National Institute for Food and Drugs Control's reconstituted drug room.
1.3 reagents:
Growth medium :+10% fetal calf serum (GIBCO, #10099) of RPMI-1640 (GIBCO, C11875500BT)+
1% dual anti-(GIBCO, #15240)
Puromycin: Amresco, J593
96 orifice plates: CORNING, 3599
Selective agar medium :+4 μ g/ml puromycin of growth medium
Induced medium: Selective agar medium+3.2IU/ml rhEGF
Analyze culture medium: 500ml RPMI-1640+1ml fetal calf serum
1.4 instruments:
Flow cytometer, U.S. company BD-BD FACSAriaTMIII cell sorting system
Microplate reader, SpectraMax M5
1.5 Data Analysis Software:
SoftMax Pro software
12.0 software of sigmaPlot
1.6 experiment flows:
1.6.1 the building of LentiCRISPR
Take Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052) Library plasmid
100ng, it is electroporated to competent escherichia coli cell, it is coated with amicillin resistance LB plate screening, collects ammonia benzyl mould
Plain resistance clone extracts Library plasmid, 120ug plasmid library and viral packaging plasmid is transfected jointly to 293 cells, 24 hours
LentiCRISPR virus is collected afterwards, is frozen.Virus titer measurement: initiator cell sum × purine resisting cell number/(not plus fast
Purine cell number × virus volume) value be virus titer.
1.6.2 infection
1) cell is collected, is counted, spreads cell in 9cm ware；
2) after cell is adherent, LentiCRISPR is taken, by MOI=0.3 infection cell；
3) after infecting 4 hours, growth medium culture 48h is added in removal infection liquid；
1.6.3 pressurization screening and monoclonal cell strain are separately cultured
1) growth medium is removed, is added Selective agar medium culture 1 week, the Selective agar medium of replacement in every 3-4 days, until thin
Born of the same parents' no longer large area apoptosis；
2) remaining cell is collected, after being resuspended with growth medium, is spread individual cells into 96 orifice plates with flow cytometer
Each hole in, amount to 24 blocks of plates.Non-infected cells negative control is set simultaneously；
3) after culture for 24 hours, growth medium is removed, induced medium is added.Negative control same treatment；
4) observation cell growth, pays attention to changing liquid, until find compared with negative control, it is raw under induced medium induction
The cell that long speed is obviously accelerated, and do expansion culture；
1.6.4 the verifying and sequencing identification of high response cell strain
Further verifying is done to the cell for expanding culture, is filtered out under growth medium culture, the speed of growth and feminine gender
Control is without significant change；And under induced medium culture, the reaction of the cell strain that the speed of growth is obviously accelerated, as rhEGF high
Property cell strain.5 plants of rhEGF high response cell strain is obtained, wherein NIH3T3-CRISPRV2 (6) cell strain reactivity is best,
Subsequent measuring method for activity is established to be carried out using the cell strain.And the sequencing of two generations and the identification of transcript profile thermal map are carried out to the cell strain.
1.6.5 high response cell strain is used for the foundation of rhEGF activity determination method (CRI-3T3):
According to test result, 6,000/hole of cell density is with PBS starvation 30min, rhEGF pre-dilution concentration
10IU/ml, drug treating time 48h, detection rhEGF press the dose-effect curve of 4 doubling dilutions.
1.6.6 methodology validation
1.6.6.1 the rate of recovery
Determination of activity is carried out to 2 batches of rhEGF samples with rebuilding method (CRI-3T3) and original method (3T3) respectively, is done simultaneously
50% recovery of standard addition, 3 multiple holes of each dosage.
1.6.6.2 precision
Determination of activity is carried out to 2 batches of rhEGF samples with rebuilding method, detects the precision of this method, each dosage 3 multiple
Hole measures 9 times.
1.6.6.3 repeated
Determination of activity is carried out to batch rhEGF sample with rebuilding method by two people, detects the repeatability of this method, everyone does
17 times.1.6.6.4 mitotic stability
Respectively with the 6th generation of high response cell strain NIH3T3-CRISPRV2 (6), the 26th generation and the 46th generation with newly
Construction method carries out determination of activity to batch rhEGF sample, detects the cell and surveys mitotic stability living for rhEGF.
1.6.6.5 method specificity
With rebuilding method respectively to rhEGF, rhEPO, rhG-CSF, rhGM-CSF, rhIL-2, rhIL-11, rhIFN- γ,
RhIFN- α 2b sample carries out determination of activity, and detection this method is used for the specificity of rhEGF determination of activity.
1.6.6.6 the comparison of rebuilding method (CRI-3T3) and original method (3T3) two kinds of measuring method for activity
Determination of activity carried out to rhEGF sample with rebuilding method (CRI-3T3) and original method (3T3) respectively, test of many times,
Two methods of method consistency, signal-to-noise ratio, R between detection2And EC50Difference.
2. results and discussion
2.1 by LentiCRISPR with MOI=0.3 infection cell, infected slow virus its purpose is that reaching as far as possible
Cell has only infected a slow virus, avoids a cell infection into excessive slow virus, as far as possible convenient for analysis and verifying.And
0.3 MOI value is obtained in comprehensive literature report and preliminary result.
2.2 by the comparisons of vitro growth rates under the conditions of whether there is or not rhEGF, and screening obtains 5 plant height reactivity cells altogether
Strain (see Fig. 1-1), and NIH3T3-CRISPRV2 (6) speed of growth under rhEGF stimulation reaches 2 times of negative control (see Fig. 1-
2), reactivity is best, so the foundation that rhEGF surveys new method living is carried out using NIH3T3-CRISPRV2 (6).
Through the sequencing of two generations and transcript profile thermal map experimental identification, knock out gene is 2.3 NIH3T3-CRISPRV2 (6) cell strain
Pcdhgb4 and H1fx, gRNA are respectively ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA (see Fig. 2).
The foundation of 2.4 detection methods
Respectively to drug doubling dilution ratio, plating cells density, the parameters such as drug treating time are optimized.Tentatively
Detection scheme has been determined: plating cells density is 6,000 cells/well, dense with PBS starvation 30min, rhEGF drug pre-dilution
Degree is 10IU/ml, and 4 doubling dilutions, the medicine irritation time is 48 hours, and the serum-concentration for analyzing culture medium is 0.2% (see figure
3).2.5 carry out determination of activity to 2 batches of rhEGF samples with rebuilding method (CRI-3T3) and original method (3T3) respectively, do simultaneously
The rate of recovery result of 50% recovery of standard addition, 2 batches of samples is shown in Fig. 4.The result shows that, rebuilding method (CRI-3T3) detects sample in figure
The rate of recovery of product 1 is between 85.8-107.8%, the coefficient of variation 11.4%, the rate of recovery of sample 2 between 87.2-103.0%,
The coefficient of variation 8.3%；And the rate of recovery of original method (3T3) test sample 1 is between 79.9-100.7%, the coefficient of variation
11.5%, the rate of recovery of sample 2 is between 88.5-104.7%, the coefficient of variation 8.4% (see Fig. 4, table 1-1).As a result it proves new
The accuracy of construction method (CRI-3T3) is higher, is suitable as conventional method to detect rhEGF activity.
2.6 carry out determination of activity to 2 batches of rhEGF samples with rebuilding method (CRI-3T3), detect the precision of this method,
3 multiple holes of each dosage measure 9 times, calculate separately withinday precision and day to day precision (being shown in Table 1-2).The in a few days essence of sample 1
Density is between 2.7-13.6%, day to day precision 12.0%；The withinday precision of sample 2 is between 1.0-4.0%, in the daytime
Precision is 6.3%.As a result it proves that the reproducibility of this method is preferable, is suitable as conventional method to detect rhEGF activity.
2.7 carry out determination of activity to batch rhEGF sample with rebuilding method by two people, detect the repeatability of this method, often
People does 17 times.As a result see Fig. 5, there was no significant difference (P=0.3179) for two people's results, and method repeatability is preferably.
2.8 are used with the 6th generation of high response cell strain NIH3T3-CRISPRV2 (6), the 26th generation and the 46th generation respectively
Rebuilding method carries out determination of activity to batch rhEGF sample, detects the cell and surveys mitotic stability living for rhEGF.As a result
As in Figure 6-1, different generation cells are relatively stable to the reactivity of rhEGF, and surveying slip-knot fruit degree of variation is 5.84%.
2.9 with rebuilding method respectively to rhEGF, rhEPO, rhG-CSF, rhGM-CSF, rhIL-2, rhIL-11, rhIFN-
γ, rhIFN- α 2b sample carry out determination of activity, and detection this method is used for the specificity of rhEGF determination of activity.As a result such as Fig. 7 institute
Show, the rhEGF measuring method for activity that cell NIH3T3-CRISPRV2 (6) is established is preferable to the specificity of rhEGF.
2.10 carry out determination of activity to rhEGF sample with rebuilding method (CRI-3T3) and original method (3T3) respectively, repeatedly
It tests, two methods of method consistency, signal-to-noise ratio, R between detection2And EC50Difference.As a result as shown in Fig. 8-1,8-2, two kinds
It is with uniformity between method, R2And EC50There was no significant difference, and signal-to-noise ratio average value is respectively 1.845 and 1.657, P=
0.0170, there is significant difference, the signal-to-noise ratio of rebuilding method (CRI-3T3) is significantly improved.
Table 1-1 is new, the aging method rate of recovery compares
Table 1-2 rebuilding method (CRI-3T3) surveys precision detection living for rhEGF
Claims (5)
1. a kind of for detecting the high response cell strain NIH3T3-CRSPRV2 of recombinant human epidermal growth factor biological activity
(6), it is characterised in that: survey living cells NIH3T3 using original rhEGF, after the intracellular certain genes of random knockout, choose
Monoclonal is taken, cell strain NIH3T3-CRSPRV2 (6) better to rhEGF reactivity is obtained, NIH3T3-CRISPRV2 (6) is thin
Born of the same parents' strain is through the sequencing of two generations and transcript profile thermal map experimental identification, and certain genes of knockout are Pcdhgb4 and H1fx, and gRNA is respectively
ATAGTCTGTGTTTCACTACC、GCGCCCTCGCTAGGGCCCGA。
2. described in claim 1 for detecting the high response cell strain of recombinant human epidermal growth factor biological activity
The preparation method of NIH3T3-CRSPRV2 (6), it is characterised in that: by by Mouse CRISPR Knockout Pooled
Library (GeCKO v2) is packaged as slow virus library (LentiCRISPR), and is infected with the library by 0.3 MOI value
NIH3T3 cell, then induced with after selected by flow cytometry apoptosis monoclonal with low dosage rhEGF, it filters out to rhEGF reactivity more
Good NIH3T3 cell strain, i.e. NIH3T3-CRISPRV2 (6), through the sequencing of two generations and transcript profile thermal map experimental identification, knockout certain
A little genes are Pcdhgb4 and H1fx, and gRNA is respectively ATAGTCTGTGTTTCACTACC, GCGCCCTCGCTAGGGCCCGA.
3. the preparation method of high response cell strain NIH3T3-CRSPRV2 (6) according to claim 2, feature exist
In: preparation step is as follows:
One, material, reagent, instrument and analysis software
Material:
Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052): purchase in
Addgene；
NIH3T3 cell: purchase is in ATCC；
RhEGF standard items and sample: it retains National Institute for Food and Drugs Control's reconstituted drug room；
Reagent:
Growth medium :+10% fetal calf serum (GIBCO, #10099)+1% of RPMI-1640 (GIBCO, C11875500BT)；
Dual anti-(GIBCO, #15240)；
Puromycin: Amresco, J593；
96 orifice plates: CORNING, 3599；
Selective agar medium :+4 μ g/ml puromycin of growth medium；
Induced medium: Selective agar medium+3.2IU/ml rhEGF；
Analyze culture medium: 500ml RPMI-1640+1ml fetal calf serum；
Instrument:
Flow cytometer, U.S. company BD-BD FACSAriaTMIII cell sorting system；
Microplate reader, SpectraMax M5；
Data Analysis Software:
SoftMax Pro software；
12.0 software of sigmaPlot；
Two, experiment flow:
1) building of LentiCRISPR
Take Mouse CRISPR Knockout Pooled Library (GeCKO v2) (#1000000052) Library plasmid
100ng, it is electroporated to competent escherichia coli cell, it is coated with amicillin resistance LB plate screening, collects ammonia benzyl mould
Plain resistance clone extracts Library plasmid, 120ug plasmid library and viral packaging plasmid is transfected jointly to 293 cells, 24 hours
LentiCRISPR virus is collected afterwards, is frozen；Virus titer measurement: initiator cell sum × purine resisting cell number/(not plus fast
Purine cell number × virus volume) value be virus titer；
2) it infects
A) cell is collected, is counted, spreads cell in 9cm ware；
B) after cell is adherent, LentiCRISPR is taken, by MOI=0.3 infection cell；
C) after infecting 4 hours, growth medium culture 48h is added in removal infection liquid；
3) pressurization screening and monoclonal cell strain are separately cultured
A) growth medium is removed, is added Selective agar medium culture 1 week, the Selective agar medium of replacement in every 3-4 days, until cell is not
Large area apoptosis again；
B) remaining cell is collected, after being resuspended with growth medium, is spread individual cells into the every of 96 orifice plates with flow cytometer
In a hole, amount to 24 blocks of plates.Non-infected cells negative control is set simultaneously；
C) after culture for 24 hours, growth medium is removed, induced medium is added.Negative control same treatment；
D) observation cell growth, pays attention to changing liquid, until find compared with negative control, under induced medium induction, growth speed
The cell obviously accelerated is spent, and does expansion culture；
4) verifying and sequencing identification of high response cell strain
Further verifying is done to the cell for expanding culture, is filtered out under growth medium culture, the speed of growth and negative control
Without significant change；And under induced medium culture, the cell strain that the speed of growth is obviously accelerated, as rhEGF high response is thin
Born of the same parents' strain；5 plants of rhEGF high response cell strain is obtained, wherein NIH3T3-CRISPRV2 (6) cell strain reactivity is best；
Three, the sequencing of two generations is carried out to NIH3T3-CRISPRV2 (6) cell strain and transcript profile thermal map is identified, determine its gene order
Structure is that knock out gene be Pcdhgb4 and H1fx, gRNA be respectively ATAGTCTGTGTTTCACTACC,
GCGCCCTCGCTAGGGCCCGA。
4. a kind of high response cell strain NIH3T3-CRISPRV2 (6) described in claim 1 detection recombinant human epidermal growth
The detection method of the factor and its derivative biological activity, it is characterised in that: NIH3T3-CRSPRV2 (6) with 6,000/hole,
96 orifice plates are spread, with PBS starvation 30min, the analysis culture medium of the rhEGF containing series of concentrations is added, act on 48h, mtt assay detects cell
Activity.
5. high response cell strain NIH3T3-CRISPRV2 (6) according to claim 4 detection recombinant human epidermal growth because
The detection method of son and its derivative biological activity, it is characterised in that: wherein rhEGF drug pre-dilution concentration is 10IU/ml,
4 doubling dilutions, the serum-concentration for analyzing culture medium is 0.2%.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810505966 | 2018-05-19 | ||
| CN2018105059669 | 2018-05-19 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110499292A true CN110499292A (en) | 2019-11-26 |
| CN110499292B CN110499292B (en) | 2022-09-06 |
Family
ID=68585623
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910415900.5A Active CN110499292B (en) | 2018-05-19 | 2019-05-19 | High-reactivity cell strain for detecting biological activity of recombinant human epidermal growth factor |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110499292B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1360022A (en) * | 2000-12-19 | 2002-07-24 | 中国科学院上海生物化学研究所 | Recombinant human epidermal growth factor and its preparing process and medicinal composition |
| CN103060249A (en) * | 2012-06-06 | 2013-04-24 | 浙江普洛康裕制药有限公司 | Escherichia coli and method for efficiently secreting and expressing human epidermal growth factor by using same |
-
2019
- 2019-05-19 CN CN201910415900.5A patent/CN110499292B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1360022A (en) * | 2000-12-19 | 2002-07-24 | 中国科学院上海生物化学研究所 | Recombinant human epidermal growth factor and its preparing process and medicinal composition |
| CN103060249A (en) * | 2012-06-06 | 2013-04-24 | 浙江普洛康裕制药有限公司 | Escherichia coli and method for efficiently secreting and expressing human epidermal growth factor by using same |
Non-Patent Citations (3)
| Title |
|---|
| JULIANNA HAN等: "《Genome-wide CRISPR/Cas9 screen identifies host factors essential for influenza virus replication》", 《CELL REPORTS》 * |
| ZHONGCHUN SU等: "《Enhancement of skin wound healing with decellularized scaffolds loaded with hyaluronic acid and epidermal growth factor》", 《MATERIALS SCIENCE AND ENGINEERING: C》 * |
| 陈晨等: "《CRISPR/Cas9-sgRNA全基因组文库筛选人单核细胞白血病功能性促癌/抑癌基因体系的建立与优化》", 《中国科学:生命科学》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110499292B (en) | 2022-09-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Delgado et al. | Production of tumor necrosis factor-alpha, interleukin 1-beta, interleukin 2, and interleukin 6 by rat leukocyte subpopulations after exposure to substance P | |
| Cordingley et al. | Tumour necrosis factor as an autocrine tumour growth factor for chronic B-cell malignancies | |
| Bol et al. | The maturation state of three types of granulocyte/macrophage progenitor cells from mouse bone marrow | |
| CN105274053B (en) | A kind of preparation method of the CIK cell of high cytotoxic activity | |
| Wei et al. | A cell viability assessment approach based on electrical wound-healing impedance characteristics | |
| Scheele et al. | Kinetics of incorporation of structural proteins into Sindbis virions | |
| Rowe et al. | A graded-response assay for the Friend leukemia virus | |
| Xing et al. | Immature monocytes contribute to cardiopulmonary bypass-induced acute lung injury by generating inflammatory descendants | |
| CN111593022B (en) | vMIP-II induced CD8+ T cell dephosphorylation to Tcm and its application in medicine | |
| McDonald | A comparison of platelet size, platelet count, and platelet 35S incorporation as assays for thrombopoietin | |
| Ao et al. | Evaluation of cancer immunotherapy using mini-tumor chips | |
| CN103255196B (en) | Method for detecting effect of Coptis chinensis alkaloid monomer on tumor cells | |
| CN110499292A (en) | It is a kind of for detecting the high response cell strain of recombinant human epidermal growth factor biological activity | |
| Phillips et al. | Antibody‐producing cells: analysis and purification by velocity sedimentation | |
| Tan et al. | Interleukin-24 (IL-24) expression and biological impact on HECV endothelial cells | |
| CN109022488A (en) | A kind of conditionity cell immortality slow virus carrier and its construction method and the application in being is built in pig ovary granular cell | |
| Hansson et al. | A rapid method for detection of cellular proliferation using carboxyfluorescein assay of growth factors (IL-2, IL-1) and growth inhibiting antibodies | |
| Kenter et al. | Colcemid inhibits growth during early G1 in normal but not in tumorigenic lymphocytes | |
| CN102660505B (en) | Subcloned cell strain TF-1-A2, preparation method thereof and application | |
| Chen et al. | Modulation of human enteric epithelial barrier and ion transport function by Peyer’s patch lymphocytes | |
| CN109182275A (en) | RGA method detects pyrogen biological activity | |
| Dai et al. | Stemness-related changes of CD133-cells in nasopharyngeal carcinoma after x-ray radiation at the median lethal dose. | |
| CN110055217A (en) | The method for obtaining megacaryocyte and blood platelet | |
| CN108998408A (en) | The preparation method and application of high-throughput airway inflammation drug screening cell model based on NF- κ B signal access | |
| Tabuse et al. | Introduction of Haemoglobin Synthesis in Friend Leukaemia Cells without the Necessity of Mitosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |